The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	379218	463334	2520015	transposase,tRNA	Catovirus(12.5%)	60	NA	NA
WP_021117263.1|379218_379992_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	28.0	8.1e-16
WP_010786502.1|380235_381222_+	amidohydrolase family protein	NA	A0A076FFX9	Aureococcus_anophage	29.4	3.5e-32
WP_021117262.1|381255_382506_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_021114396.1|382505_383192_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.0	1.3e-36
WP_075606513.1|383548_384211_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_075606514.1|384263_385013_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035522451.1|385952_387248_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.5	1.4e-68
WP_021111676.1|387442_388669_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_021112983.1|388753_389194_-	NfeD family protein	NA	NA	NA	NA	NA
WP_035493653.1|389203_390118_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_021111673.1|390241_391378_+	alanine racemase	NA	NA	NA	NA	NA
WP_075606515.1|391467_392658_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_160444837.1|392864_396872_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	25.3	6.7e-45
WP_075606516.1|396886_397339_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_015939869.1|397402_397705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042905297.1|397801_398404_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_075606517.1|398583_400356_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	30.7	5.1e-13
WP_173631982.1|406783_407410_-|transposase	IS1595-like element ISHps3 family transposase	transposase	NA	NA	NA	NA
WP_173631983.1|407461_408571_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_173631984.1|409466_410843_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_173631985.1|410858_412157_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_042905280.1|412156_413107_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.8	5.0e-07
WP_075593004.1|413288_413555_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_015939968.1|413563_413983_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015939967.1|414073_415069_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_015939966.1|415079_415838_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_173631986.1|415812_416439_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_015939964.1|416558_416951_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010787176.1|417056_418022_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	57.2	1.3e-100
WP_016528443.1|418290_418581_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016528442.1|418794_419220_-	universal stress protein	NA	NA	NA	NA	NA
WP_173631987.1|419229_421866_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_021119050.1|422007_422967_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_021111922.1|423191_423800_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.4	3.5e-22
WP_035496570.1|423828_424131_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.3	3.4e-18
WP_035492233.1|424073_424454_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_005599701.1|424483_424618_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_075605010.1|424903_426097_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	48.9	1.1e-88
WP_075606492.1|426160_429361_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_044009216.1|429506_430631_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	3.8e-46
WP_021111916.1|430892_432191_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_021113137.1|432217_433297_+	sodium/calcium exchanger family protein	NA	NA	NA	NA	NA
WP_075606493.1|433563_435465_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.3	1.4e-146
WP_106406258.1|436028_436328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606496.1|436384_437521_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	30.6	2.0e-23
WP_075606497.1|437680_439150_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_075606498.1|439243_440272_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075606499.1|440310_440910_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021111910.1|440910_441414_+	chorismate lyase	NA	NA	NA	NA	NA
WP_075606500.1|441447_442251_+	glutamate racemase	NA	NA	NA	NA	NA
WP_043894679.1|448356_448890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173631988.1|448931_450029_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075606724.1|450160_451081_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_005713507.1|451166_452027_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_042906456.1|453350_453674_+|transposase	transposase	transposase	Q716C1	Shigella_phage	45.9	2.0e-16
WP_021111059.1|453712_453925_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160448756.1|453955_454498_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.5	5.3e-38
WP_160433245.1|455867_456419_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_173631989.1|456803_462560_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_173631990.1|462998_463334_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1014664	1020855	2520015	tail	Mannheimia_phage(75.0%)	10	NA	NA
WP_052316818.1|1014664_1015321_+	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	56.0	1.4e-61
WP_021111144.1|1015320_1015539_+	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	75.0	1.9e-26
WP_021115946.1|1015538_1015958_+	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	62.0	4.4e-40
WP_106379886.1|1016059_1016227_+	photosystem I reaction center subunit PsaK	NA	NA	NA	NA	NA
WP_021110711.1|1016320_1017046_+	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	70.7	2.6e-85
WP_106404773.1|1018291_1018429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714478.1|1018909_1019191_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.6	2.3e-08
WP_005714476.1|1019202_1019481_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_075621239.1|1019551_1020313_+	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	48.8	9.3e-65
