The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	0	10779	5271029		Bacillus_phage(100.0%)	14	NA	NA
WP_000698323.1|618_1761_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000684410.1|1901_2807_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_000268518.1|2888_3701_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_001057035.1|3710_4028_+	YfhH family protein	NA	NA	NA	NA	NA
WP_000122093.1|4092_4245_-	YpzG family protein	NA	NA	NA	NA	NA
WP_000517891.1|4288_4447_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_000998162.1|4568_4835_+	YfhJ family protein	NA	NA	NA	NA	NA
WP_000379125.1|4859_5840_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000171408.1|5989_7087_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000275445.1|7120_7345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000039039.1|7470_7752_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_000997582.1|7940_8201_+	stress-induced protein	NA	NA	NA	NA	NA
WP_000506628.1|8433_8964_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_001161615.1|9018_10779_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.8e-56
>prophage 2
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	18203	19217	5271029		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000843645.1|18203_19217_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	5.8e-22
>prophage 3
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	34352	80647	5271029	integrase,holin,terminase,portal,capsid,protease,tRNA,tail	Bacillus_phage(84.44%)	60	32766:32784	87461:87479
32766:32784	attL	GTACATTTACAAAGGATGA	NA	NA	NA	NA
WP_000345218.1|34352_35495_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000260550.1|35539_36427_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_000538147.1|36485_36974_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000664302.1|37101_39171_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000353280.1|39575_41471_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.2	9.0e-101
WP_033687796.1|41916_43017_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.1	8.3e-22
WP_000286211.1|43001_44552_-	recombinase family protein	NA	D2XR37	Bacillus_phage	85.8	9.9e-223
WP_000377617.1|44714_44897_+	hypothetical protein	NA	D2XR40	Bacillus_phage	62.1	6.7e-14
WP_148313026.1|44879_45680_-	ribonuclease	NA	NA	NA	NA	NA
WP_001021824.1|45716_46151_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	79.6	1.6e-61
WP_000172328.1|46165_46585_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	54.5	5.2e-33
WP_000405111.1|46754_46946_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001274341.1|46981_47191_+	hypothetical protein	NA	D2XR40	Bacillus_phage	92.8	1.9e-28
WP_000537281.1|47232_47820_+	hypothetical protein	NA	D2XR41	Bacillus_phage	100.0	4.7e-109
WP_000215308.1|47832_48054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857132.1|48235_48520_+	hypothetical protein	NA	D2XR42	Bacillus_phage	93.6	1.5e-44
WP_000312163.1|48802_49744_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	85.0	1.0e-137
WP_000063901.1|49740_51063_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	96.4	1.7e-239
WP_000926804.1|51065_51254_+	hypothetical protein	NA	D2XR45	Bacillus_phage	88.7	1.0e-20
WP_000604168.1|51228_51516_+	hypothetical protein	NA	D2XR46	Bacillus_phage	94.4	4.9e-43
WP_001231314.1|51490_51853_+	hypothetical protein	NA	D2XR47	Bacillus_phage	94.2	8.1e-59
WP_000974688.1|51926_52118_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	93.7	1.2e-26
WP_000778214.1|52139_52655_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	90.1	1.5e-82
WP_042631161.1|52693_52903_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	97.1	3.9e-34
WP_000646516.1|52938_53214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042631249.1|53239_53422_+	hypothetical protein	NA	A0A1B1P7C0	Bacillus_phage	89.8	1.5e-21
WP_000714747.1|53459_53669_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	91.3	1.8e-31
WP_049689347.1|53704_54070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042631248.1|54188_54935_+	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	60.2	2.9e-79
WP_000758102.1|55051_55333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723866.1|55528_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744464.1|55695_56166_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	72.3	6.1e-59
WP_001055134.1|56162_56705_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	95.0	2.8e-92
WP_144405022.1|56905_57178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656806.1|57667_58015_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	53.1	2.1e-24
WP_000587663.1|58017_58326_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	80.8	1.3e-41
WP_001228912.1|58432_58753_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B1P762	Bacillus_phage	85.8	4.5e-45
WP_033687799.1|58736_60419_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	93.0	9.8e-309
