The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	3517	54927	5413450	portal,head,terminase,protease,capsid,tail	Bacillus_phage(94.52%)	74	NA	NA
WP_042513592.1|3517_3709_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	100.0	9.5e-27
WP_172855683.1|3996_4203_-	hypothetical protein	NA	A0A288WG47	Bacillus_phage	94.1	4.2e-28
WP_042513019.1|4209_4434_-	hypothetical protein	NA	Q3HKX2	Bacillus_phage	82.4	2.5e-26
WP_052494330.1|4466_5213_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	60.1	1.1e-78
WP_001982886.1|5406_5802_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFT8	Bacillus_phage	100.0	2.0e-66
WP_144402435.1|5975_6098_-	DUF3983 domain-containing protein	NA	A0A288WG42	Bacillus_phage	97.5	6.9e-15
WP_042513021.1|6472_7015_-	dUTP diphosphatase	NA	A0A288WG53	Bacillus_phage	100.0	7.5e-101
WP_042513022.1|7072_7549_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	99.4	7.0e-95
WP_042513023.1|7545_8292_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFV7	Bacillus_phage	100.0	1.3e-135
WP_001982974.1|8284_8518_-	hypothetical protein	NA	Q3HKY5	Bacillus_phage	100.0	8.9e-35
WP_042513024.1|8536_9448_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	99.0	2.2e-169
WP_042513025.1|9463_10399_-	conserved phage C-terminal domain-containing protein	NA	A0A288WFS8	Bacillus_phage	95.0	1.5e-141
WP_042513026.1|10527_11178_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	98.1	1.7e-120
WP_098345890.1|11184_11547_-	hypothetical protein	NA	A0A288WG31	Bacillus_phage	100.0	8.6e-61
WP_172855701.1|11589_12297_-	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	99.1	2.0e-130
WP_172855684.1|12347_12509_-	hypothetical protein	NA	A0A288WGR3	Bacillus_phage	98.1	2.4e-23
WP_172855685.1|12580_12739_-	hypothetical protein	NA	A0A288WGC5	Bacillus_phage	100.0	3.8e-21
WP_042513028.1|12778_13006_-	helix-turn-helix transcriptional regulator	NA	A0A288WG39	Bacillus_phage	100.0	2.3e-35
WP_015980883.1|13165_13522_+	helix-turn-helix transcriptional regulator	NA	Q2I8D5	Bacillus_phage	100.0	3.9e-58
WP_052494350.1|13862_15197_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	99.3	1.7e-247
WP_080334529.1|15299_16754_-	recombinase family protein	NA	Q3HKZ2	Bacillus_phage	98.1	3.1e-274
WP_042512998.1|16820_17684_-	helix-turn-helix domain-containing protein	NA	A0A288WFX4	Bacillus_phage	99.7	4.5e-156
WP_142337077.1|17699_17819_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	74.4	4.7e-08
WP_042512999.1|17982_18219_+	helix-turn-helix domain-containing protein	NA	A0A288WFZ7	Bacillus_phage	100.0	1.2e-34
WP_042513000.1|18251_18869_-	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	98.5	1.2e-110
WP_042513001.1|18810_19992_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	99.7	1.7e-227
WP_001982935.1|20109_20292_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	100.0	4.2e-24
WP_042513002.1|20288_20597_-	hypothetical protein	NA	Q2I8E3	Bacillus_phage	90.2	6.6e-46
WP_042513003.1|20756_20954_+	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	95.4	8.3e-26
WP_042513004.1|20958_21543_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	99.0	6.8e-108
WP_042513005.1|21610_21940_+	hypothetical protein	NA	A0A288WGP7	Bacillus_phage	96.3	1.0e-52
WP_042513006.1|22061_23060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513007.1|23116_24172_-	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	97.7	3.6e-200
WP_016716828.1|24168_24408_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
WP_029440514.1|24407_24644_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
WP_172855686.1|24682_28549_-|tail	phage tail protein	tail	Q2I8E8	Bacillus_phage	91.6	0.0e+00
WP_042513008.1|28545_30036_-|tail	phage tail family protein	tail	A0A288WFS2	Bacillus_phage	99.4	2.3e-293
WP_042513009.1|30050_33902_-|tail	phage tail tape measure protein	tail	A0A288WG36	Bacillus_phage	96.1	0.0e+00
WP_042513010.1|34124_34442_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	100.0	4.4e-53
WP_001982989.1|34491_35100_-|tail	tail protein	tail	Q2I8F2	Bacillus_phage	100.0	1.4e-108
WP_001983061.1|35100_35460_-	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	100.0	5.9e-62
WP_001983159.1|35456_35897_-	HK97 gp10 family phage protein	NA	Q2I8F4	Bacillus_phage	100.0	4.2e-78
WP_001983098.1|35889_36213_-|head	phage head closure protein	head	Q2I8F5	Bacillus_phage	100.0	6.7e-57
WP_042513011.1|36209_36500_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WFX0	Bacillus_phage	100.0	1.1e-47
WP_042513012.1|36517_37696_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	99.7	1.9e-213
