The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054003	Bacteroides fragilis strain FDAARGOS_763 chromosome, complete genome	5460140	784517	847285	5460140	protease,integrase,plate,transposase	unidentified_phage(11.11%)	59	804610:804625	831172:831187
WP_005777415.1|784517_785648_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.1	5.3e-16
WP_004310192.1|785781_786555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004322056.1|786731_787130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005777412.1|787107_788214_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004310189.1|788320_789208_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_005777409.1|789444_789897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310187.1|789898_790222_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_007481835.1|790282_790573_+	DUF4134 family protein	NA	NA	NA	NA	NA
WP_004289323.1|791114_792926_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	2.5e-31
WP_007481836.1|792950_793145_+	DUF4134 family protein	NA	NA	NA	NA	NA
WP_004310185.1|793156_793450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005777401.1|793560_796272_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_005777399.1|796271_796910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005777397.1|796914_799446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004322064.1|799442_800168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310179.1|800372_801143_+	site-specific DNA-methyltransferase	NA	A0A2C9CYT3	Yersinia_phage	45.6	1.2e-56
WP_005777394.1|801211_801982_+	DUF5045 domain-containing protein	NA	NA	NA	NA	NA
WP_005777392.1|801996_802698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005777390.1|803041_804340_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032541540.1|804344_804947_+	RloB domain-containing protein	NA	NA	NA	NA	NA
804610:804625	attL	ATAGCAAGAAGAAATA	NA	NA	NA	NA
WP_005777385.1|806831_810815_-	Eco57I restriction-modification methylase domain-containing protein	NA	NA	NA	NA	NA
WP_005777383.1|810821_811838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777381.1|812089_813301_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005777379.1|813306_814095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032541434.1|814091_815144_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_005777375.1|815140_815491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777373.1|815667_816387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777371.1|816421_816733_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032541432.1|816906_818097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777367.1|818107_819478_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004310176.1|820157_820547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310175.1|820553_821168_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_004310174.1|821180_821552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310173.1|821566_822049_+	N-6-adenine-methyltransferase	NA	B5TR99	Bacteroides_phage	61.0	4.5e-57
WP_004310172.1|822059_823205_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_004322067.1|823217_823553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004322068.1|823602_824202_+	hypothetical protein	NA	A0A0K0KVF7	Prochlorococcus_phage	56.1	4.3e-49
WP_004310170.1|824214_825060_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_004310169.1|825056_825569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310168.1|825590_826247_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_004310167.1|826260_826998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004310166.1|827001_829188_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_004310164.1|829697_829970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004322070.1|829977_830253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008659497.1|830761_832501_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	3.3e-17
831172:831187	attR	ATAGCAAGAAGAAATA	NA	NA	NA	NA
WP_005777345.1|832549_832786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005777343.1|833070_834390_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004310159.1|834460_834715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777339.1|834721_835477_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.2	7.6e-19
WP_005777338.1|835712_836126_-	single-stranded DNA-binding protein	NA	A0A139ZPL3	Marinitoga_camini_virus	30.4	3.7e-07
WP_005777334.1|836802_837543_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005777331.1|837987_838446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005777329.1|838458_839178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310152.1|839581_840961_-	type VI secretion system contractile sheath protein TssC	NA	NA	NA	NA	NA
WP_004310151.1|840973_841441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032536584.1|841638_842619_+|transposase	IS982-like element IS1187 family transposase	transposase	NA	NA	NA	NA
WP_004310150.1|842644_843067_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_005777323.1|843074_844850_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005777322.1|844846_847285_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	27.5	1.1e-69
>prophage 2
NZ_CP054003	Bacteroides fragilis strain FDAARGOS_763 chromosome, complete genome	5460140	2874224	2887907	5460140		Riemerella_phage(50.0%)	8	NA	NA
WP_005778768.1|2874224_2878349_+	hypothetical protein	NA	H7BUR2	unidentified_phage	23.3	3.4e-12
WP_005778769.1|2878375_2878885_+	hypothetical protein	NA	F5A3A1	Riemerella_phage	29.6	9.1e-08
WP_139018701.1|2878859_2880095_+	LamG domain-containing protein	NA	F5A3A0	Riemerella_phage	35.9	2.4e-22
WP_005778772.1|2880079_2884477_+	hypothetical protein	NA	F5A399	Riemerella_phage	39.7	2.0e-127
