The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	740944	795176	3171824	integrase,tail,portal,bacteriocin,capsid,head,protease,terminase	Lactobacillus_phage(81.4%)	64	745218:745240	787990:788012
WP_003642489.1|740944_741274_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_021356330.1|741468_742803_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	1.3e-26
WP_173818796.1|742938_744051_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.0	1.5e-34
WP_173818798.1|744116_745058_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
745218:745240	attL	ACTTTGGAGGAGTAAATGAAAAA	NA	NA	NA	NA
WP_003642485.1|745419_746301_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_011102097.1|746281_747778_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_063486111.1|748057_749197_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.0	4.0e-35
WP_003644558.1|749372_749687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057137256.1|749869_750127_-	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	75.0	5.0e-31
WP_003644556.1|750252_750429_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	86.2	7.2e-21
WP_154812813.1|751443_752358_-	hypothetical protein	NA	E9LUS7	Lactobacillus_phage	30.4	2.1e-07
WP_063486113.1|752438_752693_-	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	36.7	1.1e-06
WP_080469392.1|752807_753479_-	helix-turn-helix domain-containing protein	NA	D7RWL5	Brochothrix_phage	58.1	2.5e-66
WP_024624159.1|753641_753872_+	hypothetical protein	NA	A0A0N7IRA0	Lactobacillus_phage	57.7	1.0e-14
WP_063486125.1|753903_754638_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.3	9.6e-51
WP_003641364.1|754649_754859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486114.1|754871_755120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|755114_755336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057137267.1|755961_756234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486115.1|756399_756648_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	73.9	8.6e-28
WP_003641371.1|756650_756851_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_173818800.1|757134_757305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098960.1|757304_757562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486116.1|757665_758460_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	69.7	1.9e-52
WP_063486117.1|758453_759320_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	40.9	1.4e-48
WP_173818802.1|759485_759794_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.1	7.1e-48
WP_173818804.1|759786_759945_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	1.9e-17
WP_173818806.1|760154_760502_+	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	50.7	2.4e-15
WP_173818808.1|760498_760669_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	89.3	5.0e-19
WP_022638818.1|760649_761075_+	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_024624388.1|762168_762969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173818810.1|763022_763193_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	92.9	2.2e-22
WP_173819229.1|763203_763671_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	92.9	2.2e-80
WP_033608389.1|763869_764331_+|terminase	phage terminase small subunit P27 family	terminase	A0A286QRF4	Streptococcus_phage	58.2	6.5e-45
WP_072539996.1|764317_766225_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	49.7	2.2e-179
WP_033608390.1|766214_766409_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	92.2	2.0e-24
WP_072539990.1|766411_767608_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	89.7	2.5e-205
WP_173818812.1|767585_768320_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.2	8.8e-121
WP_063489696.1|768319_769552_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	90.9	2.5e-205
WP_076669798.1|769624_769963_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	92.9	4.0e-52
WP_033608492.1|769946_770309_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	98.3	5.8e-65
WP_173818814.1|770298_770739_+|tail	phage tail protein	tail	E9LUQ6	Lactobacillus_phage	96.6	2.7e-77
WP_072539986.1|770735_771119_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	94.5	8.8e-64
WP_173818816.1|771119_771758_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	94.3	1.0e-109
WP_173818818.1|771959_772343_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	97.6	5.7e-63
WP_016058335.1|772339_772531_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_173818820.1|772543_777451_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	63.0	0.0e+00
WP_173818822.1|777522_779298_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.8	4.2e-302
WP_053566541.1|779362_781777_+	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	90.0	0.0e+00
WP_173818824.1|781793_784367_+|tail	phage tail protein	tail	A0A2K9VCB6	Lactobacillus_phage	50.5	1.4e-274
WP_053566543.1|784359_784611_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.1	6.6e-28
WP_003644513.1|784614_784776_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	100.0	9.5e-20
WP_053566544.1|784759_785119_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	78.2	8.6e-45
WP_173818826.1|786149_786413_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	5.7e-38
WP_063489763.1|786424_786955_+	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	95.7	8.0e-39
WP_003642482.1|788357_789056_-	zinc metallopeptidase	NA	NA	NA	NA	NA
787990:788012	attR	ACTTTGGAGGAGTAAATGAAAAA	NA	NA	NA	NA
WP_003642481.1|789223_789391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011102096.1|789915_790755_+	DegV family protein	NA	NA	NA	NA	NA
WP_003642478.1|790929_791658_+	LrgB family protein	NA	NA	NA	NA	NA
WP_003642477.1|791677_792097_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003642476.1|792508_793051_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642475.1|793483_794356_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003643468.1|794410_794638_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003642473.1|794819_795176_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	1259900	1268411	3171824		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|1259900_1260383_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_011101896.1|1260366_1261497_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1261499_1262231_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1262232_1262487_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|1262486_1263167_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_173818912.1|1263159_1265379_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	3.5e-144
WP_003642591.1|1265363_1266818_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_013355836.1|1266814_1267840_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
WP_003645867.1|1267832_1268411_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 3
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	2288266	2302718	3171824		Lactobacillus_phage(90.0%)	11	NA	NA
