The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	1031849	1093447	5133330	transposase,tRNA,protease,plate	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001520521.1|1031849_1033202_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1033231_1035664_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1035785_1036271_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|1036274_1037300_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1037404_1037860_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1037863_1038652_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139675.1|1038651_1039800_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569434.1|1039796_1040393_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001520523.1|1040429_1043912_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000055748.1|1043924_1044884_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1044981_1047123_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1047179_1047569_+	VOC family protein	NA	NA	NA	NA	NA
WP_001520525.1|1047633_1048932_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|1048980_1049241_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1049227_1049428_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|1049593_1050139_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|1050135_1050558_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001520527.1|1050571_1051282_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_021523001.1|1051311_1052136_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_020233843.1|1052188_1053907_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|1054017_1054725_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202321.1|1054721_1055126_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|1055243_1056059_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1056098_1056752_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1056744_1057776_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001520530.1|1057963_1058536_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000526135.1|1064317_1064776_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000997053.1|1065008_1065812_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|1065808_1066723_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1066963_1067764_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001521855.1|1067841_1068612_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1068658_1070017_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_021523003.1|1070088_1070844_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|1070877_1071600_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1071596_1072064_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|1072128_1072860_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|1073399_1074185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|1074333_1074801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|1074810_1075725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|1075768_1076251_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087587.1|1076274_1077627_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173023400.1|1077637_1081072_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|1081180_1082593_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088867.1|1082597_1083341_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_077534906.1|1083337_1086199_-	AAA family ATPase	NA	A0A1C3S747	Escherichia_phage	29.6	2.5e-78
WP_001521863.1|1086207_1086969_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|1086973_1088305_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1088307_1088832_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|1088828_1090109_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|1090133_1091216_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|1091179_1093030_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029702117.1|1093033_1093447_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	1787138	1885743	5133330	portal,capsid,tRNA,holin,lysis,terminase,head,protease,tail,plate,integrase	Escherichia_phage(37.29%)	90	1800660:1800675	1838709:1838724
WP_000520781.1|1787138_1787459_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1787489_1789766_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1790806_1791025_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1791309_1792014_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001522751.1|1792055_1793777_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001043595.1|1793777_1795544_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522752.1|1795666_1796632_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1797176_1797671_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522753.1|1797805_1801873_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
1800660:1800675	attL	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_001522754.1|1802031_1802643_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1802653_1803997_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1804087_1805380_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|1805618_1808063_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|1808073_1808691_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534633.1|1808692_1809556_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_001522756.1|1809591_1810218_-	hydrolase	NA	NA	NA	NA	NA
WP_000109288.1|1810532_1811681_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918505.1|1811890_1813321_+	amino acid permease	NA	NA	NA	NA	NA
WP_000067977.1|1813530_1814328_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|1814359_1815355_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|1815448_1815760_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|1815864_1816221_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|1816231_1816402_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217677.1|1816398_1816899_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|1816963_1817188_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|1817187_1817490_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_023148842.1|1817489_1817714_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|1817710_1817986_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_173023396.1|1817975_1818425_+	hypothetical protein	NA	A0A0F7LBQ2	Escherichia_phage	99.3	5.5e-73
WP_001754918.1|1820658_1820814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239054.1|1820850_1821171_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
WP_023148839.1|1821136_1822087_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
WP_023148838.1|1822195_1823560_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
WP_048219351.1|1824072_1825107_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_000156861.1|1825106_1826879_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|1827052_1827907_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|1827961_1829035_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_001605750.1|1829038_1829782_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.9e-123
WP_089502592.1|1829881_1830391_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	98.8	4.3e-90
WP_000846399.1|1830390_1830594_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1830597_1830879_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1830878_1831376_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_106494215.1|1831390_1831816_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	9.5e-59
WP_032152948.1|1831803_1832229_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.4e-65
WP_001440152.1|1832200_1832374_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|1832336_1832804_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_023148832.1|1832796_1833249_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023148831.1|1833351_1834425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033560515.1|1834511_1835141_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.6	1.1e-108
WP_000127164.1|1835137_1835485_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|1835489_1836398_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|1836390_1836921_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_023148827.1|1836931_1838956_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