WP_075605084.1|1020342_1020855_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	50.3	3.9e-35
>prophage 3
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1116625	1123770	2520015		uncultured_Mediterranean_phage(16.67%)	6	NA	NA
WP_075606454.1|1116625_1119454_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	1.3e-305
WP_021110692.1|1119756_1120275_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	51.4	2.3e-38
WP_062923800.1|1120427_1121915_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.6	1.5e-82
WP_075606453.1|1121924_1123145_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	1.3e-39
WP_005712616.1|1123208_1123481_-	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	42.5	2.2e-08
WP_005712614.1|1123491_1123770_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	50.0	5.3e-18
>prophage 4
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1187427	1254656	2520015	terminase,holin,tail,protease,integrase,portal	Mannheimia_phage(37.5%)	89	1198964:1198985	1252177:1252198
WP_012621715.1|1187427_1187835_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.1	8.9e-22
WP_075593110.1|1187836_1188478_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021113541.1|1188693_1189011_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_075606585.1|1189054_1190353_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_010786958.1|1190352_1191243_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_035496697.1|1191330_1191693_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_021114881.1|1191686_1191956_-	spoVT / AbrB like domain protein	NA	NA	NA	NA	NA
WP_021116897.1|1192206_1193397_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010786955.1|1193477_1194392_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075621218.1|1194463_1195651_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021116899.1|1195714_1196596_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_021109517.1|1196679_1197546_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016527934.1|1197547_1198018_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_042905847.1|1198345_1198621_-	hypothetical protein	NA	NA	NA	NA	NA
1198964:1198985	attL	GATTATTGGTGCTCTGGGCGAG	NA	NA	NA	NA
WP_035491741.1|1199183_1199480_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	50.0	6.7e-19
WP_173632049.1|1199557_1204882_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	37.6	7.1e-252
WP_075592529.1|1205000_1205825_-	phage antirepressor N-terminal domain-containing protein	NA	Q0H8C7	Salmonella_phage	47.2	8.0e-62
WP_021118892.1|1205869_1206037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012621823.1|1206619_1207138_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	50.3	3.1e-35
WP_173632050.1|1207167_1207920_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	48.8	3.2e-65
WP_021118486.1|1207921_1208659_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.5	7.9e-69
WP_075592533.1|1208926_1209448_-	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	37.9	9.3e-24
WP_075606003.1|1209525_1209858_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	40.0	2.7e-13
WP_173632051.1|1209902_1213466_-	tape measure protein	NA	A0A0E3JQ03	Enterobacteria_phage	22.9	2.2e-47
WP_075606005.1|1213527_1213794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075606006.1|1213893_1214073_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	2.8e-20
WP_075606007.1|1214148_1214376_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075606008.1|1214420_1214822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075606009.1|1215090_1215756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075606010.1|1215758_1216178_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	32.6	8.0e-10
WP_075606011.1|1216177_1216711_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	35.3	7.0e-19
WP_075606012.1|1216714_1217017_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021110719.1|1217009_1217336_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_075606013.1|1217435_1219403_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	53.8	1.6e-193
WP_160433244.1|1219413_1219581_-	photosystem I reaction center subunit PsaK	NA	NA	NA	NA	NA
WP_160442000.1|1219657_1221151_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	57.3	4.1e-157
WP_005714374.1|1221151_1221373_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	55.9	1.3e-11
WP_173632052.1|1221511_1222138_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	50.0	1.2e-14
WP_173632053.1|1222396_1222924_-	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	34.5	1.0e-17
WP_160442001.1|1223044_1225180_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	66.2	4.3e-269
WP_005714379.1|1225179_1225647_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	53.9	1.3e-40
WP_075593094.1|1225961_1226246_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	68.9	5.6e-23
WP_021110725.1|1226139_1226484_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	60.7	9.8e-06
WP_021116913.1|1226456_1227002_-	lysozyme	NA	Q19UR6	Mannheimia_phage	50.3	2.5e-43
WP_021116914.1|1226976_1227276_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	53.3	2.7e-12
WP_042905676.1|1227387_1227837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110729.1|1227799_1227994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021116916.1|1228193_1229018_-	phage antirepressor N-terminal domain-containing protein	NA	Q0H8C7	Salmonella_phage	47.2	7.5e-60
WP_021110921.1|1229332_1229500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021116917.1|1229796_1230015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043895698.1|1230067_1230886_-	damage-inducible protein D	NA	NA	NA	NA	NA
WP_021116919.1|1231250_1231436_+	hypothetical protein	NA	A0A0R6PI59	Moraxella_phage	42.9	6.9e-06
WP_021116920.1|1231444_1231822_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	26.2	1.7e-06
WP_021116921.1|1231818_1232223_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	43.5	1.1e-21
