The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	1162763	1213283	5117375	plate,terminase,tail,integrase,tRNA,capsid,portal,lysis,head,transposase	Salmonella_phage(83.33%)	65	1164233:1164279	1201909:1201955
WP_101971378.1|1162763_1164002_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.6	1.5e-101
1164233:1164279	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_031591562.1|1164364_1165411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|1165400_1166441_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_031591564.1|1166444_1167077_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
WP_000102105.1|1167193_1167436_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|1167468_1167978_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956190.1|1167985_1168186_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_031591570.1|1168149_1168491_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
WP_016529331.1|1168558_1168792_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_031591572.1|1168791_1169019_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_065953674.1|1169015_1169873_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	7.1e-162
WP_042943241.1|1169869_1172284_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_004225014.1|1172580_1173549_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_032357588.1|1173701_1173935_+	DinI family protein	NA	E5G6M1	Salmonella_phage	88.3	1.1e-32
WP_000020981.1|1174332_1174803_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.2	8.4e-24
WP_001369944.1|1174806_1175388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555843.1|1175365_1175737_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	48.4	2.6e-28
WP_000904469.1|1175731_1176277_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072042792.1|1176342_1176720_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_173424213.1|1176731_1177523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040149918.1|1177519_1178563_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.1	2.9e-170
WP_031591583.1|1178562_1180329_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1180471_1181305_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_040149921.1|1181321_1182380_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|1182383_1183034_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1183129_1183594_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_031591593.1|1183593_1183797_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|1183800_1184016_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_031591597.1|1183996_1184512_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
WP_031591599.1|1184508_1184937_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
WP_001039947.1|1185032_1185464_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_173424214.1|1185456_1185921_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.9	2.1e-59
WP_031591601.1|1186008_1187520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591602.1|1187646_1188225_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_159139389.1|1188221_1188581_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_031591606.1|1188567_1189476_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|1189468_1190074_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_031591609.1|1190070_1191792_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
WP_050486392.1|1191791_1191974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173424259.1|1191954_1192014_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_173424258.1|1192026_1192107_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_016529756.1|1192769_1193336_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	4.2e-86
WP_031591343.1|1193478_1194651_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
WP_001504081.1|1194660_1195176_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|1195230_1195533_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1195547_1195667_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_031591348.1|1195659_1198737_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_016529761.1|1198733_1199219_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_031591350.1|1199215_1200316_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	1.4e-175
WP_000972389.1|1200406_1200625_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000380485.1|1200886_1201060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151541.1|1201028_1201802_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_002914164.1|1202417_1202900_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1201909:1201955	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_015875096.1|1203010_1203487_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1203476_1203767_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1203833_1204175_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1204322_1205984_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1206070_1206949_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1207073_1207664_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1207783_1209070_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1209089_1209881_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1210044_1211409_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1211668_1211917_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1211935_1212484_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1212515_1213283_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	1664412	1671317	5117375	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1664412_1665276_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|1665286_1666060_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1666300_1667197_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1667439_1668801_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1669119_1669842_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1669838_1671317_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	1714662	1725517	5117375	transposase	Enterobacteria_phage(22.22%)	9	NA	NA
WP_000043543.1|1714662_1716069_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1716295_1717711_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1717732_1719103_+	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1719257_1720322_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1720335_1721205_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1721236_1722127_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1722141_1722696_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1722875_1724042_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_004225014.1|1724548_1725517_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
>prophage 4
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	1927510	1982492	5117375	plate,transposase,protease	Staphylococcus_phage(25.0%)	46	NA	NA
WP_002910830.1|1927510_1928257_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032445203.1|1928696_1929683_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|1929675_1930476_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|1930513_1930636_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|1930933_1931077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|1931253_1932195_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_040224098.1|1932288_1933278_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1933303_1934635_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004175486.1|1934662_1935871_+	propionate kinase	NA	NA	NA	NA	NA