WP_001982892.1|37734_38355_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	100.0	4.8e-112
WP_001983089.1|38317_39616_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	100.0	4.1e-246
WP_042513013.1|39631_41329_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	99.8	0.0e+00
WP_042513014.1|41325_41811_-|terminase	phage terminase small subunit P27 family	terminase	A0A288WFZ9	Bacillus_phage	100.0	7.7e-81
WP_042513015.1|41911_42295_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	97.6	2.0e-68
WP_080334540.1|42363_42726_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	74.8	2.4e-39
WP_042513016.1|42968_43223_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	97.6	3.7e-42
WP_042513592.1|43242_43434_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	100.0	9.5e-27
WP_042513017.1|43462_43705_-	hypothetical protein	NA	A0A288WG15	Bacillus_phage	100.0	1.5e-40
WP_042513018.1|43709_43931_-	hypothetical protein	NA	A0A288WG47	Bacillus_phage	98.6	1.0e-32
WP_042513019.1|43937_44162_-	hypothetical protein	NA	Q3HKX2	Bacillus_phage	82.4	2.5e-26
WP_052494330.1|44194_44941_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	60.1	1.1e-78
WP_001982886.1|45134_45530_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFT8	Bacillus_phage	100.0	2.0e-66
WP_144402435.1|45703_45826_-	DUF3983 domain-containing protein	NA	A0A288WG42	Bacillus_phage	97.5	6.9e-15
WP_042513020.1|45978_46167_-	hypothetical protein	NA	A0A288WG27	Bacillus_phage	90.3	8.2e-23
WP_042513021.1|46202_46745_-	dUTP diphosphatase	NA	A0A288WG53	Bacillus_phage	100.0	7.5e-101
WP_042513022.1|46802_47279_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	99.4	7.0e-95
WP_042513023.1|47275_48022_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFV7	Bacillus_phage	100.0	1.3e-135
WP_001982974.1|48014_48248_-	hypothetical protein	NA	Q3HKY5	Bacillus_phage	100.0	8.9e-35
WP_042513024.1|48266_49178_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	99.0	2.2e-169
WP_042513025.1|49193_50129_-	conserved phage C-terminal domain-containing protein	NA	A0A288WFS8	Bacillus_phage	95.0	1.5e-141
WP_042513026.1|50257_50908_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	98.1	1.7e-120
WP_098345890.1|50914_51277_-	hypothetical protein	NA	A0A288WG31	Bacillus_phage	100.0	8.6e-61
WP_172855701.1|51319_52027_-	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	99.1	2.0e-130
WP_172855684.1|52077_52239_-	hypothetical protein	NA	A0A288WGR3	Bacillus_phage	98.1	2.4e-23
WP_172855685.1|52310_52469_-	hypothetical protein	NA	A0A288WGC5	Bacillus_phage	100.0	3.8e-21
WP_042513028.1|52508_52736_-	helix-turn-helix transcriptional regulator	NA	A0A288WG39	Bacillus_phage	100.0	2.3e-35
WP_015980883.1|52895_53252_+	helix-turn-helix transcriptional regulator	NA	Q2I8D5	Bacillus_phage	100.0	3.9e-58
WP_052494350.1|53592_54927_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	99.3	1.7e-247
>prophage 2
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	1298899	1307276	5413450		Synechococcus_phage(33.33%)	8	NA	NA
WP_000088592.1|1298899_1299487_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
WP_001262436.1|1299483_1300524_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000879029.1|1300630_1302046_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_000055577.1|1302030_1304250_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000666792.1|1304233_1304917_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|1304913_1305168_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170540.1|1305160_1305880_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|1305968_1307276_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 3
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	1346419	1356113	5413450		Bacillus_phage(33.33%)	7	NA	NA
WP_000719197.1|1346419_1347925_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	29.6	3.2e-32
WP_000929883.1|1347908_1348610_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_000833093.1|1348755_1350081_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_162837124.1|1350465_1352007_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_000481693.1|1352672_1353128_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000483524.1|1353151_1354192_-	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	51.0	9.5e-36
WP_042513309.1|1354478_1356113_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	1.5e-157
>prophage 4
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	2149374	2222879	5413450	portal,head,tRNA,coat,terminase,protease,capsid,tail,bacteriocin,integrase	uncultured_Caudovirales_phage(35.09%)	85	2155096:2155115	2228263:2228282
