The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	23737	32451	3879167	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_008342028.1|23737_25012_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	1.7e-95
WP_008342025.1|25113_25941_+	chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.1e-10
WP_024719578.1|26250_26910_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.1e-21
WP_017366700.1|26906_27530_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	28.8	2.0e-12
WP_173407665.1|27609_28911_-	glycoside hydrolase family 18 protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
WP_041091587.1|28956_29511_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_100325785.1|29590_30067_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_100325784.1|30738_32451_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.4	6.8e-55
>prophage 2
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	664275	674171	3879167		Synechococcus_phage(50.0%)	9	NA	NA
WP_008344295.1|664275_665571_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	2.9e-18
WP_007496901.1|665643_666366_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	1.8e-46
WP_008344293.1|666358_666613_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.6e-05
WP_008344292.1|666609_667293_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_024719398.1|667276_669508_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.1	1.7e-159
WP_017359819.1|669483_670914_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.3e-51
WP_019743757.1|671010_672051_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.5	2.6e-65
WP_008344288.1|672047_672617_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	2.9e-31
WP_008344287.1|672632_674171_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	4.8e-76
>prophage 3
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	1037215	1079295	3879167	plate,capsid,tail,integrase,terminase,portal,holin,head	uncultured_Caudovirales_phage(85.45%)	65	1038880:1038899	1079915:1079934
WP_046343106.1|1037215_1038076_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	2.9e-54
WP_003210924.1|1038140_1038371_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_056408052.1|1038660_1038957_+	competence protein ComK	NA	NA	NA	NA	NA
1038880:1038899	attL	GGTATATCACACAAGCCTCC	NA	NA	NA	NA
WP_110487432.1|1038981_1040175_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.4	3.3e-85
WP_008348797.1|1040188_1040692_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	92.2	4.1e-85
WP_045035255.1|1040758_1041691_-	hypothetical protein	NA	A0A2H4JCX8	uncultured_Caudovirales_phage	83.5	1.2e-119
WP_173407892.1|1041885_1042245_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	95.0	7.0e-55
WP_076839272.1|1042407_1042632_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	97.3	1.2e-33
WP_008348790.1|1042643_1042949_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	50.0	3.3e-21
WP_113747663.1|1042945_1043635_+	ORF6C domain-containing protein	NA	A0A0F6N3N8	Staphylococcus_phage	49.0	4.2e-32
WP_173407893.1|1043701_1044271_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	80.4	1.3e-82
WP_113747661.1|1044267_1044546_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	97.8	3.1e-42
WP_034282992.1|1044755_1044935_+	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	94.9	8.3e-25
WP_173407894.1|1044937_1045888_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	97.5	4.9e-172
WP_173407895.1|1045887_1046727_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	91.8	1.1e-143
WP_173407896.1|1046888_1047593_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	91.9	1.4e-120
WP_173407897.1|1047582_1048386_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	95.5	2.7e-139
WP_173407898.1|1048399_1048576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173407899.1|1048799_1049255_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	94.7	6.5e-74
WP_173407900.1|1049368_1049524_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	94.1	9.7e-22
WP_110487447.1|1049611_1049818_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	87.7	8.7e-26
WP_173407901.1|1049833_1050082_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	81.5	3.8e-28
WP_173407902.1|1050078_1051338_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	44.0	2.3e-116
WP_173407903.1|1051354_1051816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173407904.1|1051831_1052056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173407905.1|1052052_1052445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408448.1|1052512_1052713_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	72.7	4.5e-19
WP_173407906.1|1052882_1053308_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	91.5	3.8e-68
WP_173407907.1|1053319_1053463_+	hypothetical protein	NA	A0A2H4JCE7	uncultured_Caudovirales_phage	97.8	3.8e-20
WP_173407908.1|1053485_1053695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173407909.1|1053929_1054418_+	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	95.1	3.3e-79
WP_173407910.1|1054421_1054877_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	94.7	1.5e-78
WP_173407911.1|1055023_1055383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105927703.1|1055455_1056055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173407912.1|1056195_1056618_+|terminase	terminase small subunit	terminase	S5MA50	Brevibacillus_phage	65.2	3.8e-44
WP_173407913.1|1056610_1057849_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S0KEN9	Bacillus_phage	58.2	1.5e-141
WP_173407914.1|1057862_1059302_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	99.8	1.1e-276
WP_173407915.1|1059333_1059915_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	84.5	1.7e-82
WP_173407916.1|1059927_1060830_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	63.0	1.0e-102
WP_173407917.1|1060829_1060982_+	hypothetical protein	NA	A0A2H4JA81	uncultured_Caudovirales_phage	95.7	4.1e-17