WP_004175487.1|1935899_1938194_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.1e-158
WP_004225356.1|1938245_1938392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|1938681_1939740_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|1939849_1940764_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004175490.1|1940773_1942060_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|1942056_1942932_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_040224101.1|1942928_1943648_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.1e-11
WP_002910720.1|1943653_1944547_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|1944830_1946474_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1946523_1947000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1947100_1948027_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|1948330_1949626_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004145468.1|1949637_1950447_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1950421_1951321_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1951430_1951913_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_032444883.1|1952103_1952802_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	5.3e-06
WP_032444903.1|1952827_1953367_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|1953481_1953811_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032415142.1|1954378_1955719_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032415141.1|1955715_1956369_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032438247.1|1956372_1958070_+	OmpA family protein	NA	NA	NA	NA	NA
WP_173424224.1|1958528_1961228_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	5.3e-14
WP_129073832.1|1961224_1963102_+	phospholipase	NA	NA	NA	NA	NA
WP_017879837.1|1963101_1964376_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032415135.1|1964413_1965694_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_101971160.1|1965731_1966799_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004225014.1|1967693_1968662_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_031285250.1|1969904_1971176_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_044246017.1|1971213_1972278_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_021314031.1|1972491_1973469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004216433.1|1973556_1973820_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032434041.1|1973939_1975085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117040679.1|1975190_1978586_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_101971157.1|1978719_1980483_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029497089.1|1980512_1981529_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004175532.1|1981509_1982046_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_019724967.1|1982048_1982492_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	2639221	2650108	5117375		Escherichia_phage(87.5%)	9	NA	NA
WP_021440086.1|2639221_2642329_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2642383_2643649_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2643679_2644768_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2644854_2645115_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_063864703.1|2645412_2646273_+	class A broad-spectrum beta-lactamase SHV-71	NA	A0A077SL40	Escherichia_phage	99.0	4.9e-155
WP_002210513.1|2646293_2647055_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2647315_2648218_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_048997799.1|2648229_2649495_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.7e-233
WP_002210516.1|2649487_2650108_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP054063	Klebsiella pneumoniae strain WSHvKP chromosome, complete genome	5117375	3312266	3321730	5117375	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_101971251.1|3312266_3313988_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3314032_3314734_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3315087_3315306_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3315426_3317706_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3317736_3318054_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3318379_3318601_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3318677_3320618_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_101971250.1|3320614_3321730_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	9.9e-07
>prophage 1
NZ_CP054064	Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence	211588	93769	143536	211588	transposase,integrase	Salmonella_phage(13.33%)	38	134564:134578	147652:147666
WP_011154590.1|93769_93976_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
WP_004213628.1|94432_95665_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_004213626.1|95649_96294_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_074160420.1|96400_96628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004213623.1|96643_97759_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_023302798.1|97901_101546_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.7	3.2e-46
WP_004902400.1|101650_102880_+	esterase family protein	NA	NA	NA	NA	NA
WP_004213617.1|103339_105514_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_004213615.1|105575_105797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213613.1|105939_106842_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004213611.1|106914_107466_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213609.1|107846_108479_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023302796.1|109021_109675_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004902370.1|112290_112857_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_004902367.1|112859_113390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902363.1|113713_114127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902361.1|114211_114700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026379.1|114751_115162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225014.1|115393_116362_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_011251296.1|117484_118351_+	ParA family protein	NA	NA	NA	NA	NA
WP_004902347.1|118350_119382_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|119381_119819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902338.1|119815_120139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|122165_122948_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004211835.1|125698_126235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|128554_129565_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211841.1|130294_131461_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004117790.1|131460_132432_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004215130.1|134016_134457_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|134453_134804_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
134564:134578	attL	TCCCTTCTCCGGCCA	NA	NA	NA	NA
WP_004902302.1|134834_136427_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|136695_137664_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004213821.1|138927_139371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|139380_139788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154511.1|139830_140790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|141541_141865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213829.1|142016_142334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|142399_143536_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
147652:147666	attR	TGGCCGGAGAAGGGA	NA	NA	NA	NA