WP_042513428.1|2149374_2150376_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125503.1|2150437_2150653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|2150969_2151206_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248594.1|2151412_2151721_+	YuzD family protein	NA	NA	NA	NA	NA
WP_000494420.1|2151689_2152568_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000379272.1|2152666_2153344_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_042513429.1|2153674_2154469_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000212737.1|2154704_2155046_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
2155096:2155115	attL	TTTTGTCGGTAAGTCGATAT	NA	NA	NA	NA
WP_042513430.1|2155226_2156024_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470281.1|2156007_2156667_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	2.0e-23
WP_000994518.1|2156721_2156895_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000682073.1|2157125_2158196_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000595027.1|2158547_2158787_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077386.1|2159030_2159897_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573825.1|2159938_2160292_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_042513431.1|2160519_2160873_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.7	5.0e-13
WP_042513432.1|2160960_2162022_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	97.2	9.2e-196
WP_042513433.1|2162101_2162734_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	99.0	1.1e-116
WP_042513434.1|2162892_2163120_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	93.3	1.2e-33
WP_042513435.1|2163261_2163450_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	85.5	2.6e-21
WP_172107509.1|2163467_2163635_+	hypothetical protein	NA	A0A2H4J829	uncultured_Caudovirales_phage	60.0	1.5e-07
WP_042513436.1|2163635_2163863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513437.1|2163863_2164214_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	75.9	3.2e-44
WP_165915393.1|2164305_2164461_+	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	100.0	4.0e-23
WP_042513438.1|2164480_2164696_+	hypothetical protein	NA	A0A2H4JCV1	uncultured_Caudovirales_phage	93.0	1.4e-29
WP_042513439.1|2164680_2164884_+	hypothetical protein	NA	A0A2H4J979	uncultured_Caudovirales_phage	83.6	4.7e-24
WP_042513440.1|2164883_2165165_+	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	58.7	2.5e-23
WP_042513441.1|2165142_2165691_+	host-nuclease inhibitor Gam family protein	NA	A0A1B2AQ11	Phage_Wrath	95.6	1.1e-91
WP_042513442.1|2165698_2166367_+	hypothetical protein	NA	A0A2H4JB05	uncultured_Caudovirales_phage	60.8	3.0e-67
WP_042513443.1|2166372_2167065_+	AAA family ATPase	NA	A0A2H4J9A0	uncultured_Caudovirales_phage	94.1	1.6e-116
WP_042513444.1|2167064_2167538_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	100.0	6.6e-85
WP_042513445.1|2167645_2167852_+	hypothetical protein	NA	O64170	Bacillus_phage	70.3	1.7e-21
WP_042513446.1|2167885_2170240_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	86.7	0.0e+00
WP_042513447.1|2170505_2170934_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	95.1	3.9e-76
WP_042513448.1|2170936_2171320_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	39.1	6.0e-12
WP_042513449.1|2171316_2171856_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	53.7	3.9e-49
WP_042513450.1|2171857_2172142_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	51.1	3.0e-16
WP_042513451.1|2172223_2172568_+	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	58.5	5.0e-26
WP_042513452.1|2172627_2173164_+	dUTP diphosphatase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	73.6	1.1e-72
WP_042513453.1|2173198_2173498_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	70.7	4.3e-34
WP_042513621.1|2173933_2174056_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_042513454.1|2174093_2174480_+	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	76.8	1.1e-48
WP_042513456.1|2174901_2175222_+	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	84.9	1.2e-42
WP_042513457.1|2175218_2175584_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	66.1	2.4e-42
WP_042513458.1|2175704_2176139_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	89.6	2.0e-64
WP_042513459.1|2176135_2177860_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	97.9	0.0e+00
WP_042513460.1|2177964_2179170_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.5	2.0e-218
WP_001140505.1|2179138_2179717_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.5	4.2e-86
