The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	447474	480732	5414156	protease,tail,tRNA,integrase,capsid,portal,head,terminase	uncultured_Caudovirales_phage(75.0%)	34	465082:465099	481077:481094
WP_002919147.1|447474_448422_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|448436_448946_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|449074_450199_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|450170_450644_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|450669_451212_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|451216_451789_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|451792_452611_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|452607_452865_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|452840_453395_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|459190_459412_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|459705_462816_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|462828_463968_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|464346_464997_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
465082:465099	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|465272_466499_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|466591_467533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|467714_467999_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|468009_468789_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|469240_469510_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|469502_469691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|469683_469998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|469994_470363_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|470359_470725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|470724_472860_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|473202_473538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|473586_474099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|474362_475529_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|475580_476141_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|476142_477384_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|477380_477716_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|477712_478012_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|478011_478455_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|478447_478600_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|478730_479087_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|479070_480732_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
481077:481094	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	1237211	1283446	5414156	tail,lysis,tRNA,integrase,capsid,portal,head,plate,terminase	Salmonella_phage(83.72%)	60	1235505:1235551	1272072:1272118
1235505:1235551	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1237211_1238237_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1238239_1238869_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1238991_1239234_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1239266_1239776_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1239783_1239984_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1239947_1240286_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1240353_1240587_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1240586_1240814_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1240810_1241662_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1241658_1244043_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1244205_1244394_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1244405_1244639_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1244734_1245418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1245404_1246484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1246483_1247485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1248006_1248276_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1248332_1249376_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1249375_1251139_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1251279_1252113_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1252129_1253182_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1253185_1253839_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1253934_1254399_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1254398_1254602_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1254605_1254821_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1254801_1255311_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1255315_1255699_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1255695_1256124_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1256098_1256257_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1256219_1256642_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1256634_1257081_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1257103_1257970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1258064_1258637_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1258633_1258996_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1258982_1259891_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1259883_1260555_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1260556_1262506_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1262515_1263634_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1263685_1264759_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1264907_1266080_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1266089_1266605_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1266657_1266957_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1266971_1267091_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1267317_1269714_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1269710_1270196_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1270192_1271287_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1271353_1271572_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1271599_1271977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1272580_1273063_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1272072:1272118	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1273173_1273650_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1273639_1273930_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1273996_1274338_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1274485_1276147_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1276233_1277112_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1277236_1277827_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1277946_1279233_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1279252_1280044_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1280207_1281572_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1281831_1282080_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1282098_1282647_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1282678_1283446_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	1386304	1431007	5414156	tail,integrase,capsid,terminase,holin	Salmonella_phage(44.9%)	60	1388868:1388882	1400049:1400063
WP_004151980.1|1386304_1387771_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1387838_1389416_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1388868:1388882	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004152549.1|1389608_1390859_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1390875_1391067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1391063_1391246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1391242_1391836_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1391832_1391991_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1391983_1392277_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1392386_1392635_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1392686_1393709_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1393718_1394618_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1394614_1394914_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1394910_1395060_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152539.1|1395280_1395862_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1396015_1396249_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1396396_1396606_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152536.1|1396605_1397373_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152535.1|1397369_1398155_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1398274_1398622_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1398814_1399225_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1399208_1399400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1399396_1399822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1399818_1400562_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1400049:1400063	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004152528.1|1400561_1400732_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|1400732_1400945_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1400941_1401610_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1401602_1401842_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1401841_1402180_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1402254_1402512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1402589_1403174_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004164044.1|1403170_1404646_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152473.1|1404689_1405211_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1405916_1406120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1406123_1407803_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1407799_1408105_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_019404949.1|1408107_1408785_+	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004152467.1|1408797_1409805_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1409814_1410207_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1410199_1410478_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1410526_1411138_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1411137_1413615_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1413616_1414087_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1414079_1414577_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1414589_1417334_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1417333_1420723_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1420732_1421347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1421621_1422020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1422024_1422207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1422397_1423093_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1423176_1423365_-	ash family protein	NA	NA	NA	NA	NA
