The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	8104	80694	5492431	protease,tail,plate,head,capsid,tRNA,terminase,transposase	Pseudomonas_phage(38.46%)	78	NA	NA
WP_004177358.1|8104_9457_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_004145860.1|9488_11918_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_004178645.1|12039_12525_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_002889327.1|12528_13554_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_004145858.1|13659_14115_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004178647.1|14118_14907_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016946214.1|14906_16058_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_002889376.1|16054_16654_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_004177353.1|16671_20154_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
WP_004145855.1|20166_21126_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002889384.1|21239_23393_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_020801734.1|23439_23829_+	VOC family protein	NA	NA	NA	NA	NA
WP_004147166.1|23882_25196_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_002889424.1|25209_25470_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_002889429.1|25456_25657_-	YaeP family protein	NA	NA	NA	NA	NA
WP_002889431.1|25853_26399_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_002889433.1|26395_26809_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002889435.1|26851_27550_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_042939483.1|27681_28524_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_042939481.1|28582_30301_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002889441.1|30413_31121_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_002889443.1|31117_31525_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_002889445.1|31632_32448_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_002889448.1|32491_33145_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_002889450.1|33137_34169_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
WP_002889452.1|34357_34924_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_002889598.1|40773_41577_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
WP_173819837.1|42546_43641_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.8	1.8e-178
WP_173819838.1|43645_46432_-	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	88.2	0.0e+00
WP_115655926.1|46424_47048_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	41.5	9.1e-34
WP_104469778.1|47047_47791_-|tail	tail fiber protein	tail	A0A0E3GML4	Enterobacteria_phage	64.2	1.7e-18
WP_048756452.1|47802_48459_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.3	4.0e-32
WP_104469776.1|48455_49517_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	48.7	2.3e-77
WP_164839906.1|49516_49873_-	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	55.1	8.8e-26
WP_173819839.1|49938_50520_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	51.7	2.9e-34
WP_173819840.1|50503_51742_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	35.9	1.0e-68
WP_173819841.1|51725_53039_-	DNA circularization N-terminal domain-containing protein	NA	A0A0M3LQ21	Mannheimia_phage	22.8	3.0e-26
WP_173819842.1|53038_55216_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	26.7	1.4e-33
WP_173820037.1|55329_55611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173819843.1|55724_56099_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	53.4	3.2e-26
WP_173819844.1|56112_57531_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	50.1	4.5e-105
WP_020804729.1|57530_57728_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_115660523.1|57708_58368_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_020804749.1|58364_58793_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_080864114.1|58805_59204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064141751.1|59204_60113_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	59.6	2.5e-101
WP_064141750.1|60124_60520_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	50.0	1.2e-23
WP_064143931.1|60512_61598_-|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	42.6	6.8e-53
WP_023158175.1|61832_62375_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	35.7	1.0e-09
WP_173819845.1|62364_63636_-|capsid	minor capsid protein	capsid	A0A0A7DJT5	Pseudomonas_phage	36.2	5.2e-52
WP_173819846.1|63628_65197_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	47.6	1.8e-126
WP_173819847.1|65196_66900_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	64.3	3.7e-194
WP_049593303.1|66902_67232_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	66.7	2.6e-32
WP_020804740.1|67235_67445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110226831.1|67437_67938_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	53.6	1.7e-46
WP_023158167.1|67939_68254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804737.1|68250_68496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173819848.1|68492_69128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023158165.1|69117_69366_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_173819849.1|69347_70001_-	glycoside hydrolase family 19 protein	NA	A0A2D1GNI0	Pseudomonas_phage	57.1	2.0e-60
WP_173819850.1|70081_70618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173819851.1|70583_71018_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	44.5	3.4e-27
WP_173819852.1|70962_71439_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	61.5	2.4e-42
WP_023158160.1|71498_71714_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	66.2	7.4e-20
WP_074185589.1|71694_72024_-	DUF977 family protein	NA	NA	NA	NA	NA
WP_032415579.1|72181_72721_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	66.9	1.1e-56
WP_032415578.1|72717_72942_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	52.8	2.0e-15
WP_001339197.1|73223_74432_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_173819853.1|74410_74809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804721.1|75049_75238_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	52.5	3.5e-05
WP_173819854.1|75239_75878_-	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	63.5	4.4e-68
WP_023158152.1|75870_76062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032415574.1|76063_76297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126066056.1|76316_76532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173819855.1|76540_77434_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	60.5	1.2e-100
WP_173819856.1|77443_79495_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	49.1	1.3e-174
WP_173819857.1|79518_79782_-	helix-turn-helix domain-containing protein	NA	A0A2P9JZG5	Alteromonadaceae_phage	70.0	9.4e-25
WP_173819858.1|79959_80694_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	39.3	3.6e-29
>prophage 2
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	842384	851847	5492431	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_086627161.1|842384_843500_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|843496_845437_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|845513_845735_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|846060_846378_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|846408_848688_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|848807_849026_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|849379_850081_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_009484119.1|850125_851847_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	1118877	1199049	5492431	holin,protease,tail,portal,tRNA,terminase,integrase,transposase	Enterobacteria_phage(26.32%)	89	1109162:1109176	1152002:1152016