WP_173407918.1|1060993_1061851_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	95.8	2.6e-148
WP_045034742.1|1061850_1062186_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J6J9	uncultured_Caudovirales_phage	98.2	4.2e-54
WP_045034741.1|1062190_1062691_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	100.0	3.9e-88
WP_082472958.1|1062690_1063041_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	93.1	4.7e-56
WP_173407919.1|1063033_1063513_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	97.5	5.6e-84
WP_173407920.1|1063517_1064552_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	97.7	1.8e-188
WP_056408011.1|1064566_1064962_+	DUF3277 family protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	100.0	2.3e-67
WP_156132660.1|1065053_1065356_+	hypothetical protein	NA	A0A2H4J4Q2	uncultured_Caudovirales_phage	94.0	4.5e-47
WP_052659633.1|1065504_1069134_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	96.1	0.0e+00
WP_045034736.1|1069133_1069679_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	99.4	6.2e-95
WP_173407921.1|1069689_1070040_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	99.1	1.6e-59
WP_173407922.1|1070026_1071022_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	98.2	1.4e-158
WP_045034733.1|1071021_1071366_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	97.4	7.6e-59
WP_045034732.1|1071362_1071725_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	82.5	5.6e-44
WP_045034731.1|1071714_1072890_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	98.5	1.1e-210
WP_045034730.1|1072886_1073516_+	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	96.2	4.0e-106
WP_052659632.1|1073530_1074619_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	97.2	2.4e-207
WP_173407923.1|1074629_1074977_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	96.5	1.2e-56
WP_008348673.1|1074966_1075158_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	100.0	6.6e-28
WP_025092921.1|1075219_1075432_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	58.0	6.0e-14
WP_045034727.1|1075447_1075711_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	100.0	4.6e-40
WP_173407924.1|1075768_1076587_+	M15 family metallopeptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	98.8	1.1e-122
WP_173407925.1|1076674_1076968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173407926.1|1077473_1077731_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	92.5	3.7e-34
WP_173407927.1|1077867_1079295_+	type II toxin-antitoxin system RnlA family toxin	NA	R4TF97	Phaeocystis_globosa_virus	28.1	3.0e-08
1079915:1079934	attR	GGTATATCACACAAGCCTCC	NA	NA	NA	NA
>prophage 4
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	1759135	1765384	3879167		Bacillus_phage(66.67%)	6	NA	NA
WP_017359034.1|1759135_1759528_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	56.5	8.8e-27
WP_017359033.1|1759487_1761590_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	82.8	0.0e+00
WP_024720404.1|1761607_1762588_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.9	1.4e-150
WP_007499431.1|1762672_1763290_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	45.3	3.0e-45
WP_008344009.1|1763345_1764104_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	53.8	8.7e-47
WP_041507247.1|1764424_1765384_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.9	2.3e-52
>prophage 5
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	2128657	2136365	3879167		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
WP_163116312.1|2128657_2129749_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.9	1.1e-21
WP_113767080.1|2129748_2130921_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.7	1.7e-41
WP_008344547.1|2130997_2131774_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003216015.1|2131918_2132365_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.3	1.5e-27
WP_007500951.1|2132494_2133457_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
WP_007500957.1|2133481_2134186_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_007500958.1|2134189_2134957_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008344541.1|2135072_2135303_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003215789.1|2135326_2135896_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	1.8e-49
WP_003215863.1|2136086_2136365_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 6
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	2174218	2180795	3879167		Staphylococcus_phage(50.0%)	10	NA	NA
WP_017367523.1|2174218_2175370_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	1.9e-24
WP_024718922.1|2175480_2175960_-	YpuI family protein	NA	NA	NA	NA	NA
WP_008344462.1|2176073_2176667_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.0e-15
WP_007501021.1|2176656_2177415_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	6.5e-10
WP_008359694.1|2177625_2177718_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_138278693.1|2177806_2178331_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_017359785.1|2178551_2178905_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007501031.1|2179018_2179483_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.0	2.1e-43
WP_173408102.1|2179509_2180133_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	59.1	6.9e-58
WP_173408103.1|2180144_2180795_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.8	2.7e-41
>prophage 7
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	2501767	2555062	3879167	tRNA,coat,protease	Moraxella_phage(22.22%)	55	NA	NA
WP_008342748.1|2501767_2502913_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	3.2e-85
WP_007501498.1|2502944_2503973_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_008342752.1|2504007_2504208_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_007501501.1|2504200_2505205_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.0	1.1e-07