WP_042513461.1|2179718_2181068_+|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	69.9	2.8e-128
WP_042513462.1|2181069_2181330_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	95.3	5.4e-41
WP_042513463.1|2181310_2181640_+	hypothetical protein	NA	A0A2H4J9Y9	uncultured_Caudovirales_phage	95.4	3.0e-52
WP_042513464.1|2181629_2181959_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	96.3	2.2e-55
WP_042513465.1|2181958_2182336_+	HK97 gp10 family phage protein	NA	A0A1B2APW9	Phage_Wrath	97.6	9.6e-63
WP_042513466.1|2182347_2182977_+|tail	phi13 family phage major tail protein	tail	A0A2H4JEZ7	uncultured_Caudovirales_phage	88.5	4.9e-104
WP_042513467.1|2182987_2183374_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	90.6	3.5e-60
WP_078386944.1|2183617_2186899_+|tail	phage tail tape measure protein	tail	A0A1B2APW4	Phage_Wrath	74.1	3.5e-217
WP_052494354.1|2186902_2187616_+	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	80.6	1.4e-110
WP_042513469.1|2187616_2189152_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	62.9	4.3e-178
WP_042513470.1|2189144_2191004_+	hypothetical protein	NA	Q0E5W5	Pseudomonas_phage	62.7	1.7e-11
WP_052494338.1|2191000_2191300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158319614.1|2191312_2191453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513471.1|2191789_2192053_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	59.8	2.4e-20
WP_042513472.1|2192049_2193096_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JEZ1	uncultured_Caudovirales_phage	89.4	1.2e-179
WP_042513473.1|2193139_2193637_-	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	87.9	5.8e-76
WP_042513474.1|2193670_2194003_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	96.4	1.0e-47
WP_158319615.1|2194062_2194233_-	hypothetical protein	NA	A0A2H4JCU3	uncultured_Caudovirales_phage	78.6	2.2e-19
WP_042513475.1|2194260_2195091_-	cytosolic protein	NA	A0A1B2APY5	Phage_Wrath	95.7	3.2e-111
WP_001982685.1|2195415_2195877_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_042513476.1|2195955_2196843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000391912.1|2196853_2198101_-	MFS transporter	NA	NA	NA	NA	NA
WP_001994481.1|2198276_2198753_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042513477.1|2199198_2209935_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000829779.1|2210053_2211043_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856618.1|2211505_2212714_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042513478.1|2212837_2213344_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027007.1|2213340_2213658_+	YuiB family protein	NA	NA	NA	NA	NA
WP_042513479.1|2213744_2214371_+	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	2.3e-13
WP_000487987.1|2214516_2216001_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.3e-57
WP_001158741.1|2216083_2216689_-	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_001104191.1|2216832_2218557_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
WP_000832654.1|2218665_2219553_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.1	7.7e-79
WP_001252159.1|2219598_2220192_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000810351.1|2220242_2220986_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001140609.1|2221081_2221465_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000287154.1|2221502_2222879_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
2228263:2228282	attR	ATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	3117465	3191504	5413450	portal,head,tRNA,terminase,protease,capsid,tail,integrase	Bacillus_phage(75.93%)	90	3121026:3121041	3132588:3132603
WP_042512226.1|3117465_3118596_-|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	39.1	2.1e-65
WP_042512227.1|3118934_3119744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512228.1|3119744_3120608_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_042512229.1|3120696_3121041_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	38.4	7.2e-17
3121026:3121041	attL	CTCCAAATGTATTCAT	NA	NA	NA	NA
WP_042512230.1|3121478_3122576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074544100.1|3122588_3122738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000153814.1|3123000_3123369_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.6	4.1e-10
WP_000516834.1|3123587_3123815_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000284333.1|3123866_3124067_+	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	3.9e-07
WP_042512231.1|3124123_3124288_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	3.9e-21