1109162:1109176	attL	GACATTTTCTGGTCA	NA	NA	NA	NA
WP_004150803.1|1118877_1119984_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|1120040_1120499_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|1120515_1121166_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|1121406_1122657_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_110228966.1|1122774_1123902_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_012542206.1|1123882_1124128_-	excisionase	NA	NA	NA	NA	NA
WP_167875589.1|1124180_1124471_-	3'-5' exoribonuclease	NA	A0A2I7RDR9	Vibrio_phage	57.0	1.3e-22
WP_014228879.1|1124685_1125030_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|1125072_1125267_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|1125656_1125971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418059.1|1126291_1126681_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	63.4	1.4e-37
WP_004147982.1|1126816_1127038_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_032418032.1|1127040_1127595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072031995.1|1127639_1128659_+	helix-turn-helix domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	35.5	1.3e-32
WP_032418060.1|1128651_1129116_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.9	6.9e-63
WP_032418033.1|1129129_1129570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418061.1|1130132_1132139_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001339197.1|1132607_1133816_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_173819891.1|1133888_1134845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048290151.1|1135125_1136298_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_048290152.1|1136722_1136956_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	69.7	2.4e-24
WP_165476662.1|1137018_1137258_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_131082165.1|1137298_1137691_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_173819892.1|1137890_1138949_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.7	5.7e-105
WP_131082163.1|1138969_1139668_+	antitermination protein	NA	NA	NA	NA	NA
WP_169546928.1|1139874_1140678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075208973.1|1140831_1141101_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	84.8	4.2e-36
WP_131066624.1|1141072_1141612_+	lysozyme	NA	K7PM52	Enterobacteria_phage	73.6	1.2e-74
WP_131066636.1|1141644_1142121_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_131082162.1|1142202_1142511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077273936.1|1142615_1142930_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.8	7.5e-29
WP_023342892.1|1143161_1143650_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_016530357.1|1143649_1145752_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_023342890.1|1145748_1145961_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_016530355.1|1145960_1147463_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	6.2e-246
WP_071887248.1|1147413_1149435_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.8	0.0e+00
WP_016530353.1|1149518_1149845_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_173819893.1|1149837_1150113_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530351.1|1150116_1150695_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
WP_016530350.1|1150691_1151093_+|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_016530349.1|1151101_1151845_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_077258542.1|1151855_1152284_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.7	2.1e-37
1152002:1152016	attR	TGACCAGAAAATGTC	NA	NA	NA	NA
WP_071609142.1|1152304_1152619_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_134872456.1|1152602_1155746_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.0	0.0e+00
WP_023342885.1|1155750_1156098_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_131082158.1|1156094_1156850_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	83.7	1.4e-129
WP_023342884.1|1156851_1157562_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530340.1|1157593_1158184_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_134872457.1|1158246_1167180_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	44.7	0.0e+00
WP_025368254.1|1167248_1168745_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	6.4e-126
WP_004892953.1|1168899_1169052_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004213085.1|1169324_1170038_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|1170034_1170427_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|1170419_1170743_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048263900.1|1170831_1171038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|1171191_1171419_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|1171531_1172725_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004213087.1|1172792_1173128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|1173347_1173533_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|1173623_1174118_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|1174144_1174651_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|1174667_1175555_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|1175610_1177017_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|1177013_1178024_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|1178139_1178337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|1178903_1179536_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032409986.1|1179575_1179755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|1180152_1180839_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032415973.1|1180951_1181116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|1181149_1182658_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|1182778_1183669_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019705575.1|1183675_1185460_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|1185533_1186742_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|1187044_1188088_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|1188749_1189664_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|1189753_1190392_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|1190522_1190786_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|1190845_1190971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|1191088_1191163_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|1191162_1191264_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001339197.1|1191766_1192975_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004179368.1|1193973_1194213_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|1194202_1194541_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004190885.1|1194545_1195055_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|1195200_1195893_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|1195924_1197100_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|1197207_1198002_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|1197985_1198432_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|1198548_1199049_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	1309484	1360113	5492431	holin,tail,terminase,integrase,transposase	Enterobacteria_phage(21.57%)	65	1312164:1312179	1366717:1366732
WP_004140269.1|1309484_1310294_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|1310295_1311288_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|1311287_1312178_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1312164:1312179	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_032445489.1|1312324_1313542_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	2.5e-120