WP_173408156.1|2505216_2505822_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_008342756.1|2505969_2506482_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017367714.1|2506708_2507353_+	serine/threonine protein kinase	NA	V5L5V0	Insectomime_virus	27.6	7.0e-05
WP_008342761.1|2507585_2507768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162835670.1|2507960_2508110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408157.1|2508141_2509902_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_024718389.1|2510376_2511009_+	LysE family transporter	NA	NA	NA	NA	NA
WP_017367717.1|2511055_2511676_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_173408158.1|2511809_2513012_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_100325240.1|2513143_2514253_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017367720.1|2514239_2515103_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_173408159.1|2515084_2516656_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_173408160.1|2516754_2517897_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	27.9	8.8e-27
WP_024718395.1|2517900_2518440_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_039167032.1|2518464_2519343_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_008342790.1|2519361_2519805_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_163116424.1|2519860_2521147_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_007501522.1|2521168_2521762_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003216586.1|2522038_2522323_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_007501524.1|2522335_2522674_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003216781.1|2522688_2522997_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_024718398.1|2523149_2524019_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_110487325.1|2524011_2524803_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_017358134.1|2524912_2525716_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_007501533.1|2525718_2526402_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_008342803.1|2526456_2526975_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007501536.1|2526971_2527871_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_007501538.1|2527898_2528918_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_135226741.1|2529008_2529683_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_007501543.1|2529731_2530301_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_045034118.1|2530478_2531672_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_173408161.1|2531652_2532384_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_173408162.1|2532533_2533832_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_100325234.1|2533903_2536546_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.9	1.6e-159
WP_024718406.1|2537001_2537193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408163.1|2537272_2538304_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_173408164.1|2538341_2539583_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041506785.1|2539715_2541008_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_110487328.1|2541035_2542007_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_008342826.1|2542003_2542795_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_173408165.1|2542791_2543727_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007501558.1|2543764_2544595_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024718410.1|2544602_2545970_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_024718411.1|2546210_2546696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163116425.1|2546921_2547317_-	hypothetical protein	NA	A0A2I2L429	Orpheovirus	38.9	1.2e-10
WP_163116426.1|2547317_2548466_-	MFS transporter	NA	NA	NA	NA	NA
WP_017367733.1|2548536_2548677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007501562.1|2548915_2549503_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_041506778.1|2549499_2551824_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	4.8e-181
WP_173408166.1|2551995_2553657_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	26.9	2.4e-17
WP_017358145.1|2553796_2555062_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.2	1.3e-148
>prophage 8
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	2804517	2919900	3879167	plate,capsid,tail,holin,terminase,portal,integrase	Bacillus_phage(30.43%)	147	2841827:2841865	2891822:2891860
WP_008342944.1|2804517_2804922_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_008342942.1|2805079_2805271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408215.1|2805394_2805832_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	64.8	8.3e-50
WP_017358370.1|2805963_2806110_+	YtzI protein	NA	NA	NA	NA	NA
WP_008342936.1|2806118_2806556_-	FixH family protein	NA	NA	NA	NA	NA
WP_008342935.1|2806678_2807152_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_008342933.1|2807280_2807505_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.1e-25
WP_017358372.1|2807506_2808073_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_024719324.1|2808286_2809279_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017358374.1|2809356_2809599_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_173408216.1|2809774_2811106_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_169476099.1|2811128_2812175_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_008360682.1|2812243_2812402_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_024720421.1|2812427_2812619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008342917.1|2812724_2813849_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_045034189.1|2813835_2815296_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.3	3.4e-79