WP_042512232.1|3124317_3124494_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	93.1	1.1e-24
WP_042512233.1|3124500_3125376_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	98.1	5.7e-50
WP_042512234.1|3125344_3126142_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.9	8.1e-144
WP_042512235.1|3126163_3126358_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	98.4	6.5e-31
WP_000805174.1|3126383_3126557_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
WP_000811866.1|3126571_3126826_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	94.0	6.5e-39
WP_042512236.1|3126838_3127264_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	41.6	3.8e-15
WP_172855691.1|3127279_3127735_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.2	1.4e-20
WP_042512237.1|3127774_3128185_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	68.4	1.6e-50
WP_172855692.1|3128223_3128373_+	hypothetical protein	NA	A0A192Y938	Bacillus_phage	68.1	6.1e-13
WP_042512238.1|3128413_3129133_+	hypothetical protein	NA	D2XR55	Bacillus_phage	82.4	9.3e-115
WP_042512239.1|3129171_3129546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512240.1|3129662_3130034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512241.1|3130060_3130390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172855693.1|3130407_3130581_+	hypothetical protein	NA	A0A1B1P875	Bacillus_phage	91.2	2.0e-23
WP_000803282.1|3130598_3130721_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_042512242.1|3130837_3131008_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	76.8	4.7e-09
WP_042512243.1|3131035_3131518_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_042512244.1|3131517_3132060_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.5e-88
WP_042512245.1|3132635_3133385_+	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	58.9	2.2e-79
3132588:3132603	attR	CTCCAAATGTATTCAT	NA	NA	NA	NA
WP_000778977.1|3133533_3133746_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	100.0	3.5e-30
WP_000376884.1|3133879_3134071_+	hypothetical protein	NA	Q3HKW9	Bacillus_phage	76.2	7.3e-19
WP_042512246.1|3134090_3134345_+	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	95.2	7.4e-43
WP_042512247.1|3134334_3134712_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	98.4	6.8e-69
WP_169509249.1|3134841_3135351_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	75.2	8.7e-67
WP_042512249.1|3135347_3137042_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	64.2	8.1e-210
WP_042512250.1|3137230_3138484_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	9.8e-237
WP_001259166.1|3138470_3139181_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.3	2.2e-124
WP_042512251.1|3139218_3140391_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	93.3	3.4e-199
WP_000244596.1|3140411_3140690_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	94.6	5.8e-41
WP_029440521.1|3140686_3141010_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_000763222.1|3141002_3141440_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	100.0	4.6e-77
WP_042512252.1|3141436_3141796_+	DUF3168 domain-containing protein	NA	A0A288WFU0	Bacillus_phage	100.0	3.5e-62
WP_001982989.1|3141796_3142405_+|tail	tail protein	tail	Q2I8F2	Bacillus_phage	100.0	1.4e-108
WP_042512253.1|3142454_3142772_+	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	99.0	7.5e-53
WP_000344052.1|3142801_3142978_+	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_042512254.1|3142992_3146844_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	98.6	0.0e+00
WP_042512255.1|3146858_3148349_+|tail	phage tail family protein	tail	Q2LIB8	Bacillus_phage	98.6	2.2e-291
WP_042512256.1|3148345_3152275_+|tail	phage tail protein	tail	A0A288WFW2	Bacillus_phage	83.7	0.0e+00
WP_042512257.1|3152396_3152621_+	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	85.1	1.6e-25
WP_029440514.1|3152685_3152922_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
WP_042512258.1|3152921_3153161_+	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	97.5	5.0e-33
WP_042512259.1|3153157_3154213_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A288WFQ3	Bacillus_phage	93.2	1.6e-192
WP_042512260.1|3154251_3154794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512262.1|3155177_3156026_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	37.9	1.0e-19
WP_042512263.1|3156455_3156653_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7S8	Bacillus_phage	68.8	3.5e-16
WP_042512264.1|3156814_3157117_+	hypothetical protein	NA	Q2I8E3	Bacillus_phage	93.0	2.4e-48
WP_042512265.1|3157119_3157302_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	95.0	2.7e-23