WP_004152454.1|1423473_1423671_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1423674_1423932_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152452.1|1424022_1424319_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004221284.1|1424470_1426840_+|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|1426848_1427001_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|1427124_1427529_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1427515_1427821_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1427810_1428440_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1428436_1428919_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1429138_1431007_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	1759737	1766644	5414156	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1759737_1760601_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1760611_1761385_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1761627_1762524_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1762766_1764128_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1764446_1765169_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1765165_1766644_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	1804277	1811902	5414156		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1804277_1805684_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1805908_1806973_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1806999_1807869_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1807900_1808791_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1808805_1809360_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1809540_1810707_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1810900_1811902_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	2053843	2110330	5414156	protease,transposase,plate	Staphylococcus_phage(16.67%)	54	NA	NA
WP_002910830.1|2053843_2054590_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2055028_2056015_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2056007_2056808_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2056794_2056968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2057265_2057409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2057585_2058527_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2058620_2059610_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2059635_2060967_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2060994_2062203_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2062231_2064526_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2064577_2064724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2065013_2066072_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2066181_2067096_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2067105_2068383_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2068379_2069255_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|2069251_2069971_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2069976_2070870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2071153_2072797_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2072846_2073323_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2073421_2074348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2074651_2075947_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2075958_2076768_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2076742_2077642_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2077751_2078234_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2078424_2079123_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2079148_2079688_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2079802_2080132_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2080700_2082041_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2082037_2082691_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2082694_2084392_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2087355_2088711_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2088711_2089221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2089217_2089724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2089818_2089971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2089960_2090470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2092075_2093044_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2093185_2093368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2093364_2093694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2093690_2094197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2095712_2096018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2096039_2096933_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2096978_2097095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2097116_2098010_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2098035_2098164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2098185_2099079_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2099254_2100145_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2100481_2101462_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2101519_2101822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2102082_2102268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2102565_2102832_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2102835_2103993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2103976_2107387_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2107520_2109284_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2109313_2110330_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	2753294	2764169	5414156		Escherichia_phage(85.71%)	8	NA	NA
WP_004151613.1|2753294_2756402_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2756456_2757722_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2757752_2758841_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2758927_2759188_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2759485_2760346_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2760366_2761128_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2761389_2762292_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210516.1|2763548_2764169_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	2958634	3152346	5414156	protease,tail,integrase,transposase,plate,terminase,holin	Klebsiella_phage(22.73%)	212	2984204:2984221	3138838:3138855
WP_002902268.1|2958634_2959720_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2959683_2961438_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2963109_2966535_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2966518_2967658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2967654_2967912_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2967956_2970374_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2970361_2970892_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2970959_2971490_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2971558_2972089_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2972156_2972687_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2972755_2973286_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2973349_2974129_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2974129_2976499_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2976500_2979155_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2979419_2979911_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|2979915_2981622_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2981618_2982308_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2982304_2983648_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2983657_2985202_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
2984204:2984221	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_002902144.1|2985244_2985736_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2986581_2986830_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2987052_2987337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2987441_2987651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2987647_2988379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2988389_2989118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2991468_2991666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2991665_2992532_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2992531_2993305_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2993301_2994498_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2994497_2994851_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2994852_2995506_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2995559_2996126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2996168_2996351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2996400_2996742_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2996741_2997764_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2997766_2997994_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2998069_2998669_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2998668_3000672_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3000661_3000814_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3000849_3001275_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3001601_3002793_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3002734_3003025_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3003035_3004181_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3004184_3004625_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3004719_3005106_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3005105_3005612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3005608_3006028_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3005996_3006278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3006317_3007259_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3007270_3007765_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_087749906.1|3007768_3008971_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	5.9e-106
WP_004152174.1|3009022_3009571_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3009626_3011078_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3011315_3012716_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3012666_3013155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3013520_3013841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3014075_3014465_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3014461_3014992_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3014994_3015243_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3015648_3016431_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3016427_3016904_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3016900_3017863_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3017864_3019523_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3020099_3020321_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3020418_3021087_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3021257_3021572_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3021564_3021753_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3021922_3022288_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3022280_3022535_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3022506_3022725_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|3022721_3023147_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3023143_3023338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749880.1|3023334_3024162_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	83.6	2.1e-110