WP_039168312.1|2815366_2816185_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_173408217.1|2816199_2817030_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_173408218.1|2817014_2818757_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_017358381.1|2818749_2820168_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_041506521.1|2820551_2821490_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_041506520.1|2821607_2822342_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_041506519.1|2822430_2822907_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_007500615.1|2830951_2831527_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_058213680.1|2831767_2832322_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041507659.1|2832492_2833131_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_061420002.1|2833145_2834300_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_173408219.1|2834296_2835439_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_008344044.1|2835470_2837018_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	28.4	9.5e-08
WP_017359006.1|2837029_2837560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420006.1|2837765_2838245_+	DinB family protein	NA	NA	NA	NA	NA
WP_007500606.1|2838285_2839494_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_100324849.1|2839521_2840991_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041507664.1|2841197_2841755_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
2841827:2841865	attL	CGGGGCATTAGCTCAGCTGGGAGAGCGCTACGCTGGCAG	NA	NA	NA	NA
WP_117616612.1|2842039_2842201_-	RapH phosphatase inhibitor	NA	NA	NA	NA	NA
WP_056702386.1|2842190_2843309_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	45.7	1.6e-84
WP_056702387.1|2843596_2843932_+	YolD-like family protein	NA	O64030	Bacillus_phage	37.6	2.2e-10
WP_056702388.1|2843999_2844800_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	62.5	4.0e-66
WP_056702389.1|2844858_2845122_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	9.7e-30
WP_025092921.1|2845137_2845350_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	58.0	6.0e-14
WP_041506910.1|2845410_2845554_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	52.3	3.1e-06
WP_056702390.1|2845550_2845925_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	41.9	2.5e-10
WP_056702391.1|2845930_2847061_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	56.1	3.7e-33
WP_056702394.1|2847078_2847462_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_056702397.1|2847474_2848398_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.9	1.6e-10
WP_056702411.1|2848384_2849431_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	40.9	8.3e-64
WP_047946132.1|2849423_2849852_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	33.3	1.5e-11
WP_056702414.1|2849851_2850133_-	DUF2577 family protein	NA	S6C459	Thermus_phage	41.6	7.7e-09
WP_056702417.1|2850129_2851227_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.0	1.2e-36
WP_056702419.1|2851238_2851901_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	32.1	4.3e-26
WP_056702422.1|2851893_2856870_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.6	4.5e-43
WP_056702424.1|2857049_2857499_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	32.4	1.0e-10
WP_074041930.1|2857652_2857742_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_056702426.1|2858061_2858505_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	47.2	1.3e-26
WP_056702427.1|2858506_2859853_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	41.5	9.3e-84
WP_056702955.1|2859855_2860053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702428.1|2860066_2860522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702429.1|2860522_2861032_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	49.7	7.4e-42
WP_056702436.1|2861028_2861385_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_056702438.1|2861381_2861774_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_173408220.1|2861779_2862178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408221.1|2862183_2863113_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	66.1	1.8e-107
WP_173408222.1|2863136_2864291_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	50.6	6.1e-84
WP_173408223.1|2864306_2864858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408224.1|2864900_2865818_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	38.5	4.3e-48
WP_173408225.1|2865814_2867335_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	50.0	2.5e-138
WP_173408226.1|2867334_2868633_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	62.9	9.7e-155
WP_144525720.1|2868632_2869352_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	65.9	4.7e-66
WP_144525721.1|2869512_2869812_-	hypothetical protein	NA	Q9T202	Bacillus_phage	56.5	8.5e-22
WP_025092893.1|2869902_2870490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408466.1|2870618_2871095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408227.1|2871191_2871536_-	structural protein	NA	Q38579	Bacillus_phage	56.1	5.0e-26
WP_056702470.1|2871626_2871806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408228.1|2872320_2873556_+	collagen-like protein	NA	NA	NA	NA	NA
WP_056702476.1|2873589_2873934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056702479.1|2874048_2874432_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	54.0	7.3e-26
WP_056702482.1|2874506_2874851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702485.1|2874847_2875258_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	42.7	1.9e-11
WP_056702487.1|2875254_2875860_-	HNH endonuclease	NA	A0A1S5SDS7	Streptococcus_phage	39.8	2.2e-37
WP_008360821.1|2875862_2876093_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	71.6	3.6e-20
WP_056702490.1|2876095_2876404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702496.1|2876638_2876839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047946039.1|2877047_2877272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702503.1|2877304_2877508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702507.1|2877581_2877863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702510.1|2878150_2878846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702513.1|2878865_2879357_-	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	53.5	5.6e-39