WP_042512266.1|3157419_3158601_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	85.0	4.2e-197
WP_042512267.1|3158542_3159160_+	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	88.1	2.1e-99
WP_000872145.1|3159444_3159945_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_001984764.1|3160006_3160180_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000246476.1|3160309_3160816_+	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.0e-11
WP_000506702.1|3160850_3161324_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001995047.1|3161698_3162586_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001995077.1|3162665_3164282_+	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_000481786.1|3164651_3165584_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_000067081.1|3165599_3165962_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000600098.1|3166034_3168134_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_001266229.1|3168215_3170132_+	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_001995054.1|3170340_3171816_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000893058.1|3171838_3172813_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_042512268.1|3172813_3174166_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000753510.1|3174256_3175348_+	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_001995057.1|3175453_3176548_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_001995034.1|3176609_3177515_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000798225.1|3177613_3178384_+	cell division protein DivIB	NA	NA	NA	NA	NA
WP_001087551.1|3178784_3180092_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_042512269.1|3180131_3181286_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_000261988.1|3181598_3182516_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000976948.1|3182535_3183255_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_000197753.1|3183412_3184192_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
WP_000619397.1|3184366_3184645_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_001209022.1|3184762_3185581_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000218170.1|3185577_3186252_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000119136.1|3186271_3186742_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_000450918.1|3186748_3187012_+	YggT family protein	NA	NA	NA	NA	NA
WP_000029721.1|3187027_3187795_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_001131611.1|3187884_3188391_+	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_000455931.1|3188738_3191504_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	27.1	2.7e-85
>prophage 6
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	4219769	4226975	5413450		Geobacillus_phage(33.33%)	9	NA	NA
WP_000540634.1|4219769_4220576_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
WP_000820167.1|4220641_4220854_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000714659.1|4220856_4222242_-	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.9	7.8e-78
WP_000288934.1|4222489_4222894_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000994639.1|4222907_4223261_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000655496.1|4223282_4223990_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_001093444.1|4224055_4224442_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000720567.1|4224651_4225170_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_042512621.1|4225607_4226975_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
>prophage 7
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	4531869	4564356	5413450	portal,holin,tail,terminase	Bacillus_phage(73.91%)	42	NA	NA
WP_042512714.1|4531869_4533333_-	recombinase family protein	NA	Q2XVV3	Bacillus_phage	54.1	2.4e-141
WP_042512715.1|4533678_4533897_-	hypothetical protein	NA	A0A0U3TKC9	Bacillus_phage	50.8	1.1e-07
WP_042512717.1|4534136_4534760_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	78.2	1.9e-92
WP_042512718.1|4534701_4535892_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.4	7.8e-143
WP_042512719.1|4536007_4536190_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_042512720.1|4536186_4536489_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	56.1	5.2e-27
WP_042512721.1|4536488_4536755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512722.1|4536940_4537141_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	8.2e-13
WP_139303532.1|4537785_4537908_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	1.3e-08