1838709:1838724	attR	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_023148826.1|1838957_1839485_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_023148825.1|1839775_1841002_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
WP_020233495.1|1841288_1842479_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251408.1|1842491_1843010_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1843066_1843342_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1843374_1843494_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_029701691.1|1843486_1845934_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
WP_001565024.1|1845948_1846428_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_033559748.1|1846427_1847591_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|1847673_1847892_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292809.1|1848211_1850494_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|1850548_1851406_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001328457.1|1851811_1853572_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642852.1|1853701_1854394_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|1854592_1855681_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_001522761.1|1855751_1857035_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001313710.1|1857204_1857969_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001522762.1|1858141_1858825_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1858935_1860609_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1860768_1861053_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_021523053.1|1861259_1863524_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1863560_1865309_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570527.1|1865305_1866292_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001522765.1|1866328_1867561_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1867612_1867795_+	protein YcaR	NA	NA	NA	NA	NA
WP_021523054.1|1867791_1868538_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1868691_1869585_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_001522767.1|1869561_1870341_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|1870476_1871262_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1871258_1872581_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|1872561_1873266_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_021523055.1|1873265_1877726_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020232980.1|1877986_1879834_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1880014_1880563_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|1880589_1881237_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1881287_1882478_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000117881.1|1884342_1885743_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 3
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	2071794	2133042	5133330	portal,capsid,holin,lysis,tRNA,terminase,head,tail,transposase,integrase	Escherichia_phage(37.5%)	75	2065250:2065264	2092390:2092404
2065250:2065264	attL	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_000074983.1|2071794_2072913_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|2072881_2073151_-	excisionase	NA	NA	NA	NA	NA
WP_001542183.1|2073212_2075669_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_001093951.1|2075746_2075950_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|2075946_2076135_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|2076145_2077000_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|2077530_2077905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|2077916_2078069_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|2078275_2078683_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|2078759_2078987_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|2078970_2079522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|2079493_2080534_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|2080445_2080988_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|2081021_2081792_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|2081807_2082200_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2082196_2082493_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|2082489_2082951_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|2082928_2083285_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137948.1|2083380_2083788_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_001229301.1|2083789_2084155_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|2084151_2085138_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|2085696_2085852_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|2086068_2086320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|2086386_2086665_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|2086666_2087725_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|2087725_2088094_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|2088086_2088776_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|2088988_2089186_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|2089161_2089275_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|2089555_2089891_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|2090136_2090340_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|2090336_2090498_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|2090647_2090863_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|2090867_2091758_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|2091794_2092328_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|2092484_2092667_+	hypothetical protein	NA	NA	NA	NA	NA
2092390:2092404	attR	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_001280932.1|2092681_2092813_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|2092815_2093283_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|2093593_2093920_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|2094042_2094396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|2094878_2095388_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|2095359_2097288_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|2097271_2097478_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|2097474_2099067_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|2099056_2100562_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|2100598_2100946_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_029702099.1|2101003_2102032_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|2102083_2102458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|2102450_2102804_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975005.1|2102819_2103395_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|2103391_2103787_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|2103794_2104547_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|2104560_2104992_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|2105018_2105432_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|2105412_2107974_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|2107970_2108300_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|2108299_2108998_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|2109008_2109752_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|2109697_2110330_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514726.1|2110673_2114366_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_000608644.1|2114601_2115864_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001233148.1|2117239_2117839_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|2117990_2121017_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|2121016_2121601_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|2121655_2122324_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|2122380_2122647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|2122878_2123742_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_172986636.1|2123725_2124862_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|2125111_2126338_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2126386_2127508_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2127583_2129044_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2129043_2129715_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2129884_2131255_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2131258_2131900_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|2131935_2133042_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	2354403	2412596	5133330	tRNA,holin,lysis,terminase,tail	Escherichia_phage(50.0%)	68	NA	NA