WP_004892750.1|1313762_1314002_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_032445491.1|1314009_1314318_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
WP_032445494.1|1314314_1314926_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	76.3	4.1e-39
WP_032445496.1|1314918_1315263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804298.1|1315297_1316386_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	53.3	5.5e-103
WP_173819897.1|1316398_1319506_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	56.7	2.4e-292
WP_016946289.1|1319643_1319799_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_080783016.1|1319808_1320000_-	YebW family protein	NA	NA	NA	NA	NA
WP_048997841.1|1320486_1320696_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	5.0e-21
WP_063422095.1|1320782_1321151_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_044245063.1|1321154_1321574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173819898.1|1321592_1321976_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	84.0	4.5e-52
WP_023282398.1|1322074_1322293_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
WP_173819899.1|1322295_1322832_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.2	7.7e-58
WP_173819900.1|1322843_1323104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032446341.1|1323181_1324102_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_023301220.1|1324098_1324842_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	55.6	4.1e-65
WP_016946299.1|1324834_1325170_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_115667100.1|1325162_1325948_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	2.5e-65
WP_048279473.1|1325944_1326148_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	83.3	3.8e-26
WP_020804604.1|1326140_1326395_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804600.1|1326391_1326613_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_032417030.1|1326616_1327045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413665.1|1327140_1327440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|1328191_1328425_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|1328530_1328779_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_064164738.1|1328813_1329410_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.6	3.8e-90
WP_173819901.1|1329618_1329915_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	2.1e-36
WP_023282412.1|1329911_1330268_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1330383_1331205_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_025983157.1|1331896_1332292_+|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_173819902.1|1332278_1332560_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	5.9e-33
WP_004899661.1|1332559_1333189_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	77.5	3.1e-90
WP_117086704.1|1333191_1333467_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	39.3	1.1e-07
WP_016831932.1|1333650_1333851_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
WP_048271635.1|1334248_1334494_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	2.7e-18
WP_025713971.1|1334567_1334984_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_173819903.1|1335242_1336247_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
WP_071033688.1|1336224_1337532_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	2.3e-148
WP_047694609.1|1337531_1338932_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	4.1e-127
WP_117055504.1|1338915_1340028_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.9	4.8e-110
WP_032417039.1|1340112_1340898_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
WP_032410237.1|1340908_1341862_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
WP_158414530.1|1341870_1342143_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_008807837.1|1342183_1342579_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190649.1|1342580_1342835_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|1342844_1343078_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_032417040.1|1343064_1343448_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	1.6e-20
WP_032417041.1|1343449_1344001_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.5	1.2e-29
WP_004190640.1|1343997_1344390_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_173819904.1|1344413_1345586_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_059065378.1|1345641_1346124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123235785.1|1346261_1346459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173819905.1|1346526_1347411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|1347593_1348802_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_173819906.1|1348853_1351754_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.3	1.5e-102
WP_032417047.1|1351753_1352218_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_032417048.1|1352398_1352881_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	93.8	2.9e-80
WP_016946669.1|1352890_1353271_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	3.1e-69
WP_032417049.1|1353267_1356336_+	kinase	NA	A0A286S259	Klebsiella_phage	96.3	0.0e+00
WP_032417050.1|1359018_1360113_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.8	2.0e-177
1366717:1366732	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 5
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	1396597	1476090	5492431	transposase,holin,protease,tail,plate,head,capsid,terminase,integrase,portal	Klebsiella_phage(45.83%)	79	1401969:1401985	1446252:1446268
WP_001339197.1|1396597_1397806_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_042938106.1|1398711_1399596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173819910.1|1399768_1400905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052264171.1|1400970_1402173_+	MFS transporter	NA	NA	NA	NA	NA
1401969:1401985	attL	GGGCGGCGGGCTGATGG	NA	NA	NA	NA
WP_004152141.1|1402251_1403121_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004176439.1|1403667_1403856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042938114.1|1404156_1405071_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176437.1|1405179_1405941_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_016197745.1|1407888_1408437_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_019705445.1|1408633_1409815_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.0	6.2e-201
WP_004198241.1|1409795_1409987_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
WP_029602963.1|1410123_1410525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602964.1|1410521_1410746_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
WP_029602965.1|1410735_1411446_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	87.9	1.2e-111
WP_032422926.1|1411451_1411970_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_023304718.1|1412074_1412902_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_009309071.1|1412898_1413093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602967.1|1413089_1413515_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	76.5	6.6e-52
WP_004177208.1|1413511_1413730_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_029602968.1|1413701_1413956_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_023304721.1|1413948_1414314_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|1414314_1414539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602969.1|1414721_1415135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|1415298_1415958_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_071646927.1|1416113_1416347_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_072002489.1|1417065_1418724_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	99.3	0.0e+00