WP_042512723.1|4537895_4538258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694537.1|4538437_4538677_+	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	67.1	2.0e-21
WP_042512724.1|4538753_4539086_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	47.2	4.8e-18
WP_042512725.1|4539109_4539307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512726.1|4539308_4540655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512727.1|4541620_4541851_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	1.2e-23
WP_042512728.1|4541865_4542150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512729.1|4542243_4542519_-	hypothetical protein	NA	A0A1B1P7E8	Bacillus_phage	72.9	1.4e-31
WP_080334514.1|4542538_4544917_-|tail	phage tail protein	tail	A0A1B1P7E6	Bacillus_phage	35.2	6.9e-183
WP_042512730.1|4544913_4546425_-|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	58.6	5.1e-163
WP_042513567.1|4546437_4550226_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	40.3	9.4e-41
WP_042512731.1|4550262_4550517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512732.1|4550606_4550984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512733.1|4551036_4551552_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_042512734.1|4551565_4551973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512735.1|4551979_4552342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512736.1|4552341_4552716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512737.1|4552719_4553526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512738.1|4553530_4553872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512739.1|4553901_4554126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512740.1|4554176_4554584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512741.1|4554682_4555807_-	DUF5309 family protein	NA	NA	NA	NA	NA
WP_042512742.1|4555869_4556652_-	phage scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.9	4.4e-09
WP_042512743.1|4556710_4558228_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.4	1.6e-68
WP_042512744.1|4558244_4559960_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.9	5.0e-151
WP_042512745.1|4559976_4560405_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	2.6e-32
WP_042512746.1|4561174_4561564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512747.1|4561824_4562151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512748.1|4562140_4562323_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	48.0	4.4e-05
WP_042512749.1|4562485_4563685_+	protein kinase	NA	J2YXI2	Acanthamoeba_polyphaga_lentillevirus	28.0	1.3e-07
WP_042512750.1|4563681_4563879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512751.1|4563875_4564073_-	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	47.4	8.6e-07
WP_042512752.1|4564077_4564356_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.3	1.0e-13
>prophage 8
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	5020828	5030146	5413450		Bacillus_phage(71.43%)	9	NA	NA
WP_042512871.1|5020828_5021701_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.1	7.9e-68
WP_042512872.1|5021835_5022507_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_000818985.1|5022656_5023376_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823559.1|5023571_5024159_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_042512873.1|5024183_5025257_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_171856546.1|5025253_5025958_-	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_042512874.1|5026019_5027780_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.7	5.7e-267
WP_001194301.1|5028020_5028785_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755546.1|5028883_5030146_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
>prophage 9
NZ_CP053931	Bacillus cereus strain FDAARGOS_797 chromosome, complete genome	5413450	5396559	5405904	5413450		Bacillus_phage(85.71%)	15	NA	NA
WP_080334529.1|5396559_5398014_-	recombinase family protein	NA	Q3HKZ2	Bacillus_phage	98.1	3.1e-274
WP_042512998.1|5398080_5398944_-	helix-turn-helix domain-containing protein	NA	A0A288WFX4	Bacillus_phage	99.7	4.5e-156
WP_142337077.1|5398959_5399079_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	74.4	4.7e-08
WP_042512999.1|5399242_5399479_+	helix-turn-helix domain-containing protein	NA	A0A288WFZ7	Bacillus_phage	100.0	1.2e-34
WP_042513000.1|5399511_5400129_-	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	98.5	1.2e-110
WP_042513001.1|5400070_5401252_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	99.7	1.7e-227