WP_020233353.1|2354403_2355336_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.3e-17
WP_000387388.1|2356667_2357651_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|2358128_2359502_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|2359630_2360566_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2360617_2361853_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2361854_2362070_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2362169_2362358_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2362395_2362545_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2362600_2363410_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2363402_2366003_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2366104_2366380_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2366454_2366625_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2366624_2366846_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2367287_2367776_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2367772_2367928_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2367938_2368118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2368360_2368780_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2368859_2369114_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2369110_2369533_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|2369610_2370399_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|2370405_2371152_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|2371174_2371936_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|2371951_2372374_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|2372535_2373039_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|2373159_2373933_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|2374455_2374581_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|2374663_2375005_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|2375872_2376472_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|2376471_2376762_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|2376758_2377301_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|2377522_2378092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|2378060_2378363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|2378439_2378781_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|2378784_2379261_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|2379477_2379663_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2379859_2381317_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|2381454_2382246_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|2382238_2383171_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000613571.1|2383106_2383358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|2383361_2384456_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|2384436_2385738_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|2385740_2387147_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|2387130_2388243_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_029702112.1|2388347_2389112_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
WP_020233804.1|2389210_2390350_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000908084.1|2390392_2390569_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|2390572_2390968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2390967_2391351_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2391351_2391732_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|2391728_2392121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|2392147_2393110_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|2393260_2393620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|2393727_2393928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|2394091_2397325_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|2397317_2397656_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|2397655_2398354_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_032153655.1|2398359_2399103_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_049286672.1|2399039_2399642_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|2399702_2403182_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|2403249_2403849_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|2403913_2406313_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|2406309_2406591_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|2406600_2407305_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_001405873.1|2407315_2407609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836768.1|2408744_2408978_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2409046_2409160_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_029701979.1|2409763_2411047_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|2411135_2412596_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 5
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	2559551	2666811	5133330	portal,capsid,lysis,terminase,head,tail,transposase	Enterobacteria_phage(40.74%)	110	NA	NA
WP_000526135.1|2559551_2560010_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001261003.1|2560187_2560856_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|2561158_2561752_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2561748_2562741_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001551086.1|2562864_2563845_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001523221.1|2563836_2564376_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2564438_2564663_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|2564802_2566458_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|2566682_2568026_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2568242_2569166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|2569203_2570844_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_029702060.1|2571242_2571392_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731851.1|2571463_2571637_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|2571881_2572412_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|2572600_2573602_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|2573643_2575083_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|2575279_2576080_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2576195_2576573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2576692_2577142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2577128_2577467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|2577751_2581654_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|2581854_2582460_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|2582513_2583830_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|2583819_2585577_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000177498.1|2586488_2587094_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|2587264_2589571_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_021523074.1|2589634_2590495_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_059321765.1|2590702_2593111_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|2597182_2597506_-	YdbL family protein	NA	NA	NA	NA	NA
WP_172986643.1|2597513_2597699_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|2597695_2600335_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2600542_2601532_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2601642_2602065_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2602061_2602328_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|2602601_2606126_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2606492_2607626_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2607766_2608201_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286865.1|2608785_2609700_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_029702064.1|2609699_2610527_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2610523_2611381_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|2611377_2612235_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|2612707_2613502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|2614047_2614341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|2614383_2615424_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|2615433_2615715_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|2615714_2618090_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001542091.1|2618154_2618754_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|2618821_2622301_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|2622361_2622964_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|2622900_2623644_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_029702161.1|2623649_2624348_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|2624347_2624677_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_048219008.1|2624673_2627235_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