WP_116961294.1|1418725_1419688_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.7	4.8e-183
WP_040088851.1|1419684_1420161_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
WP_023304725.1|1420157_1420973_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	77.9	4.4e-113
WP_004184721.1|1421129_1421387_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_031280381.1|1421292_1421739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|1422381_1422681_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_029602975.1|1422677_1423217_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	97.8	1.3e-100
WP_029602976.1|1423213_1423558_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	3.9e-39
WP_110244697.1|1423554_1423830_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	78.0	2.2e-08
WP_004184720.1|1424065_1424350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116961293.1|1424482_1424755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029603004.1|1425078_1425324_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	4.7e-18
WP_029603005.1|1425379_1425721_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	1.0e-47
WP_004177162.1|1425903_1426368_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_004177157.1|1426321_1428064_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	2.8e-141
WP_040088853.1|1428063_1429371_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.5	5.4e-214
WP_023317649.1|1429384_1430233_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.6	3.0e-136
WP_021441630.1|1430242_1431460_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	3.6e-196
WP_004177149.1|1431798_1432125_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_038435250.1|1432136_1432475_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	9.2e-41
WP_040088856.1|1432471_1432921_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.9	6.1e-64
WP_042947699.1|1432917_1433265_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
WP_047671839.1|1433321_1434026_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.9e-80
WP_021313622.1|1434056_1434461_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_040088907.1|1434463_1434769_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	1.6e-28
WP_116961328.1|1434843_1435227_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.1	5.2e-32
WP_173819911.1|1435293_1438701_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	42.5	4.4e-191
WP_004177132.1|1438722_1439196_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004177130.1|1439182_1439659_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177128.1|1439671_1440052_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_173819912.1|1440048_1443126_+	kinase	NA	A0A286S259	Klebsiella_phage	61.7	0.0e+00
WP_173819913.1|1445810_1446908_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.8	4.0e-178
1446252:1446268	attR	GGGCGGCGGGCTGATGG	NA	NA	NA	NA
WP_173819914.1|1447035_1447848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|1449028_1449277_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_004176434.1|1450122_1450614_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190552.1|1450656_1452201_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022615502.1|1452210_1453554_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190548.1|1453550_1454240_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042938116.1|1454236_1455943_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|1455947_1456439_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042938119.1|1456703_1459358_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.2e-97
WP_004224357.1|1459359_1461729_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	2.4e-18
WP_004224359.1|1461729_1462509_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_042938122.1|1462572_1463166_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_042938124.1|1463233_1463764_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_042938126.1|1463832_1464363_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_086627217.1|1464350_1466792_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|1466812_1467070_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040146284.1|1467066_1468206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040146281.1|1468189_1471618_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004183804.1|1471614_1473207_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_040146278.1|1473286_1475041_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004176418.1|1475004_1476090_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	1669336	1680223	5492431		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1669336_1669957_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_173819928.1|1669949_1671215_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	4.3e-232
WP_002903955.1|1671226_1672129_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1672389_1673151_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|1673171_1674032_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|1674329_1674590_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|1674676_1675765_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|1675795_1677061_-	MFS transporter	NA	NA	NA	NA	NA
WP_065901146.1|1677115_1680223_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 7
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	2444064	2494845	5492431	terminase,holin,head,integrase	Cronobacter_phage(22.58%)	78	2442651:2442678	2491899:2491926
2442651:2442678	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_042938019.1|2444064_2445156_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	83.5	1.9e-172
WP_086627443.1|2447882_2450360_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.4	2.6e-196
WP_042937281.1|2450346_2450742_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	2.1e-36
WP_042937280.1|2450738_2451209_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	3.3e-28
WP_023342746.1|2451208_2451685_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	2.5e-36
WP_173819960.1|2451727_2454991_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	60.4	2.7e-238
WP_042937289.1|2455062_2455533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937278.1|2455803_2456145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255888.1|2456395_2456755_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	1.4e-15
WP_042937275.1|2457341_2457920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052264160.1|2458011_2458599_-	HNH endonuclease	NA	G0ZNE5	Cronobacter_phage	38.6	1.9e-25
WP_042937274.1|2458668_2459385_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.2	4.1e-62
WP_042937273.1|2459453_2460218_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	1.6e-40
WP_024622701.1|2460276_2460660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937272.1|2460656_2461025_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.7e-48
WP_128337600.1|2461084_2461303_-	hypothetical protein	NA	A0A2D2W2V0	Stenotrophomonas_phage	45.7	1.2e-09
WP_042937271.1|2461331_2461694_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.0	1.6e-27
WP_032752624.1|2461693_2461867_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_042937269.1|2461866_2462247_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_042937267.1|2462249_2462489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937265.1|2462499_2463594_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.5	8.2e-123