WP_004152153.1|3024266_3024785_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3024790_3025501_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3025490_3025715_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3025711_3025924_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3026166_3026400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3026472_3026619_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3026578_3026821_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3026801_3027983_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3028179_3028728_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|3028926_3030459_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3030675_3031437_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|3031545_3032460_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3032760_3032949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152141.1|3033495_3034365_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|3034443_3035646_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|3035718_3036855_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|3037027_3037912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|3038036_3038870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|3039100_3039487_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|3039654_3041271_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004148146.1|3041267_3041384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152134.1|3041456_3042164_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|3042160_3043126_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|3043228_3043735_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_004152128.1|3043805_3044858_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|3044959_3046501_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|3046673_3047987_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|3048118_3049000_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|3049089_3050151_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|3050147_3051545_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|3051647_3051866_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|3051894_3052254_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|3052253_3052478_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|3052533_3053202_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004148137.1|3053354_3054344_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|3054334_3055726_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|3055751_3056921_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|3057092_3059402_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|3059380_3060211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004231410.1|3060318_3061227_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|3061560_3063204_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|3063200_3064166_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|3064370_3065042_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3065228_3066056_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3066131_3067397_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3067398_3067818_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3067897_3069385_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|3071294_3071999_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3072175_3072940_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3073446_3073947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3074074_3074914_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3074907_3075255_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3075418_3076210_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3077205_3077910_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3078158_3080102_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3080343_3080943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3081167_3081899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940942.1|3081902_3082637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152652.1|3084933_3088002_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3087998_3088379_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3088388_3088871_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3089051_3089516_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3089830_3090166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3090356_3091337_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3091449_3094347_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3094608_3094800_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3095024_3095381_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3095457_3095664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3095801_3096284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3096337_3097510_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3097533_3097926_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3097922_3098474_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3098475_3098859_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3098845_3099079_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3099088_3099343_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3099344_3099740_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3099780_3100053_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|3100061_3101015_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3101025_3101811_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004227000.1|3101924_3102101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019405022.1|3102341_3103454_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3103437_3104838_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3104837_3106145_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3106122_3107127_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3107989_3108235_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3109193_3109469_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3109465_3109810_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3109806_3110346_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3110342_3110642_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3111120_3112167_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3112392_3113082_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3113081_3113222_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3113218_3113857_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3113849_3114518_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3114514_3114682_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3114662_3115130_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3115262_3115541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3115650_3116679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3116886_3117132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3117187_3117490_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3117486_3118335_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3118331_3119192_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3119277_3119499_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3119539_3119767_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3119878_3120577_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3120864_3121941_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3122022_3122226_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3122536_3122662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3122654_3122849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3122937_3123222_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3123237_3124083_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3124079_3124367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3124368_3125049_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3125045_3125474_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3125470_3126133_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3126340_3127558_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3127704_3128595_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3128594_3129587_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3129588_3130398_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004151902.1|3130442_3131822_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3132069_3132612_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3132810_3133599_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3133789_3134947_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002901787.1|3135028_3136963_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|3137121_3137301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3137372_3138122_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901783.1|3138397_3138616_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3138747_3139074_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
3138838:3138855	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004151907.1|3139073_3139811_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3140002_3141172_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3141178_3141487_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3141622_3142390_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3142553_3143156_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3143202_3145875_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|3146263_3146431_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3146676_3147651_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3147996_3150594_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3151000_3151252_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3151299_3152346_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	3506689	3599035	5414156	protease,tail,lysis,tRNA,integrase,capsid,portal,head,plate,terminase	Salmonella_phage(59.65%)	93	3562215:3562233	3599110:3599128
