The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	654020	693584	5542270	lysis,tRNA,portal,capsid,terminase,head,tail,plate,integrase	Salmonella_phage(81.4%)	50	653935:653981	687395:687441
653935:653981	attL	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_032439000.1|654020_655106_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
WP_109232864.1|655109_655730_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.0	3.3e-36
WP_004144798.1|655830_656067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109232863.1|656101_656611_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.0	3.5e-76
WP_109232862.1|656618_656819_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	83.1	6.5e-26
WP_109232861.1|656782_657124_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	85.7	2.1e-48
WP_019704181.1|657192_657426_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	7.8e-31
WP_101516368.1|657425_657653_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	85.3	1.5e-31
WP_109232860.1|657649_658537_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.6	3.1e-120
WP_109232859.1|658517_660923_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.5	0.0e+00
WP_109232868.1|661109_661298_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	5.1e-25
WP_109232867.1|661310_661544_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.0e-30
WP_016529211.1|661829_662048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109232858.1|662047_662890_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	2.9e-59
WP_109232857.1|663104_664655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109232856.1|664751_665774_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.6	8.4e-178
WP_109232855.1|665773_667537_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
WP_109232854.1|667677_668511_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	72.2	1.8e-101
WP_038421820.1|668527_669580_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	88.8	2.7e-171
WP_109232853.1|669583_670234_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	2.8e-102
WP_064172752.1|670330_670795_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	6.0e-75
WP_002896155.1|670794_670998_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_109232852.1|671001_671217_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	3.9e-29
WP_019704195.1|671197_671707_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	3.3e-82
WP_109232851.1|671711_672095_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	43.7	8.1e-17
WP_020323995.1|672091_672520_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_072145348.1|672494_672653_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	2.0e-14
WP_002896172.1|672615_673047_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_173817997.1|673039_673486_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	3.3e-54
WP_109232849.1|673554_674127_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.7	3.3e-75
WP_004174325.1|674123_674486_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_064189017.1|674472_675381_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.5	9.0e-107
WP_109232848.1|675373_675976_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	59.9	5.6e-57
WP_129497902.1|675911_678242_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.5	1.2e-107
WP_109232847.1|678247_678976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109232846.1|678987_680070_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	33.8	1.8e-29
WP_109232845.1|680208_681381_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|681390_681906_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|681958_682258_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|682272_682392_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_162556882.1|682618_685012_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	6.9e-106
WP_004185683.1|685008_685494_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_109232843.1|685490_686588_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
WP_004174338.1|686658_686877_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|686889_687267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173817999.1|687594_688101_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
687395:687441	attR	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_008806539.1|688200_690042_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_008806538.1|690260_692006_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.2e-75
WP_001144069.1|692117_692333_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_008806537.1|692570_693584_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
>prophage 2
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	1689495	1696421	5542270	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_173818090.1|1689495_1690359_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	2.6e-07
WP_012967575.1|1690369_1691143_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_173818093.1|1691382_1692279_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	4.7e-15
WP_008804076.1|1692521_1693883_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1694199_1694922_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804077.1|1694918_1696421_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 3
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	2785905	2796784	5542270		Escherichia_phage(87.5%)	9	NA	NA
WP_173818184.1|2785905_2789013_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_012968277.1|2789067_2790333_+	MFS transporter	NA	NA	NA	NA	NA
WP_080923376.1|2790361_2791450_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.1	3.1e-207
WP_012968279.1|2791536_2791797_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	96.5	4.6e-40
WP_080923375.1|2792091_2792952_+	class A beta-lactamase LEN-30	NA	A0A077SL40	Escherichia_phage	90.6	6.7e-144
WP_008804982.1|2792969_2793731_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_173818185.1|2793991_2794894_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_023340102.1|2794905_2796171_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	1.3e-228
WP_012541792.1|2796163_2796784_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 4