WP_021110734.1|1232219_1232510_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	89.1	1.7e-43
WP_005714427.1|1232602_1232785_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_021110735.1|1232823_1233231_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	54.1	1.2e-37
WP_021110736.1|1233264_1233693_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	59.7	4.3e-43
WP_173632054.1|1234011_1234683_-|holin	holin	holin	D0UIL4	Aggregatibacter_phage	37.2	8.5e-38
WP_021110739.1|1234682_1235468_-	replication protein	NA	A0A0M3LS90	Mannheimia_phage	71.3	2.7e-27
WP_052316815.1|1235464_1236100_-	phage antirepressor KilAC domain-containing protein	NA	A0A2I7QYL9	Vibrio_phage	50.7	8.6e-48
WP_021116926.1|1236195_1236471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012621794.1|1236491_1236698_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	45.3	2.8e-08
WP_021110742.1|1236833_1237487_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	68.4	1.1e-69
WP_021110743.1|1237561_1238635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606019.1|1238648_1238984_+	DUF4325 domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	36.1	1.3e-10
WP_075606020.1|1238973_1239399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606021.1|1239490_1240087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042905667.1|1240775_1241417_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_021110750.1|1241472_1241793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110751.1|1241789_1242011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110752.1|1241997_1242204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110753.1|1242283_1242760_+	siphovirus Gp157 family protein	NA	A0A1W6JP90	Staphylococcus_phage	37.6	3.3e-12
WP_021110754.1|1242923_1243949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606022.1|1244053_1244710_+	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	55.0	4.2e-66
WP_075606023.1|1244711_1245350_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	45.1	5.4e-34
WP_005823354.1|1245416_1245605_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	50.0	5.7e-08
WP_173632055.1|1245973_1246333_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	33.9	6.4e-08
WP_173632056.1|1246363_1247161_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_021116938.1|1247240_1247504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606024.1|1247517_1248207_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	35.9	5.9e-18
WP_160442013.1|1248219_1248375_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_012621817.1|1248583_1248802_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	77.8	5.2e-21
WP_173632057.1|1249345_1250164_+	hypothetical protein	NA	B6SD63	Bacteriophage	52.1	1.6e-25
WP_043894432.1|1250368_1250662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173632058.1|1250693_1250984_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	34.8	1.2e-07
WP_005712908.1|1250980_1251979_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	57.4	2.3e-103
WP_005712907.1|1252281_1252611_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
1252177:1252198	attR	GATTATTGGTGCTCTGGGCGAG	NA	NA	NA	NA
WP_075606026.1|1252736_1254656_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	6.7e-35
>prophage 5
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1287409	1374534	2520015	terminase,head,tRNA,tail,capsid,integrase,portal,plate	Mannheimia_phage(53.66%)	90	1324955:1324970	1375209:1375224
WP_042905644.1|1287409_1290034_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	1.0e-78
WP_021110787.1|1290258_1290684_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_075604617.1|1290998_1293275_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_021110790.1|1293973_1294270_-	YciI family protein	NA	NA	NA	NA	NA
WP_042905642.1|1294281_1294722_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_005711560.1|1294705_1295269_-	septation protein A	NA	NA	NA	NA	NA
WP_075606037.1|1295277_1296006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021112350.1|1296184_1296619_+	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_043894448.1|1296600_1297137_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	32.0	3.1e-06
WP_075606038.1|1297233_1299066_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.0	1.9e-55
WP_075606039.1|1299444_1300371_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_075606040.1|1300444_1302574_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021116971.1|1302910_1303252_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021112352.1|1303248_1303566_+	XRE family transcriptional regulator	NA	A0A1S5R3V5	Pseudomonas_phage	44.7	2.3e-09
WP_075606041.1|1303800_1305594_-	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	25.7	9.4e-07
WP_075606042.1|1305812_1307966_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_042905634.1|1308208_1309855_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_021110803.1|1309901_1310264_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_021110804.1|1310422_1312657_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	2.5e-41
WP_042905633.1|1312742_1315076_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_075604556.1|1315143_1316511_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_021110807.1|1316513_1316963_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_021116982.1|1316968_1317541_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_075606091.1|1317638_1318346_-	YdcF family protein	NA	NA	NA	NA	NA
WP_044008967.1|1318349_1319243_-	DMT family transporter	NA	NA	NA	NA	NA
WP_173632061.1|1319493_1320102_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.7	8.3e-32
WP_075606043.1|1320068_1320818_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_021116986.1|1320994_1323304_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_005711597.1|1323434_1324859_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	2.4e-42
1324955:1324970	attL	CAAATCTGACCGCTTA	NA	NA	NA	NA