WP_002898139.1|3506689_3507982_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3508072_3509416_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3509424_3510036_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3510158_3514412_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3514547_3515042_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3515574_3516543_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3516657_3518424_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3518424_3520146_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3520190_3520892_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3521245_3521464_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3521584_3523864_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3523894_3524212_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3524537_3524759_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3524835_3526776_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3526772_3527888_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3528034_3529693_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3530112_3530808_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3530923_3531823_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3531966_3533619_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3533629_3534598_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3534809_3535244_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3535395_3537114_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3537152_3538154_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3538164_3539607_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3539694_3540708_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3540704_3541535_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3541566_3542706_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3543583_3544099_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3544325_3545054_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3545074_3545806_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3545812_3546529_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3546528_3547197_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3547380_3548112_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3548154_3549627_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3549623_3550340_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3550418_3551546_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3551587_3552076_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3552133_3552979_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3552975_3553929_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3553939_3555073_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3555236_3556349_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3556697_3557177_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3557265_3558168_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3558989_3559277_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3559479_3559743_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3559749_3560133_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3560399_3562085_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3562215:3562233	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3562304_3562523_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3562614_3563715_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_087749901.1|3563711_3564197_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.0	4.7e-62
WP_014342962.1|3564193_3566587_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3566813_3566933_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3566947_3567247_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3567299_3567815_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3567824_3568997_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3569135_3570212_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3570241_3570445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3570441_3571173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3571176_3571911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3574129_3574729_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3574721_3575630_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3575616_3575979_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3575975_3576548_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3576642_3577335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3577331_3577778_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3577770_3578202_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3578164_3578311_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3578297_3578726_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3578722_3579106_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3579110_3579620_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3579600_3579816_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3579819_3580023_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3580022_3580487_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3580582_3581233_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3581236_3582295_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3582311_3583145_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3583287_3585054_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3585053_3586079_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3586140_3587883_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3588158_3588836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3588950_3589184_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3589194_3589383_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3589536_3591951_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3591947_3592805_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3592801_3593029_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3593028_3593262_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3593329_3593671_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3593634_3593835_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3593842_3594352_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3594384_3594606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3594751_3595630_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3595641_3596586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342959.1|3598054_3599035_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3599110:3599128	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	4045343	4090618	5414156	head,tRNA,lysis,holin	Cronobacter_phage(25.0%)	65	NA	NA
WP_004151249.1|4045343_4047821_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4047807_4048203_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4048199_4048670_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4048669_4049146_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|4049188_4052635_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4052727_4053231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4053358_4054144_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4054209_4054923_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4054912_4055083_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4055182_4055542_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4055558_4056029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4056322_4056577_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4056579_4057335_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4057510_4058188_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4058240_4058993_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4059061_4059454_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4059450_4059876_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4059878_4060241_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4060240_4060414_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4060413_4060794_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4060796_4061036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4061046_4062141_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4062152_4062581_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4062584_4063970_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4064042_4064519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4064560_4065565_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4065539_4066961_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4066973_4068446_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4068445_4069048_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4069418_4069748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4069853_4070318_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4070314_4070845_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4070847_4071096_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151283.1|4072005_4072695_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4072691_4073222_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4073214_4073352_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4073348_4073984_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4073976_4074147_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4074146_4074602_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4075102_4075750_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|4075746_4075923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151293.1|4075922_4076765_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4076871_4077378_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4077374_4077668_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4077667_4079083_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4079087_4079939_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4079979_4080126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4080211_4080433_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4080473_4080707_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4080834_4081524_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4081874_4082090_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4082086_4082197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4082189_4082384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4082472_4082757_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4082772_4083618_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4083614_4084295_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4084291_4084450_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4084446_4085103_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4085099_4085867_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4085863_4086082_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4086083_4086299_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4086300_4086636_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4088106_4088973_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4088974_4089187_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4089232_4090618_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 11
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	4300173	4311827	5414156	integrase	Enterobacteria_phage(70.0%)	13	4300025:4300038	4304238:4304251
4300025:4300038	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4300173_4301277_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4301287_4302541_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4302893_4304084_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4304071_4305022_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4304238:4304251	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4305021_4305447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4306015_4306582_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4306599_4306845_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4306841_4307579_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4308120_4308387_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4308383_4308941_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4308937_4309165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4309161_4309482_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4309493_4311827_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 12