WP_004151271.1|2463605_2464034_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_042937263.1|2464037_2465219_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	42.8	3.6e-92
WP_042937261.1|2465631_2466627_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.3e-114
WP_042937259.1|2466559_2468023_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	1.2e-148
WP_042937257.1|2468035_2469508_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	1.5e-249
WP_040245563.1|2469507_2470110_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	6.4e-77
WP_077255887.1|2470292_2470877_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	46.5	1.4e-39
WP_042937253.1|2471104_2471455_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	38.9	1.0e-10
WP_042937252.1|2471451_2471946_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	94.5	6.6e-88
WP_019704119.1|2471923_2472148_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_042937251.1|2472632_2473247_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	98.0	1.6e-112
WP_042937250.1|2473243_2473426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967714.1|2473413_2473611_-	protein ninH	NA	I6RSQ6	Salmonella_phage	66.7	1.2e-16
WP_042937249.1|2473607_2473832_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	85.1	2.1e-33
WP_042937248.1|2473828_2474194_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	76.7	7.9e-46
WP_042937247.1|2474190_2474481_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	84.2	1.7e-43
WP_072039973.1|2474464_2474650_-	NinF family protein	NA	I6R994	Salmonella_phage	71.4	2.8e-15
WP_042937246.1|2474642_2474822_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	68.5	1.3e-14
WP_042937245.1|2474791_2474962_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	84.0	5.7e-23
WP_042937244.1|2474958_2475369_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	85.9	6.8e-62
WP_042937243.1|2475417_2475657_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	1.1e-08
WP_042937242.1|2475649_2475955_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	62.0	3.6e-28
WP_042937241.1|2475951_2476503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937240.1|2476499_2477042_-	hypothetical protein	NA	A0A0S1S1U7	Klebsiella_phage	58.1	2.5e-19
WP_042937239.1|2477038_2477341_-	hypothetical protein	NA	F1C5B5	Cronobacter_phage	50.9	1.6e-07
WP_042937238.1|2477337_2477763_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	5.5e-59
WP_086627474.1|2478144_2478897_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	85.6	2.6e-128
WP_074384543.1|2478893_2479151_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	72.9	3.6e-29
WP_086627476.1|2479147_2479681_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	29.1	3.6e-07
WP_042937230.1|2479677_2479902_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	51.5	1.1e-13
WP_042937228.1|2480215_2480416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937226.1|2480412_2481012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042937223.1|2481011_2482445_-	AAA family ATPase	NA	Q716D2	Shigella_phage	85.3	6.1e-227
WP_042937221.1|2482434_2483328_-	hypothetical protein	NA	G5DA89	Enterobacteria_phage	70.3	2.2e-105
WP_012967698.1|2483314_2483476_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	92.5	3.3e-20
WP_042937218.1|2483510_2483810_-	hypothetical protein	NA	A2SY75	Escherichia_phage	70.0	3.6e-28
WP_077203341.1|2483915_2484125_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.2	4.4e-09
WP_042937216.1|2484231_2484828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042937214.1|2485225_2485513_+	hypothetical protein	NA	A0A0K2FII1	Escherichia_phage	66.7	1.9e-07
WP_042937212.1|2485559_2486102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255886.1|2486250_2486415_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_142285263.1|2486401_2486764_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	40.8	1.7e-08
WP_042937206.1|2486891_2487200_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	51.0	4.2e-24
WP_042937204.1|2487196_2488090_+	recombinase RecT	NA	K7P7A0	Enterobacteria_phage	83.7	2.3e-139
WP_173819961.1|2488082_2488565_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	76.2	4.2e-63
WP_042937200.1|2488871_2489144_+	DUF5405 family protein	NA	Q716F1	Shigella_phage	66.7	1.4e-23
WP_072039971.1|2489140_2489308_+	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	53.2	6.6e-08
WP_042937198.1|2489307_2489646_+	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	50.0	1.7e-23
WP_042937284.1|2489681_2489939_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	3.2e-25
WP_072039974.1|2490027_2490375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967684.1|2490496_2490769_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	61.1	3.0e-26
WP_042937196.1|2490737_2491823_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.6e-147
WP_002911404.1|2492161_2492500_-	YebY family protein	NA	NA	NA	NA	NA
2491899:2491926	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_032420215.1|2492516_2493386_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_004151448.1|2493389_2493764_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_040210823.1|2493876_2494107_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|2494185_2494845_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 8
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	2735341	2742244	5492431	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004189109.1|2735341_2736820_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|2736816_2737539_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|2737855_2739217_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|2739459_2740356_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|2740596_2741370_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_042937159.1|2741380_2742244_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	9.7e-10
>prophage 9
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	2954157	3040789	5492431	protease,tail,holin,head,portal,capsid,tRNA,terminase,integrase,transposase	Escherichia_phage(20.0%)	87	2976888:2976912	3017759:3017783
WP_002913226.1|2954157_2954970_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|2954969_2955983_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040147248.1|2956046_2957183_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.2e-20
WP_032423559.1|2957293_2958271_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|2958357_2959533_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|2959742_2960963_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023285399.1|2961121_2963110_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|2963171_2963453_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|2963484_2964033_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|2964032_2964842_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|2964841_2965666_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_040147249.1|2965668_2966754_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.5e-89
WP_002913346.1|2966795_2967728_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|2967895_2968447_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|2968467_2968953_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023282886.1|2969162_2971307_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|2971306_2972617_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|2972776_2973061_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913360.1|2973434_2974757_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|2974818_2975580_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|2975869_2976799_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