WP_000459457.1|2627227_2627662_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|2627643_2628066_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|2628081_2628822_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|2628829_2629225_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|2629221_2629800_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|2629811_2630165_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|2630176_2630575_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|2630616_2631642_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|2631696_2632029_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|2632038_2633358_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|2633338_2634940_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|2634936_2635143_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|2635139_2637065_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|2637039_2637585_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|2637973_2638207_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2638264_2638675_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001309517.1|2639169_2639325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2639404_2639470_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2639472_2639661_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2639671_2639884_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2640246_2640744_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2640740_2641274_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2641270_2641582_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2641586_2641802_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000526135.1|2642358_2642817_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000066484.1|2643267_2643483_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2643783_2643996_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2644050_2644140_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2644417_2645170_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|2645183_2646233_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|2646234_2646513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2646579_2646831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2647047_2647203_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2647274_2647562_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2647561_2647801_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2647825_2648131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2648333_2648666_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2649102_2650416_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000915483.1|2650899_2651922_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_021523102.1|2652744_2653410_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|2653612_2654011_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|2654051_2655017_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|2654997_2655519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|2655502_2655730_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2655810_2656218_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|2656386_2656542_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|2656543_2657119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2657605_2657794_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|2657790_2657982_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|2658075_2660547_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_000005552.1|2660619_2660871_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001339397.1|2660941_2661619_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2661618_2661966_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_029392005.1|2661985_2663557_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000526135.1|2663826_2664285_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001389342.1|2665605_2665734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|2665791_2666811_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
>prophage 6
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	3148803	3219820	5133330	terminase,head,protease,tail,transposase	Escherichia_phage(17.39%)	60	NA	NA
WP_000526135.1|3148803_3149262_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_021523147.1|3149461_3150868_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.7e-38
WP_021523148.1|3150962_3151982_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.5	1.5e-89
WP_173023397.1|3152858_3153257_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_173023398.1|3153632_3153800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173023401.1|3154292_3154538_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523155.1|3158066_3158615_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|3158619_3159498_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|3159555_3160455_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|3160454_3161540_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|3161911_3162805_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|3163036_3164032_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|3164189_3165584_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523161.1|3165594_3166815_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_000770873.1|3166811_3168092_-	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_021523162.1|3168367_3169846_-	colanic acid undecaprenyl disphosphate flippase WzxC	NA	NA	NA	NA	NA
WP_000183119.1|3169847_3171242_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_021523164.1|3171376_3172747_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079285.1|3172939_3174376_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_021523165.1|3174378_3175602_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024166508.1|3175598_3176078_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_021523167.1|3176077_3177046_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	3.8e-87
WP_000048190.1|3177048_3178170_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_021523168.1|3178195_3178744_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000927072.1|3178759_3179506_-	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_000107816.1|3179516_3180734_-	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_021523169.1|3180708_3181926_-	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000888740.1|3181922_3182411_-	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_000654503.1|3182413_3183253_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_021523170.1|3183345_3185508_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|3185510_3185954_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|3185959_3187099_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_021523171.1|3187757_3189341_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_021523172.1|3189614_3191468_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|3191489_3192071_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|3192162_3192804_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_021523173.1|3193121_3196439_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001520813.1|3196476_3197334_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_021534347.1|3198179_3198392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021534349.1|3198501_3198819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021534353.1|3200356_3200599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100134637.1|3204362_3204767_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_073508512.1|3204751_3205375_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_096149103.1|3205377_3205941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137504023.1|3206228_3207848_-	hypothetical protein	NA	A0A0B5A0F2	Paracoccus_phage	42.3	6.9e-09