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	2889917	2934674	5542270	holin,terminase,head,tail,integrase	Cronobacter_phage(30.23%)	61	2887493:2887507	2923102:2923116
2887493:2887507	attL	AGCATGGCGGCGCGG	NA	NA	NA	NA
WP_099718767.1|2889917_2891018_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.9	7.5e-116
WP_099718765.1|2891334_2892018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117024239.1|2892365_2893088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057216394.1|2893100_2895329_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	36.7	5.1e-111
WP_099718760.1|2895415_2897893_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.5	4.7e-198
WP_099718758.1|2897879_2898275_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	3.0e-35
WP_004199076.1|2898271_2898742_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_032438661.1|2898741_2899218_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	2.5e-36
WP_065802151.1|2899260_2899506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117024238.1|2899505_2901977_-|tail	phage tail length tape measure family protein	tail	A0A173GC04	Salmonella_phage	60.1	5.1e-205
WP_048291458.1|2902052_2902556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099719279.1|2902683_2903430_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	58.0	4.4e-67
WP_038421578.1|2903499_2904204_-	BRO family, N-terminal domain protein	NA	H6WRU8	Salmonella_phage	39.8	6.2e-39
WP_004223324.1|2904193_2904367_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
WP_099719276.1|2904479_2904842_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	65.6	3.3e-12
WP_099719274.1|2905024_2905723_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	49.3	7.0e-51
WP_099719272.1|2905780_2906524_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	84.4	9.1e-73
WP_099719269.1|2906586_2906970_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	7.5e-39
WP_117024235.1|2906966_2907392_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	66.7	4.0e-25
WP_099719052.1|2907394_2907742_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	63.5	5.9e-35
WP_061357254.1|2907741_2907915_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_099719054.1|2907914_2908295_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
WP_173818201.1|2908297_2908555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178847.1|2908564_2909662_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_004178846.1|2909673_2910105_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_099719059.1|2910108_2911494_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	1.5e-166
WP_048980364.1|2911841_2912846_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.0	6.0e-112
WP_099719063.1|2912772_2914242_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	2.0e-148
WP_099719065.1|2914254_2915553_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	94.1	2.3e-241
WP_099719067.1|2915536_2916004_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	74.5	1.5e-57
WP_099719070.1|2916035_2916671_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	5.5e-103
WP_172436860.1|2917563_2917953_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	45.1	2.0e-23
WP_099719076.1|2917949_2918480_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.1	9.3e-80
WP_004151282.1|2918482_2918731_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_099719078.1|2918890_2919307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099719080.1|2919502_2920192_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	4.2e-56
WP_173818203.1|2920188_2920329_-	YlcG family protein	NA	NA	NA	NA	NA
WP_049152056.1|2920325_2920709_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	44.6	4.6e-20
WP_049152055.1|2920705_2921299_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.4	6.2e-40
WP_049152053.1|2921923_2922325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049152050.1|2922303_2922720_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_049152048.1|2922856_2923075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142351863.1|2923067_2923373_-	hypothetical protein	NA	NA	NA	NA	NA
2923102:2923116	attR	AGCATGGCGGCGCGG	NA	NA	NA	NA
WP_049152045.1|2923406_2923781_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	40.9	1.8e-16
WP_099719087.1|2923777_2924293_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_053091181.1|2924292_2924646_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	68.2	1.3e-08
WP_049152042.1|2924638_2925715_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.2	1.4e-146
WP_049152041.1|2925711_2926500_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	2.4e-63
WP_029499290.1|2926712_2927108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049152038.1|2927134_2928229_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.1	2.2e-30
WP_023312759.1|2928225_2928480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196543.1|2928675_2928996_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_040217333.1|2929035_2929269_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	47.9	6.2e-12
WP_040217336.1|2929396_2930086_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	6.7e-62
WP_099719095.1|2930738_2931032_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_099719099.1|2931557_2931782_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.9e-18
WP_099719101.1|2931778_2932123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099719104.1|2932115_2932745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072664171.1|2932858_2933119_+	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_012541886.1|2933742_2933901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022065676.1|2934158_2934674_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	1.7e-22
>prophage 5
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	3043543	3084611	5542270	tRNA,transposase,plate	Escherichia_phage(50.0%)	42	NA	NA
WP_002902422.1|3043543_3044479_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_032735419.1|3044524_3045898_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_032735417.1|3046423_3047407_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_012541956.1|3047685_3048429_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	4.1e-17