2976888:2976912	attL	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_032434919.1|2977497_2978586_+	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
WP_032434917.1|2978620_2979715_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
WP_001339197.1|2982539_2983748_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_032434913.1|2986811_2987192_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
WP_023302606.1|2987204_2987681_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_004884312.1|2987667_2988141_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_032434911.1|2988162_2991549_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
WP_016530182.1|2991610_2991844_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530183.1|2991917_2992223_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_032434909.1|2992225_2992630_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
WP_032412035.1|2992660_2993365_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_023302599.1|2993421_2993769_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|2993765_2994215_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_031592512.1|2994211_2994550_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
WP_023316722.1|2994558_2994876_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_004104235.1|2994953_2996192_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_032434907.1|2996201_2996801_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
WP_032434905.1|2996793_2998020_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000246643.1|2998167_2999919_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
WP_032434902.1|2999922_3000420_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_032434901.1|3000578_3000929_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
WP_032434899.1|3001128_3001788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434896.1|3001989_3002265_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
WP_032434894.1|3002272_3002902_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
WP_019705280.1|3002901_3003183_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|3003169_3003565_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_032434891.1|3004063_3004219_-	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
WP_032412064.1|3004215_3004641_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
WP_004899672.1|3004860_3005439_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_032434890.1|3005452_3006433_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
WP_000779146.1|3006445_3006823_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032434888.1|3006832_3007642_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	2.9e-109
WP_017880208.1|3007638_3008592_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_001208720.1|3008581_3008761_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_004213338.1|3008998_3009460_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001191665.1|3009494_3009737_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_000690183.1|3009834_3010530_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_024623196.1|3011158_3011458_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_032434886.1|3011457_3012243_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
WP_021314787.1|3012370_3013447_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
WP_004864289.1|3013822_3014338_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_077254126.1|3015145_3015346_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
WP_123618668.1|3015447_3016290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434882.1|3016394_3017564_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
WP_002913367.1|3018083_3018566_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3017759:3017783	attR	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_004149226.1|3018933_3019815_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004149227.1|3019824_3020733_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023282887.1|3020865_3021324_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.9	3.8e-13
WP_023282888.1|3021320_3022517_+	cyanate transporter	NA	NA	NA	NA	NA
WP_099119320.1|3022855_3022927_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_002913372.1|3022997_3024212_-	alanine transaminase	NA	NA	NA	NA	NA
WP_032409803.1|3024300_3024486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153200.1|3024482_3024596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149230.1|3024594_3026292_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|3026303_3027041_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_002913377.1|3027094_3028060_-	glucokinase	NA	NA	NA	NA	NA
WP_004154521.1|3028323_3029559_+	ion channel protein	NA	NA	NA	NA	NA
WP_009309545.1|3029555_3031217_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004174934.1|3031397_3032390_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002913419.1|3032520_3032880_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002913421.1|3032937_3034179_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002913423.1|3034525_3035728_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_004151096.1|3035776_3037948_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913434.1|3038569_3038923_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913435.1|3038926_3039319_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004145598.1|3039370_3040789_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP054303	Klebsiella pneumoniae strain MS14393 chromosome, complete genome	5492431	3205072	3288406	5492431	protease,tail,holin,head,capsid,tRNA,terminase,integrase,portal	Klebsiella_phage(71.43%)	93	3200359:3200374	3298370:3298385
3200359:3200374	attL	AAACCTGCAGCGCGAA	NA	NA	NA	NA
WP_002914089.1|3205072_3206158_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|3206361_3206787_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_042936772.1|3206856_3207555_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_042936775.1|3207589_3210241_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004180947.1|3210361_3211717_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004899914.1|3211758_3212082_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004144368.1|3212085_3213384_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
WP_042937525.1|3219261_3221835_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_004212956.1|3221964_3222696_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_040172544.1|3222692_3223673_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|3223804_3224542_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|3224812_3225148_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|3225254_3225302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|3225402_3226563_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004174805.1|3226559_3227432_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_040146086.1|3227494_3228616_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|3228625_3229696_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|3230038_3230548_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|3230540_3231764_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004145671.1|3231777_3232260_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|3232268_3233639_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004174802.1|3233695_3234154_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3234273_3234621_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|3234660_3235428_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|3235459_3236008_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|3236026_3236275_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|3236534_3237899_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|3238062_3238854_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|3238873_3240160_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|3240279_3240870_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|3240994_3241873_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174799.1|3241959_3243621_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|3243768_3244110_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|3244176_3244467_-	RnfH family protein	NA	NA	NA	NA	NA