WP_096149101.1|3207931_3208249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137504040.1|3208238_3208610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503924.1|3208643_3208949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137504025.1|3209004_3209484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157919894.1|3209547_3211404_-|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	36.0	7.2e-103
WP_140436207.1|3211429_3211795_-	hypothetical protein	NA	A0A291LGD5	Salmonella_phage	46.5	1.0e-16
WP_172986647.1|3211772_3213020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986648.1|3213035_3213425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157919893.1|3214156_3214318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986649.1|3214647_3215973_-|head,protease	HK97 family phage prohead protease	head,protease	R9TPU0	Vibrio_phage	25.7	9.6e-17
WP_137504030.1|3217460_3218006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135566170.1|3218015_3218225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986678.1|3218196_3218757_-|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_077898445.1|3218901_3219366_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	32.4	3.2e-07
WP_123055505.1|3219337_3219820_-|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
>prophage 7
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	3242964	3270226	5133330	portal,capsid,tRNA,holin,lysis,terminase,head,tail,plate	Escherichia_phage(46.88%)	34	NA	NA
WP_000675148.1|3242964_3244368_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|3244364_3245087_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|3245266_3245599_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|3245746_3247108_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
WP_000468308.1|3247380_3247599_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_033559748.1|3247681_3248845_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_001565024.1|3248844_3249324_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_029701691.1|3249338_3251786_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
WP_000785970.1|3251778_3251898_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3251930_3252206_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251412.1|3252262_3252781_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233495.1|3252793_3253984_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_021523176.1|3254313_3254859_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	98.9	1.1e-96
WP_021523177.1|3255128_3255656_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|3255657_3257679_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_001285325.1|3257689_3258220_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|3258212_3259121_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|3259125_3259473_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|3259469_3260105_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_021523179.1|3260188_3260974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|3261045_3261498_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|3261490_3261958_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|3261920_3262094_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_033560494.1|3262065_3262491_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.5e-67
WP_106494215.1|3262478_3262904_-	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	9.5e-59
WP_001144101.1|3262918_3263416_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3263415_3263697_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|3263700_3263904_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|3263903_3264413_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203455.1|3264512_3265256_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_020233501.1|3265259_3266333_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|3266391_3267246_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156847.1|3267419_3269192_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001533791.1|3269191_3270226_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
>prophage 8
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	3276462	3281960	5133330	integrase	Enterobacteria_phage(30.0%)	11	3275884:3275897	3286422:3286435
3275884:3275897	attL	TATTTTTTCCAGTA	NA	NA	NA	NA
WP_029701698.1|3276462_3276738_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029701699.1|3276734_3276959_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_001754915.1|3276958_3277261_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_000557703.1|3277260_3277485_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_029701701.1|3277548_3278049_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_162852172.1|3278045_3278216_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.9e-24
WP_029701703.1|3278226_3278502_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_000020919.1|3278623_3278923_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|3279038_3280052_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|3280328_3280646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807371.1|3281060_3281960_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
3286422:3286435	attR	TATTTTTTCCAGTA	NA	NA	NA	NA
>prophage 9
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	3319490	3328933	5133330		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|3319490_3320627_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|3320623_3322624_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3322748_3323210_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3323251_3323722_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3323768_3324488_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3324484_3326170_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3326391_3327123_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3327182_3327290_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|3327270_3328002_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|3328006_3328933_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 10
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	3542555	3614618	5133330	portal,tRNA,lysis,holin,terminase,head,coat,integrase	Enterobacteria_phage(64.41%)	88	3574234:3574256	3622357:3622379
WP_001283590.1|3542555_3543368_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3543367_3544381_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699144.1|3544446_3545583_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
WP_001520944.1|3545681_3546677_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|3546673_3547852_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|3548127_3549348_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001520946.1|3549506_3551513_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3551568_3551847_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089216.1|3551880_3552429_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_001520948.1|3552428_3553238_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043827.1|3553237_3554062_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3554065_3555151_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001309606.1|3555185_3556118_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730805.1|3556283_3556835_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001520950.1|3556904_3557768_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001037531.1|3557769_3558315_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826833.1|3558311_3558791_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826023.1|3558787_3559279_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170521.1|3559294_3560044_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_020232969.1|3560063_3562703_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033306.1|3562786_3563353_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3564013_3564499_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425037.1|3564701_3566846_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531924.1|3566845_3568156_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3568336_3568621_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001520953.1|3568992_3570333_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001520954.1|3570698_3571946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3572124_3572880_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3573173_3574106_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3574234:3574256	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_087503470.1|3574417_3575575_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