WP_056702516.1|2879353_2880013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702519.1|2880009_2880210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702522.1|2880224_2881517_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	45.4	4.6e-96
WP_056702525.1|2881488_2881776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702528.1|2881781_2882630_-	hypothetical protein	NA	U5Q085	Bacillus_phage	40.2	1.2e-17
WP_056702533.1|2882831_2883536_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	68.4	1.2e-90
WP_056702535.1|2883532_2884456_-	recombinase RecT	NA	D7RWF9	Brochothrix_phage	61.7	6.6e-89
WP_008360779.1|2884448_2884694_-	hypothetical protein	NA	A0A142F1S1	Bacillus_phage	35.1	1.4e-06
WP_056702537.1|2884690_2886673_-	hypothetical protein	NA	A0A1L2K2K3	Aeribacillus_phage	42.5	5.5e-133
WP_056702540.1|2886774_2886993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702543.1|2886989_2887187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702549.1|2887542_2887818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041085486.1|2887820_2888072_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056702556.1|2888174_2888372_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	51.7	6.4e-10
WP_056702559.1|2888426_2888666_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213755.1|2888787_2889207_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056702562.1|2889225_2889876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056702567.1|2889953_2890448_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_056702570.1|2890440_2891724_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	46.8	4.1e-105
WP_041507665.1|2891948_2892131_-	hypothetical protein	NA	NA	NA	NA	NA
2891822:2891860	attR	CGGGGCATTAGCTCAGCTGGGAGAGCGCTACGCTGGCAG	NA	NA	NA	NA
WP_041507666.1|2892247_2893051_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.7	1.6e-62
WP_008361671.1|2893070_2893334_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	5.9e-27
WP_017367922.1|2893346_2893559_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	5.1e-13
WP_039170001.1|2893595_2893736_-	XkdX family protein	NA	NA	NA	NA	NA
WP_041507667.1|2893735_2894056_-	hypothetical protein	NA	O64053	Bacillus_phage	45.2	6.1e-18
WP_163116707.1|2894069_2895452_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	30.8	4.3e-28
WP_173408229.1|2895511_2896675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072368326.1|2896646_2896856_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_073415526.1|2896852_2897182_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	37.1	3.7e-10
WP_173408230.1|2897192_2898071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017359000.1|2898086_2898470_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041507672.1|2898481_2899405_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.5	9.4e-11
WP_039169972.1|2899391_2900438_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	1.9e-68
WP_041507673.1|2900430_2900853_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_039169977.1|2900867_2901134_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	6.2e-08
WP_017367933.1|2901130_2902141_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.4	1.0e-34
WP_173408231.1|2902152_2902821_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.6	2.9e-22
WP_173408467.1|2902813_2906953_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	42.7	4.9e-43
WP_008344097.1|2906954_2907092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012011040.1|2907133_2907574_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
WP_072368332.1|2907726_2907816_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003213309.1|2908091_2908535_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_024719687.1|2908536_2909883_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.3	1.1e-76
WP_008344108.1|2909886_2910099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047946736.1|2910085_2910541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408232.1|2910545_2911043_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	1.4e-37
WP_173408233.1|2911039_2911396_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_024719690.1|2911392_2911776_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_173408234.1|2911789_2912713_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.9	3.7e-108
WP_039169992.1|2912735_2913827_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.9	3.1e-61
WP_041507681.1|2913862_2915320_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	53.0	1.1e-138
WP_173408468.1|2915316_2916618_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.1	5.9e-152
WP_008344125.1|2916626_2917274_-	helix-turn-helix domain-containing protein	NA	A0A2P1JTW4	Anoxybacillus_phage	43.7	2.5e-42
WP_061420050.1|2917427_2917946_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	46.2	4.4e-34
WP_061420053.1|2918070_2918277_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	1.2e-14
WP_024719696.1|2918273_2918678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358978.1|2918780_2918963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162835675.1|2918952_2919105_-	hypothetical protein	NA	A0A2H4J4L6	uncultured_Caudovirales_phage	62.2	2.3e-07
WP_061420055.1|2919123_2919363_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500560.1|2919522_2919900_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.4	1.6e-17
>prophage 9
NZ_CP054136	Bacillus altitudinis strain 11-1-1 chromosome, complete genome	3879167	3147177	3194949	3879167	plate,capsid,protease,tail,holin,terminase,portal,integrase,head	Bacillus_phage(43.59%)	67	3145335:3145353	3184480:3184498
3145335:3145353	attL	TGTTGCCAAAATGTTGCCA	NA	NA	NA	NA
WP_173408269.1|3147177_3147999_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.0	4.2e-63
WP_173408270.1|3148045_3148465_-|holin	holin family protein	holin	D6R405	Bacillus_phage	74.2	8.2e-47