WP_015875096.1|3244456_3244933_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|3245043_3245526_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_060184360.1|3246303_3246552_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	3.6e-26
WP_149795616.1|3246860_3247085_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	78.0	7.3e-18
WP_133061045.1|3247191_3248037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135729215.1|3248246_3249341_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	85.7	9.9e-177
WP_135729214.1|3252024_3255093_-	kinase	NA	A0A286S259	Klebsiella_phage	96.8	0.0e+00
WP_017880229.1|3255089_3255470_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_117264102.1|3255479_3255962_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	3.7e-83
WP_094354457.1|3255948_3256428_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.1e-92
WP_040182604.1|3256427_3258875_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004143894.1|3258919_3259387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|3259452_3259716_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|3259748_3260102_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|3260145_3260637_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_087637325.1|3260693_3261059_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.0e-61
WP_094354456.1|3261055_3261595_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.9	1.5e-93
WP_065799391.1|3261587_3261920_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	96.4	6.5e-55
WP_065799390.1|3261921_3262119_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	93.8	1.6e-24
WP_040186860.1|3262179_3262506_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
WP_044067369.1|3262453_3262696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032416975.1|3262732_3263896_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
WP_004216821.1|3263907_3264588_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_065799389.1|3264593_3265871_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.8	3.1e-246
WP_004143904.1|3265873_3267406_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|3267415_3267850_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040213586.1|3267970_3268180_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	88.4	1.2e-25
WP_049109190.1|3268192_3268483_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_094354455.1|3268551_3269037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064171958.1|3269155_3269401_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.7e-18
WP_094354454.1|3269720_3269912_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	4.4e-24
WP_040236329.1|3269862_3270138_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
WP_023316711.1|3270145_3270775_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
WP_023317187.1|3270774_3271053_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
WP_023317188.1|3271042_3271435_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
WP_023317190.1|3271686_3272235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317191.1|3272454_3273237_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
WP_004198239.1|3273233_3273710_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3273706_3274669_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3274670_3276329_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3276905_3277127_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3277224_3277893_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3278063_3278378_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_094354453.1|3278370_3278559_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	98.4	2.3e-25
WP_004152158.1|3278728_3279094_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3279086_3279341_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3279312_3279531_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|3279527_3279953_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_009309071.1|3279949_3280144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3280140_3280968_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3281072_3281591_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_032441077.1|3281596_3282322_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	98.3	2.7e-130
WP_023317194.1|3282311_3282536_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_004152150.1|3282532_3282745_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_023317195.1|3282802_3283015_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	74.2	8.4e-24
WP_023317196.1|3282969_3284145_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.8	7.3e-210
WP_023317197.1|3284632_3285541_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
WP_151425524.1|3285881_3287123_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.4	5.9e-101
WP_013365117.1|3288193_3288406_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.0	5.4e-07
3298370:3298385	attR	AAACCTGCAGCGCGAA	NA	NA	NA	NA
>prophage 1
NZ_CP054304	Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence	216803	14907	62475	216803	transposase,bacteriocin	uncultured_Caudovirales_phage(27.27%)	42	NA	NA
WP_000427623.1|14907_15912_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001114073.1|17111_17465_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|17512_17875_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|17892_19644_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_003026002.1|19692_20982_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	3.3e-171
WP_000065759.1|20994_21420_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.8e-50
WP_004118313.1|21450_21855_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|21863_22436_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_012291341.1|22599_25608_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_047063025.1|25624_26692_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_012561144.1|26733_27729_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000792636.1|27728_28262_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_000091613.1|28434_28749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|29003_29360_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|29349_29751_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|29747_30038_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|30529_31534_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|31612_34585_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|34587_35145_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|35274_35487_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|35552_35789_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|35785_36151_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|36168_37854_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|37892_38318_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|38345_38621_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