WP_001982935.1|5401369_5401552_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	100.0	4.2e-24
WP_042513002.1|5401548_5401857_-	hypothetical protein	NA	Q2I8E3	Bacillus_phage	90.2	6.6e-46
WP_042513003.1|5402016_5402214_+	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	95.4	8.3e-26
WP_042513004.1|5402218_5402803_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	99.0	6.8e-108
WP_042513005.1|5402870_5403200_+	hypothetical protein	NA	A0A288WGP7	Bacillus_phage	96.3	1.0e-52
WP_042513006.1|5403321_5404320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513007.1|5404376_5405432_-	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	97.7	3.6e-200
WP_016716828.1|5405428_5405668_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
WP_029440514.1|5405667_5405904_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
>prophage 1
NZ_CP053930	Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence	211003	139783	184407	211003	integrase,transposase,protease	Bacillus_phage(36.36%)	43	163753:163768	178736:178751
WP_000861527.1|139783_142750_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.3	3.5e-216
WP_001226074.1|142897_143473_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.3	4.6e-16
WP_000383879.1|143585_144431_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	42.9	4.4e-23
WP_001191778.1|144752_145832_+	endospore germination permease	NA	NA	NA	NA	NA
WP_042631285.1|145886_147371_+	spore germination protein	NA	NA	NA	NA	NA
WP_000766211.1|147367_148522_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_042512073.1|148945_149653_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000425109.1|149702_150095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804598.1|150332_150746_-	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	83.2	3.9e-65
WP_042512071.1|150777_151182_-	hypothetical protein	NA	A0A0A7AR60	Bacillus_phage	33.1	1.3e-09
WP_042512070.1|151416_151770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091677.1|151847_152042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080334501.1|152074_152482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512069.1|152570_152753_-	hypothetical protein	NA	A0A0U3B243	Bacillus_phage	83.3	6.5e-25
WP_042512068.1|152912_154154_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	25.8	3.8e-23
WP_042512067.1|154172_154853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512066.1|155009_155312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426064.1|155396_155702_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_042512064.1|155692_156076_-	membrane protein	NA	NA	NA	NA	NA
WP_042512063.1|156240_156816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512061.1|156832_159043_-	lysozyme family protein	NA	A7KUS1	Bacillus_phage	40.7	3.0e-15
WP_042512060.1|159039_163020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765113.1|163050_165150_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
163753:163768	attL	AATTTCTTTTAACTCT	NA	NA	NA	NA
WP_000892015.1|165152_166067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233525.1|166067_166418_-	PrgI family protein	NA	NA	NA	NA	NA
WP_042512155.1|166484_166820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512154.1|167054_167243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512059.1|167457_168381_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000353863.1|168488_168650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888139.1|169333_171217_-	TniQ family protein	NA	NA	NA	NA	NA
WP_001285624.1|171223_172864_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000631828.1|172856_175001_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001129155.1|174981_175821_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_033695785.1|175939_176368_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_001027747.1|176395_176677_-	adhesin	NA	NA	NA	NA	NA
WP_000549739.1|176693_177638_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.8	4.2e-75
WP_000182869.1|177661_179425_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
178736:178751	attR	AATTTCTTTTAACTCT	NA	NA	NA	NA
WP_000717840.1|179443_179803_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_000428325.1|179868_180273_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	64.3	5.3e-43
WP_000072354.1|180299_181355_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000416301.1|181383_181731_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	40.9	1.7e-10
WP_000566970.1|181925_182117_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042512153.1|182970_184407_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