WP_075606044.1|1324976_1326875_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_043894450.1|1327024_1329682_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_012621758.1|1330064_1330559_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_042905628.1|1330559_1331525_+	asparaginase	NA	NA	NA	NA	NA
WP_075606045.1|1331632_1332727_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_042905626.1|1332820_1333330_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.5	4.0e-11
WP_021110821.1|1333397_1334108_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_173632062.1|1334229_1335378_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.8	1.8e-128
WP_075621098.1|1335897_1337901_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_021110825.1|1338027_1338798_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_052157446.1|1339380_1340352_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	60.7	2.5e-115
WP_075606046.1|1340359_1342138_-|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.6	7.2e-217
WP_075606047.1|1342304_1343138_+|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	53.1	3.6e-70
WP_075606048.1|1343171_1344248_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	55.9	4.3e-100
WP_021110830.1|1344253_1344916_+|terminase	phage small terminase subunit	terminase	A4JWP8	Burkholderia_virus	41.4	1.3e-38
WP_075604546.1|1345033_1345510_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	54.5	8.4e-40
WP_021116997.1|1345509_1345716_+|tail	tail protein X	tail	A0A0M3LPY0	Mannheimia_phage	59.7	1.4e-12
WP_043895751.1|1345721_1345943_+	hypothetical protein	NA	Q19UR7	Mannheimia_phage	43.9	3.7e-06
WP_035522662.1|1345926_1346451_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	57.4	6.9e-51
WP_075604545.1|1346435_1346903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110836.1|1347111_1347279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110837.1|1347256_1347709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021115818.1|1347824_1348043_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	71.2	3.1e-21
WP_075604544.1|1348039_1348516_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	52.9	1.9e-39
WP_075604543.1|1348515_1348977_+	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	62.3	1.3e-40
WP_075604542.1|1349143_1349389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081378059.1|1349423_1352186_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	34.6	2.4e-102
WP_021118247.1|1352280_1352478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118248.1|1352458_1352833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021113085.1|1352946_1353144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606049.1|1353269_1353842_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	60.8	1.0e-39
WP_021110844.1|1353841_1354183_+	GPW/gp25 family protein	NA	A0A0M3LQ08	Mannheimia_phage	66.7	8.2e-29
WP_075604541.1|1354179_1355094_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	67.1	3.5e-111
WP_071610266.1|1355083_1355623_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	55.8	3.7e-52
WP_075604540.1|1358132_1358696_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	90.7	1.0e-92
WP_021113064.1|1358682_1358952_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	83.5	9.9e-38
WP_075606050.1|1359055_1360228_+|tail	phage tail sheath protein	tail	E5E3Q3	Burkholderia_phage	56.6	2.9e-126
WP_021110851.1|1360282_1360792_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	54.1	1.2e-44
WP_075606051.1|1360843_1361179_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	46.7	1.3e-10
WP_071610269.1|1361187_1361307_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	61.5	1.3e-05
WP_043896106.1|1361383_1361821_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	62.8	1.6e-48
WP_042905887.1|1361817_1362966_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	66.2	1.7e-142
WP_075606052.1|1363202_1363559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042905890.1|1363567_1364014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075604534.1|1364039_1364345_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	50.0	4.5e-10
WP_021113041.1|1364366_1364699_-	hypothetical protein	NA	A0A0M3LRY6	Mannheimia_phage	65.1	6.3e-34
WP_075606053.1|1364709_1365861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113122.1|1365869_1366331_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075604532.1|1366458_1366653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042905893.1|1366686_1367193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035524138.1|1367388_1367781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021110863.1|1367975_1368248_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	70.2	3.2e-28
WP_075606054.1|1368326_1368647_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	40.4	7.7e-05
WP_075606055.1|1368656_1368971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021117027.1|1369096_1369312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606056.1|1369286_1371710_+	replication endonuclease	NA	Q1I108	Pasteurella_virus	47.4	3.9e-165
WP_035524151.1|1371696_1372086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606057.1|1372094_1372616_+	ash family protein	NA	NA	NA	NA	NA
WP_075606058.1|1372608_1372935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110872.1|1373021_1373279_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021110873.1|1373316_1374534_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.5	4.6e-58
1375209:1375224	attR	TAAGCGGTCAGATTTG	NA	NA	NA	NA
>prophage 6
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1447319	1457082	2520015	tRNA	Ostreococcus_lucimarinus_virus(12.5%)	9	NA	NA
WP_075606080.1|1447319_1448582_-	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	35.7	1.1e-59
WP_075606081.1|1448601_1449282_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_021111620.1|1449591_1450575_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	7.1e-33
WP_075606082.1|1450730_1453118_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.4e-05