WP_046878927.1|3048391_3049510_+	oxidoreductase	NA	NA	NA	NA	NA
WP_008805155.1|3049746_3049941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032754194.1|3050056_3050806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008805157.1|3051041_3052418_-	amino acid permease	NA	NA	NA	NA	NA
WP_008805158.1|3052752_3053232_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002902402.1|3053482_3054097_+	YitT family protein	NA	NA	NA	NA	NA
WP_032754191.1|3054135_3055335_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004892563.1|3055379_3056048_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032733457.1|3056040_3057054_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.5	7.6e-30
WP_012968382.1|3057062_3057869_-	methionine-binding protein	NA	NA	NA	NA	NA
WP_080923340.1|3058089_3059265_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032735411.1|3059311_3060346_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173818210.1|3060434_3060983_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032735410.1|3061039_3061951_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_173818212.1|3061950_3062814_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162708829.1|3063510_3063825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032735406.1|3063844_3064750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032730181.1|3064888_3065818_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_012968391.1|3065843_3066050_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|3066099_3066978_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022066352.1|3067136_3067892_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_173818214.1|3067896_3068490_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805173.1|3068563_3069277_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_131010802.1|3069343_3069838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173818216.1|3069962_3070505_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072124844.1|3070482_3071568_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_131010803.1|3071531_3073286_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_049155396.1|3073362_3073833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049155394.1|3073829_3074885_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_015874732.1|3074915_3076514_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_173818218.1|3076513_3080017_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_020324630.1|3079965_3081174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072072278.1|3081919_3082348_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_072072277.1|3082440_3083511_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	35.0	5.6e-07
WP_077268497.1|3083497_3084040_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	1.3e-07
WP_077270055.1|3084059_3084203_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015874727.1|3084343_3084535_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015874726.1|3084506_3084611_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	3318474	3411872	5542270	tRNA,holin,portal,capsid,terminase,head,tail,integrase	Klebsiella_phage(44.44%)	99	3345401:3345417	3409926:3409942
WP_173818251.1|3318474_3318975_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_008807681.1|3319092_3319539_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_163593195.1|3319522_3320317_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163593198.1|3320423_3321599_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_012968515.1|3321630_3322323_-	CTP synthase	NA	NA	NA	NA	NA
WP_032739592.1|3322468_3322978_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_163593197.1|3322982_3323321_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_032739591.1|3323310_3323550_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_023297404.1|3323851_3324865_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3324922_3325024_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|3325023_3325098_+	protein YoaJ	NA	NA	NA	NA	NA
WP_012542130.1|3325217_3325343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004203731.1|3325402_3325666_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004203730.1|3325796_3326435_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|3326524_3327439_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_173818253.1|3328096_3329140_-	type II asparaginase	NA	NA	NA	NA	NA
WP_032754049.1|3329448_3330657_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012542132.1|3330730_3332515_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_008807694.1|3332521_3333412_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012542133.1|3333532_3335035_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_012542134.1|3335110_3335521_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016160694.1|3335650_3336337_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032691162.1|3336804_3336993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807698.1|3336971_3337604_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032754041.1|3338176_3338374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032754039.1|3338432_3339227_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100781348.1|3339304_3341356_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012968537.1|3341348_3341561_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_022066226.1|3341557_3342478_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012542144.1|3342471_3343482_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012542145.1|3343478_3344885_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_043875502.1|3344940_3345828_-	manganese catalase family protein	NA	NA	NA	NA	NA
3345401:3345417	attL	TCGGCGGTGGGTTCGCC	NA	NA	NA	NA
WP_008807706.1|3345844_3346351_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_008807707.1|3346377_3346872_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3346961_3347147_-	general stress protein	NA	NA	NA	NA	NA