WP_016242483.1|3575691_3576348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050596990.1|3576348_3577080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503469.1|3577199_3579599_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
WP_087503468.1|3579763_3582157_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_087503467.1|3582157_3583489_-	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
WP_087503466.1|3583498_3584191_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_087503465.1|3584193_3584649_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
WP_087503464.1|3584648_3585602_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_085701391.1|3585601_3587020_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
WP_117041780.1|3587029_3587491_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	98.7	1.7e-82
WP_001389518.1|3587471_3587660_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_005759997.1|3587701_3588961_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	94.3	2.3e-222
WP_117041781.1|3588979_3589873_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.3	1.4e-128
WP_117041782.1|3589963_3592162_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
WP_000200766.1|3592163_3593579_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_000113732.1|3593575_3594016_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|3594018_3594261_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001028465.1|3594423_3594945_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_021554252.1|3595148_3595586_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	6.1e-69
WP_000229389.1|3595582_3596059_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|3596042_3596366_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027554.1|3596961_3597480_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994516.1|3597476_3597665_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001549462.1|3597661_3598024_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_023146907.1|3598024_3598549_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_000002250.1|3598545_3598836_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_023146906.1|3598835_3599558_-	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
WP_000566866.1|3599550_3599721_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_024176095.1|3599717_3599900_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_023146905.1|3599896_3600424_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
WP_000736913.1|3600420_3600861_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001749476.1|3600934_3602311_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_172986679.1|3602307_3603195_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.3	1.1e-141
WP_001244621.1|3603257_3603530_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|3603552_3603846_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001194218.1|3603965_3604181_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|3604284_3604917_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618034.1|3604913_3605318_+	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_077694523.1|3605567_3605948_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000213975.1|3606026_3606227_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000972063.1|3606453_3606588_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3606572_3606725_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|3606809_3607118_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_032153682.1|3607114_3608026_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
WP_032153683.1|3608009_3608492_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_000753555.1|3608503_3608818_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|3608834_3609116_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|3609112_3609280_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|3609276_3609531_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_029701302.1|3609517_3610210_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_000951706.1|3610211_3610421_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_029701304.1|3610417_3611209_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_029701309.1|3611201_3611486_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_000545716.1|3611557_3611725_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_001163428.1|3611782_3611983_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001535474.1|3612235_3613522_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001535476.1|3613514_3614270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|3614426_3614618_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
3622357:3622379	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 11
NZ_CP044403	Escherichia coli strain NMBU-W10C18 chromosome, complete genome	5133330	4001029	4009798	5133330	integrase	Escherichia_phage(71.43%)	7	3991551:3991563	4013468:4013480
3991551:3991563	attL	TTGATGAGTTTAT	NA	NA	NA	NA
WP_029701594.1|4001029_4002493_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHE0	Moraxella_phage	27.8	8.4e-22
WP_108433725.1|4002652_4005220_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	7.1e-32
WP_001141345.1|4005325_4005982_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|4006032_4006800_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|4006995_4007904_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|4007900_4009163_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4009159_4009798_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
4013468:4013480	attR	ATAAACTCATCAA	NA	NA	NA	NA
>prophage 1
NZ_CP044404	Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence	114329	1220	39810	114329	integrase,transposase,protease	Enterobacteria_phage(23.08%)	33	NA	NA
WP_001066952.1|1220_1961_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_033877173.1|2081_2270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029702141.1|2396_3137_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_029702172.1|4089_4539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|8166_9027_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|9209_9767_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|10037_10742_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_131096459.1|11412_12996_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045295164.1|13046_13751_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113388538.1|14175_15120_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.8	7.8e-13
WP_163428417.1|15255_16484_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	90.0	3.3e-160
WP_001067855.1|16868_17573_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_173009554.1|17631_20598_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	63.6	0.0e+00
WP_057061618.1|21441_23904_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_034167706.1|23913_25935_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_034167705.1|25931_27266_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_034167704.1|27262_27769_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001067855.1|28008_28713_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|29008_29410_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|29342_29600_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|29692_30346_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029702152.1|31284_32142_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|32134_32209_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083833.1|32444_32702_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032215358.1|32985_33192_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087757657.1|33378_33645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029702150.1|34019_34589_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_029702149.1|34740_35367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023209.1|35778_35988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567328.1|36118_36679_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_052273601.1|36733_37480_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.7e-08
WP_001016257.1|37507_38254_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_002431311.1|38268_39810_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