WP_016527802.1|1453134_1453431_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	2.1e-12
WP_106406244.1|1453482_1453995_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	40.0	1.8e-16
WP_016527800.1|1454182_1454836_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.0	1.1e-34
WP_005710639.1|1454852_1455437_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
WP_075606083.1|1455567_1457082_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.0	1.2e-79
>prophage 7
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1465479	1521371	2520015	transposase,tRNA,integrase	Staphylococcus_phage(27.27%)	53	1501539:1501555	1524832:1524848
WP_021111606.1|1465479_1466208_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_021111605.1|1466225_1466381_+	YoaH family protein	NA	NA	NA	NA	NA
WP_021112461.1|1466381_1466846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021116689.1|1466856_1467153_-	RnfH family protein	NA	NA	NA	NA	NA
WP_021116688.1|1467142_1467577_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_005710678.1|1467785_1468289_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_021116687.1|1468293_1468974_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021111600.1|1468973_1469255_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_075606087.1|1469441_1471052_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	2.2e-140
WP_021116531.1|1471651_1472482_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_021111597.1|1472534_1473164_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_021111596.1|1473191_1473761_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_021111595.1|1473882_1475421_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_021111594.1|1475417_1476302_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_005710704.1|1476455_1477097_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_075606685.1|1477994_1479185_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_075606686.1|1479335_1481543_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_075606687.1|1481817_1483125_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_021111658.1|1483265_1484780_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_075606688.1|1484792_1486220_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.5	8.4e-35
WP_016527772.1|1486287_1487226_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_075606689.1|1487324_1488185_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_021111654.1|1490087_1491362_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_075606576.1|1491385_1491643_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021111652.1|1491645_1491984_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_021111651.1|1491991_1492627_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005710726.1|1492663_1493173_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_021112484.1|1493245_1494022_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_021109697.1|1494018_1494819_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.7	1.7e-21
WP_021111649.1|1495013_1495604_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_021111648.1|1495624_1496215_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_035496084.1|1496216_1496573_-	YraN family protein	NA	NA	NA	NA	NA
WP_075606575.1|1496562_1498302_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_042906400.1|1498392_1499253_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.0	7.3e-50
WP_010786684.1|1499429_1499915_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.4	1.6e-17
WP_005710743.1|1500110_1500950_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_075606574.1|1501045_1504006_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
1501539:1501555	attL	GCTTTTGCCATTCTCAC	NA	NA	NA	NA
WP_021111644.1|1504236_1505604_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.9	1.1e-111
WP_075606573.1|1505751_1506699_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	33.0	9.6e-27
WP_021111642.1|1506723_1507266_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.9	2.3e-49
WP_075606572.1|1507350_1508532_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042905713.1|1508524_1509181_+	membrane protein	NA	NA	NA	NA	NA
WP_173632065.1|1509845_1510079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080651876.1|1510658_1511075_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042905716.1|1511597_1512386_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_021112557.1|1512491_1514417_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_021112548.1|1515187_1516087_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042905715.1|1516248_1516683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052157455.1|1516672_1516984_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_170386723.1|1517315_1518287_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_006744646.1|1518625_1519540_+	alpha/beta hydrolase	NA	B3VGL1	Mycobacterium_virus	22.6	6.9e-06
WP_173632116.1|1520131_1521103_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	1.8e-52
WP_173632066.1|1520996_1521371_-|transposase	transposase	transposase	NA	NA	NA	NA
1524832:1524848	attR	GCTTTTGCCATTCTCAC	NA	NA	NA	NA
>prophage 8
NZ_CP054198	Glaesserella parasuis strain YHP170504 chromosome, complete genome	2520015	1863871	1872265	2520015		Staphylococcus_phage(50.0%)	7	NA	NA
WP_042905790.1|1863871_1864663_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	1.8e-10
WP_021113976.1|1864774_1865236_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.1	6.0e-43
WP_021112688.1|1865328_1866528_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.0	5.3e-99
WP_160428693.1|1866659_1867304_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.2	1.2e-41
WP_160433153.1|1867328_1868420_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.3	3.2e-50
WP_021113972.1|1868888_1870763_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021113971.1|1870945_1872265_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	35.2	1.2e-30