WP_064160807.1|3347757_3348951_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072023763.1|3349004_3349196_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_012968540.1|3349240_3349786_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_008807711.1|3350106_3350580_+	OsmC family protein	NA	NA	NA	NA	NA
WP_008807712.1|3350717_3351041_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_064160808.1|3351033_3351426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012968544.1|3351422_3352136_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032730035.1|3352473_3352947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022066233.1|3352943_3353282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892953.1|3353680_3353833_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_123797883.1|3354165_3354489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173818254.1|3354494_3355187_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_085841091.1|3355542_3356601_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-15
WP_021462614.1|3357023_3358448_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	4.1e-98
WP_099441265.1|3358509_3371100_-	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.7	0.0e+00
WP_032447254.1|3371162_3371756_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
WP_085898365.1|3371776_3372601_-	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	45.9	1.8e-05
WP_085898366.1|3372647_3373358_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	5.2e-134
WP_023289191.1|3373359_3374115_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_017880254.1|3374111_3374450_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_085898367.1|3374449_3377785_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.4	0.0e+00
WP_014228914.1|3378017_3378383_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_173818256.1|3378440_3378902_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.0	2.3e-66
WP_172601091.1|3378933_3379326_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	2.7e-60
WP_017880258.1|3379331_3379721_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_064291707.1|3379701_3380040_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.1e-53
WP_023339902.1|3380036_3380354_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_048964994.1|3380334_3380622_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_046622319.1|3380679_3381966_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.2	6.3e-207
WP_033128541.1|3382043_3382964_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
WP_061154057.1|3383000_3384260_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	3.1e-222
WP_020318187.1|3384259_3384439_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_014228904.1|3384432_3386154_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_012542168.1|3386153_3386588_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023279521.1|3386835_3387267_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	2.4e-41
WP_016160653.1|3387263_3387581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228901.1|3387532_3387895_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_022065713.1|3389018_3389369_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	36.8	2.5e-09
WP_064151301.1|3389365_3389863_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.7	1.8e-80
WP_017880269.1|3389862_3390078_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_022064937.1|3390970_3392002_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	93.3	7.2e-177
WP_064277453.1|3392072_3392534_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	83.0	1.9e-60
WP_064277416.1|3392555_3392897_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	2.4e-57
WP_022065891.1|3392909_3393941_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.0	1.4e-95
WP_049114843.1|3394140_3394533_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_050597314.1|3394573_3394813_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_014228891.1|3394875_3395109_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	69.7	2.4e-24
WP_048333319.1|3395763_3397125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040975727.1|3397468_3399232_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099441261.1|3399544_3399985_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021462583.1|3399998_3400463_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.7e-61
WP_021462582.1|3400455_3401439_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
WP_014907826.1|3401490_3402045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3402047_3402263_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3402364_3402754_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_099217174.1|3403596_3403791_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_072123312.1|3403950_3404289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099441260.1|3404430_3406569_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.5	5.6e-99
WP_012542206.1|3406621_3406867_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3406847_3407975_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_173818258.1|3408092_3409343_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_042947647.1|3409583_3410234_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3409926:3409942	attR	GGCGAACCCACCGCCGA	NA	NA	NA	NA
WP_008806030.1|3410250_3410709_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012542211.1|3410765_3411872_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP054254	Klebsiella variicola strain FH-1 chromosome, complete genome	5542270	3669728	3679176	5542270	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032739423.1|3669728_3671450_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	4.5e-14
WP_008805841.1|3671489_3672194_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3672545_3672764_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3672882_3675162_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3675192_3675510_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3675835_3676057_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_008805839.1|3676123_3678064_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3678060_3679176_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