WP_173819100.1|2288266_2290540_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	23.5	1.0e-37
WP_047673279.1|2292652_2292862_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_173819102.1|2292965_2293931_-	hypothetical protein	NA	A0A2P0ZL95	Lactobacillus_phage	88.9	4.7e-29
WP_052098033.1|2293914_2294382_-	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	99.4	6.1e-83
WP_011101401.1|2294726_2295167_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_011101400.1|2295237_2295798_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	3.8e-100
WP_173819104.1|2295885_2298324_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_173819106.1|2298326_2298941_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	1.8e-111
WP_003643099.1|2299284_2300232_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_011101398.1|2300417_2301389_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_173819108.1|2301479_2302718_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.4	8.5e-217
>prophage 4
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	2500724	2508331	3171824	integrase	Escherichia_phage(66.67%)	9	2494825:2494841	2516865:2516881
2494825:2494841	attL	TTAATAAATTAGTAAAT	NA	NA	NA	NA
WP_024002485.1|2500724_2501672_-	GDP-mannose 4,6-dehydratase	NA	A0A1V0SAI6	Catovirus	34.9	1.4e-41
WP_060417606.1|2501689_2502463_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_063721029.1|2502449_2503178_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_024002886.1|2503189_2503960_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_080440298.1|2504316_2504895_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.5	9.3e-33
WP_024002617.1|2504926_2505769_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	2.5e-34
WP_003643249.1|2505838_2506867_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	4.9e-69
WP_024002618.1|2506876_2507458_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.0	1.6e-32
WP_024002619.1|2507461_2508331_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.2	9.2e-101
2516865:2516881	attR	ATTTACTAATTTATTAA	NA	NA	NA	NA
>prophage 5
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	2962394	2971018	3171824		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|2962394_2963390_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|2963528_2964314_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|2964317_2965214_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|2965312_2965660_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|2965684_2966704_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|2966720_2967050_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_173819189.1|2967046_2967712_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.0	3.2e-53
WP_003640957.1|2968109_2968361_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2968375_2968975_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2968990_2969299_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|2969320_2971018_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 6
NZ_CP054259	Lactobacillus plantarum strain TCI507 chromosome, complete genome	3171824	3104249	3160436	3171824	tRNA,protease,bacteriocin	uncultured_Mediterranean_phage(22.22%)	51	NA	NA
WP_060684287.1|3104249_3105521_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	2.6e-96
WP_003642042.1|3105987_3107601_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|3107773_3108382_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|3108426_3108867_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003643833.1|3109229_3110162_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|3110170_3111529_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|3111548_3112358_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003643831.1|3112527_3113514_-	lipoprotein	NA	NA	NA	NA	NA
WP_173819211.1|3113596_3114619_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|3114907_3115888_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_173819214.1|3116253_3117078_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|3117313_3118696_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|3118764_3119601_-	pur operon repressor	NA	NA	NA	NA	NA
WP_173819261.1|3119956_3120754_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|3120746_3121445_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_047672693.1|3121712_3122657_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|3122966_3123833_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|3123965_3124217_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|3124321_3125212_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|3125208_3125772_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642017.1|3125758_3126535_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016511603.1|3126657_3127842_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|3128074_3130126_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_021356646.1|3130447_3130837_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|3131433_3132276_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646490.1|3132275_3132980_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|3133001_3133961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033608308.1|3133953_3135228_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|3135273_3136191_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|3136359_3137154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642006.1|3137158_3138292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101007.1|3138746_3139760_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|3139872_3140619_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173819216.1|3140768_3141665_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|3141785_3143222_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_053567057.1|3143239_3144595_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|3144817_3145240_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|3145229_3145418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|3145424_3146786_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|3146858_3147569_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|3147976_3148993_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021356643.1|3149432_3150209_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_060684282.1|3150467_3152777_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060684281.1|3152871_3153075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566441.1|3153212_3153899_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_173819218.1|3153992_3154673_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063721086.1|3154759_3155428_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_062688864.1|3155494_3156184_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063721087.1|3157665_3159816_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|3160082_3160253_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|3160277_3160436_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