WP_005778773.1|2884480_2884873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005778775.1|2884955_2885228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171810372.1|2885379_2886537_+	hypothetical protein	NA	A0A2P9HXN3	Yersinia_phage	27.9	4.9e-17
WP_005778778.1|2886896_2887907_+	reverse transcriptase	NA	H7BW04	unidentified_phage	52.7	9.1e-92
>prophage 3
NZ_CP054003	Bacteroides fragilis strain FDAARGOS_763 chromosome, complete genome	5460140	4764420	4841877	5460140	protease,integrase,transposase	Liberibacter_phage(25.0%)	60	4813122:4813143	4814768:4814789
WP_032536584.1|4764420_4765401_+|transposase	IS982-like element IS1187 family transposase	transposase	NA	NA	NA	NA
WP_005782781.1|4765660_4765918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032541919.1|4766069_4767065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782778.1|4767094_4768051_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_005782777.1|4768179_4769208_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_005782776.1|4769378_4770659_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_032541918.1|4770854_4771967_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005821496.1|4772522_4773335_+	DUF4469 domain-containing protein	NA	NA	NA	NA	NA
WP_005782772.1|4773505_4775716_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.0	3.2e-33
WP_005782771.1|4775975_4776176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782770.1|4776211_4777585_-	TolC family protein	NA	NA	NA	NA	NA
WP_005782769.1|4777894_4781104_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	4.7e-49
WP_005782767.1|4781181_4782300_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005782765.1|4782450_4783302_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005782762.1|4783677_4783911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005782761.1|4784326_4785820_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	33.3	1.7e-57
WP_171810387.1|4785954_4786854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171810386.1|4787042_4788674_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.3	3.0e-28
WP_005821486.1|4788785_4790399_-	serine hydrolase	NA	NA	NA	NA	NA
WP_005782753.1|4790792_4791464_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005782752.1|4791647_4792562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005782748.1|4792775_4793660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005782746.1|4793799_4795335_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_005782744.1|4795352_4795853_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_032541926.1|4795859_4797374_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005782741.1|4797909_4800168_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005782739.1|4800920_4802132_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005782737.1|4802155_4803322_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	29.1	1.9e-29
WP_005782735.1|4803420_4804398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005782733.1|4804514_4805117_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005782731.1|4805257_4806037_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005782727.1|4807202_4807523_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005782726.1|4807640_4809014_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005782724.1|4809050_4810544_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	43.1	9.5e-114
WP_005782722.1|4810549_4812088_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	46.2	9.5e-117
4813122:4813143	attL	CAAGCCGATAAATCAAAATTTG	NA	NA	NA	NA
WP_005782719.1|4813260_4814244_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.2	2.9e-34
WP_139018719.1|4814245_4815421_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
4814768:4814789	attR	CAAGCCGATAAATCAAAATTTG	NA	NA	NA	NA
WP_005782715.1|4815453_4818384_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	36.8	2.2e-175
WP_005782712.1|4818407_4820228_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_005782710.1|4820281_4823908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782708.1|4824028_4824556_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005782706.1|4824560_4825772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032541915.1|4825768_4826188_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_139018718.1|4826171_4826405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005782697.1|4826502_4827573_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005782695.1|4827575_4827950_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005782694.1|4828049_4828823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171810385.1|4830030_4830189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782689.1|4830478_4831708_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005782686.1|4832525_4833107_+	metallophosphoesterase	NA	A0A292GAJ3	Xanthomonas_phage	38.3	2.2e-26
WP_005782684.1|4833112_4833880_+	metallophosphoesterase	NA	A0A1X6WFZ0	Pacmanvirus	29.9	3.2e-20
WP_005782682.1|4834244_4835519_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_005782680.1|4835526_4835904_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032541913.1|4836248_4836782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005782676.1|4837255_4837819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782673.1|4837839_4838148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139018720.1|4838151_4838400_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005782671.1|4838584_4839874_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_172885980.1|4840572_4840842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782665.1|4841028_4841877_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	30.1	1.5e-26