NZ_CP054268	Klebsiella pneumoniae strain 39427 chromosome, complete genome	5414156	4788225	4794050	5414156		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4788225_4790559_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4790573_4790894_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4790890_4791118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4791114_4791663_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4791659_4791926_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4792486_4793224_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4793220_4793466_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4793483_4794050_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP054265	Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence	168717	8032	106533	168717	bacteriocin,integrase,protease,transposase	Escherichia_phage(24.24%)	91	18042:18101	94302:95497
WP_004220208.1|8032_9112_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_004118124.1|9183_9345_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004152759.1|10044_10317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152758.1|10313_10664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|11299_11656_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|11716_11929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|11939_12164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|12244_12565_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|12554_12833_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152722.1|12833_13247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004178064.1|14080_14902_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_011977736.1|14934_15264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178063.1|15296_15782_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_004178062.1|16215_16608_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_011977735.1|16830_17517_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_004208838.1|17600_17972_+	TraY domain-containing protein	NA	NA	NA	NA	NA
18042:18101	attL	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCG	NA	NA	NA	NA
WP_000019473.1|18188_19169_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152296.1|20817_21096_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|21436_21916_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|22236_22515_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|22731_22809_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|22801_23659_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000093087.1|25105_27301_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|27297_28614_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|28617_30927_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077264219.1|31571_32540_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.9e-184
WP_003846917.1|32631_33885_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|33936_37011_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|37132_38215_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|38675_39686_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_165765869.1|40019_40307_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|40637_40931_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|41029_41797_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|41797_42754_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|42750_43749_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|43745_44648_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|44692_47017_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|47102_48056_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|48052_48574_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|49535_49748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|49676_49844_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|50128_51256_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|51252_51846_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|51842_52691_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|52690_53611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|53623_55228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|55272_56220_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|56227_57961_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|61783_62131_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|62127_62514_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|63061_63697_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|63693_64806_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004152560.1|64798_66187_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
WP_016197752.1|66186_66417_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|67394_68054_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|68254_68632_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|68698_71665_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|71667_72228_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|72353_72704_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|72906_73920_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|74064_74562_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|74673_74964_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|74969_75761_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|75924_76272_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|76265_77105_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|77232_77436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|77591_78797_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|78807_79113_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|79339_80104_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|80596_81181_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|81180_82419_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|82415_83321_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|83442_84147_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|84297_85113_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044503635.1|85302_85971_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_001067855.1|87274_87979_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|88834_89662_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|89658_90522_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|90530_91358_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|91366_92377_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|92370_93240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|94448_95429_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|96630_96894_-|transposase	transposase	transposase	NA	NA	NA	NA
94302:95497	attR	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCGGATCTGGGCCGATTTTTTTCCCGCAAACACATCGAATCAGCCTATTTAGGCTATTTTTTCCACCATTTCTGGCGTTATTTCCGGTTTTTACTGAGATCTCTCCCACTGACGTATCATTTGGTCCACCCGAAACAGGTTGGCCAGGGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAGCCCTTTGTATCTGGCTTTCACGAAGCCGAACTGCCGCTTGATGATGCGAAACGGGTGCTCCACCCTGGCACGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGCGGATGCTGCTTCAAGGTTTTTACCTTGCCGGGACGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCTCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGAAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTAGAGCTGGGTGCCTCAATGATGGTGGCATCCACCAAAGTGCCTTGGGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGACGGGCCAGTTGATGCTGCTCGAGCAGGTGGCGGAAATTCATGATGGTGGTGCGATCCGGCAGGGCGCTATCCAGGGATAATCGGGCAAACAGGCGCATGGAGGCGATTTCGTACAGGGCATCTTCCATGGCACCGTCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATACGCAGCATGGTCTCCAGCGGATAGGGCCGTCGGCCATTGCCCGCCTTGGGATAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCTGAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTCCCTCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCC	NA	NA	NA	NA
WP_004118208.1|96908_97172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|97415_97697_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|97731_98301_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|98415_101211_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|101210_101408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|101645_102395_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|102381_103344_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|105186_106533_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP054266	Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence	89626	1127	9931	89626		Enterobacteria_phage(28.57%)	9	NA	NA
WP_004152348.1|1127_2102_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|2098_3304_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|3625_4522_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|4922_6194_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|6193_6625_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|6856_7828_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|7830_8502_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|8562_8793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|9229_9931_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP054267	Klebsiella pneumoniae strain 39427 plasmid pKPN39427.3, complete sequence	57419	0	11585	57419		Streptococcus_phage(33.33%)	11	NA	NA
WP_004221702.1|3914_4100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|4057_4270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|4332_4608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510385.1|4625_4880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196235.1|4989_5811_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000136657.1|5807_5987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351937.1|6259_6910_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001293458.1|6947_7403_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004199098.1|7414_9742_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|9745_11008_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_001215543.1|11090_11585_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
>prophage 2
NZ_CP054267	Klebsiella pneumoniae strain 39427 plasmid pKPN39427.3, complete sequence	57419	30216	30732	57419		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|30216_30732_-	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
NZ_CP054267	Klebsiella pneumoniae strain 39427 plasmid pKPN39427.3, complete sequence	57419	35332	43324	57419	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
WP_000516402.1|35332_35995_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|36375_37038_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|37124_37364_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|37756_38461_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|38811_39366_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|39599_40157_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|40318_43324_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