WP_173408271.1|3148507_3148687_-	XkdX family protein	NA	NA	NA	NA	NA
WP_173408272.1|3148683_3148974_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	42.2	1.0e-11
WP_173408273.1|3148987_3150553_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	49.5	2.4e-51
WP_159159665.1|3150533_3150833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408274.1|3150832_3152737_-	right-handed parallel beta-helix repeat-containing protein	NA	Q9ZXE2	Bacillus_phage	40.0	1.1e-32
WP_173408275.1|3152772_3154503_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	68.9	3.8e-223
WP_173408276.1|3154514_3155351_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.1	2.2e-104
WP_173408277.1|3155351_3159785_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	52.2	7.8e-79
WP_173407663.1|3159824_3159962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358183.1|3159967_3160330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025094085.1|3160385_3160997_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	38.2	3.3e-12
WP_057079043.1|3160999_3161398_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_173408278.1|3161394_3161799_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_057079042.1|3161798_3162113_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.4e-11
WP_173408279.1|3162102_3162417_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.4e-11
WP_173408280.1|3162429_3162828_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.9	1.0e-14
WP_173408281.1|3162854_3164150_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.0	6.2e-93
WP_173408282.1|3164189_3164813_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	71.7	6.0e-78
WP_173408283.1|3164775_3166056_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	60.4	1.3e-143
WP_173408284.1|3166060_3166240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408285.1|3166239_3167949_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.3	5.6e-211
WP_173408286.1|3167945_3168464_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	43.5	2.4e-32
WP_173408469.1|3168695_3169061_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	1.5e-28
WP_173408287.1|3169050_3169407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408288.1|3169466_3170078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408289.1|3170424_3170688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408290.1|3170852_3171224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035701886.1|3171463_3172006_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	57.9	7.6e-53
WP_173408291.1|3172002_3172488_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	52.2	3.7e-35
WP_173408292.1|3172714_3173104_-	hypothetical protein	NA	A0A076G7Y2	Bacillus_phage	90.1	1.5e-58
WP_173408293.1|3173106_3173277_-	hypothetical protein	NA	A0A2H4J4P7	uncultured_Caudovirales_phage	85.2	1.4e-16
WP_173408294.1|3173281_3173509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408295.1|3173520_3173946_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	92.2	9.1e-70
WP_057079026.1|3173942_3174215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408296.1|3174230_3174713_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	90.4	5.9e-73
WP_173408297.1|3174834_3175206_-	hypothetical protein	NA	A0A2H4J4Q6	uncultured_Caudovirales_phage	96.7	5.7e-68
WP_173408298.1|3175218_3175962_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	99.6	4.6e-133
WP_173408299.1|3175978_3177238_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	43.6	5.6e-115
WP_173408300.1|3177234_3177483_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	75.3	3.6e-26
WP_017358222.1|3177517_3177727_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	1.5e-09
WP_173408301.1|3177792_3177966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108611783.1|3177981_3178122_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_173408302.1|3178121_3178262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408303.1|3178230_3178758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837042.1|3178754_3178910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408470.1|3179020_3179842_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	39.2	4.4e-52
WP_173408304.1|3179825_3180677_-	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	44.4	2.1e-49
WP_047945691.1|3180669_3180879_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_144626619.1|3180921_3181128_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173408471.1|3181282_3181663_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	45.3	3.4e-07
WP_144626617.1|3182056_3183157_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_144626615.1|3183409_3184477_+|integrase	tyrosine-type recombinase/integrase	integrase	H0UST3	Bacillus_phage	63.0	8.3e-128
WP_041507778.1|3185094_3185565_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.8	1.9e-47
3184480:3184498	attR	TGTTGCCAAAATGTTGCCA	NA	NA	NA	NA
WP_041507779.1|3185704_3188044_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.0	3.6e-91
WP_008347663.1|3188063_3188810_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003212746.1|3188933_3189167_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_008347666.1|3189354_3189645_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.5	8.8e-08
WP_024719830.1|3189682_3189916_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500204.1|3190070_3190475_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	43.3	4.2e-16
WP_173408305.1|3190602_3191007_+	transcriptional regulator	NA	S6C481	Thermus_phage	55.1	1.0e-17
WP_007500199.1|3191089_3191410_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008347676.1|3191491_3192181_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008347678.1|3192202_3193120_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024719832.1|3193133_3193787_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_173408306.1|3193800_3194949_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.0	3.6e-12