|38636_39002_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|39073_39529_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152292.1|39803_40661_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|40653_40731_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|40947_41226_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009485932.1|41546_42026_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004152296.1|42366_42645_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|42646_44968_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004178052.1|45323_45869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152301.1|46083_46431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178053.1|46450_47047_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152303.1|47204_47930_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004153029.1|48009_53271_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152629.1|55939_56671_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_004153030.1|56860_57388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178054.1|57393_60243_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_004176137.1|61443_62475_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP054304	Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence	216803	117112	173406	216803	transposase,holin,integrase,protease	uncultured_Caudovirales_phage(31.25%)	51	106005:106020	152432:152447
106005:106020	attL	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_001515717.1|117112_117853_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004182028.1|118996_119944_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_071527918.1|119970_120282_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_068814619.1|120301_121270_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_004197688.1|121942_122200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176137.1|124136_125168_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_004152070.1|126393_127671_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|127733_129731_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|130770_131978_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|133406_133838_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|134088_135564_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|135556_136237_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|136426_137812_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|137840_138194_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|138307_139600_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|139610_142757_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|142843_143284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|143410_145858_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|145898_146096_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|146129_146867_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|147155_147605_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|147838_149656_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|149661_150552_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|150591_150972_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|150976_151906_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|151960_152641_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
152432:152447	attR	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_004152084.1|152637_154038_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|154254_154689_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_024623170.1|154920_155100_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004196769.1|156842_157352_+	aquaporin	NA	NA	NA	NA	NA
WP_004196778.1|157401_157899_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|158230_158557_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004182006.1|158553_159267_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|159275_159821_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|159896_160259_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|162155_162692_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|162724_163150_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|163162_164452_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|164499_166251_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|166268_166631_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|166680_167031_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|167388_167658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|167645_168221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|168251_168746_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|168789_169158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|169191_169395_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|169443_169701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|169776_170031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|170206_170473_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|170460_170943_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152113.1|172443_173406_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP054305	Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence	125232	31690	37940	125232	transposase	Escherichia_phage(66.67%)	8	NA	NA
WP_001067855.1|31690_32395_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|32538_33180_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|33329_33830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|33909_34614_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|34732_35548_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|35730_36435_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210551.1|37104_37233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792636.1|37406_37940_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 2
NZ_CP054305	Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence	125232	84207	107109	125232	transposase,integrase	Escherichia_phage(37.5%)	22	81531:81546	86461:86476
81531:81546	attL	GTAATTATCATAATTA	NA	NA	NA	NA
WP_000543934.1|84207_85218_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|85220_85757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|86055_86337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|86598_87201_+	hypothetical protein	NA	NA	NA	NA	NA
86461:86476	attR	GTAATTATCATAATTA	NA	NA	NA	NA
WP_000791469.1|87216_87669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|87839_88280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|88251_92505_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_000988731.1|92637_93363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|93476_93851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|93971_94088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|94493_95498_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|95725_96931_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|96941_97247_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|97473_98238_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|98730_99315_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|99314_100553_-	MFS transporter	NA	NA	NA	NA	NA
WP_001404365.1|100549_101455_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|101576_102281_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|102867_103728_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|103910_104468_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|105031_106294_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001067855.1|106404_107109_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