WP_000524275.1|60433_61606_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	90.9	3.3e-202
WP_000423566.1|61586_62333_+|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	60.7	3.5e-64
WP_000154580.1|62360_63512_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	93.5	2.2e-203
WP_080000553.1|63486_63660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033687800.1|63646_63946_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	76.3	1.2e-36
WP_001168000.1|63929_64325_+	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	79.1	1.7e-46
WP_000664219.1|64299_64683_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	80.8	3.6e-49
WP_000118162.1|64663_65092_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	74.5	1.4e-57
WP_000301569.1|65093_65678_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	57.6	2.9e-58
WP_000701647.1|65752_66229_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	54.9	7.6e-41
WP_000113549.1|66392_70904_+	hypothetical protein	NA	Q0H230	Geobacillus_phage	52.4	3.2e-104
WP_000198630.1|70908_71769_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	56.0	1.7e-70
WP_000962013.1|71846_73463_+|tail	phage tail protein	tail	A0A0K1LLF9	Bacillus_phage	37.6	1.4e-94
WP_144405015.1|73519_75652_+|tail	tail fiber domain-containing protein	tail	Q9FZW3	Bacillus_phage	45.1	6.9e-25
WP_000614141.1|75930_76731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001049697.1|77022_77787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000822943.1|77882_78842_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR30	Bacillus_phage	92.2	4.6e-170
WP_001115042.1|78857_79097_+	hemolysin XhlA family protein	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_000787572.1|79139_79370_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	93.4	1.8e-32
WP_000135310.1|79386_80139_+	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	72.4	1.8e-97
WP_000633248.1|80152_80410_-	hypothetical protein	NA	A0A1B2APX4	Phage_Wrath	58.8	4.0e-20
WP_000604231.1|80428_80647_-	winged helix-turn-helix transcriptional regulator	NA	A0A1B1P7Q3	Bacillus_phage	61.2	9.2e-18
87461:87479	attR	GTACATTTACAAAGGATGA	NA	NA	NA	NA
>prophage 4
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	85190	86741	5271029		Vibrio_phage(100.0%)	1	NA	NA
WP_000591591.1|85190_86741_-	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	25.8	1.1e-22
>prophage 5
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	92525	94502	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000486181.1|92525_94502_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.9	4.9e-17
>prophage 6
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	101728	102826	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000571399.1|101728_102826_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.7	4.2e-26
>prophage 7
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	106389	107915	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_000821964.1|106389_107094_+	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	37.7	2.5e-32
WP_001238611.1|107243_107915_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	1.8e-32
>prophage 8
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	111205	117044	5271029		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001169189.1|111205_113188_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.1	6.9e-11
WP_000746415.1|113266_114871_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_000598671.1|114867_115575_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	2.0e-08
WP_000512718.1|115697_117044_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	42.3	3.1e-15
>prophage 9
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	122378	124579	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_000041007.1|122378_123842_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	36.0	1.1e-40
WP_000238951.1|123907_124579_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	5.5e-37
>prophage 10
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	136004	140440	5271029		Streptococcus_phage(66.67%)	3	NA	NA
WP_000918377.1|136004_136382_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	38.3	8.2e-14
WP_000796597.1|136406_138773_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	3.0e-122
WP_000222893.1|138976_140440_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.9	3.9e-112
>prophage 11
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	156512	157862	5271029		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000338316.1|156512_157862_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.8	2.6e-62
>prophage 12
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	161453	168271	5271029		Anomala_cuprea_entomopoxvirus(25.0%)	6	NA	NA
WP_001167965.1|161453_162275_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	8.9e-13
WP_000095906.1|162776_163967_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.1	3.4e-45
WP_000723139.1|164011_164977_+	L-threonine 3-dehydrogenase	NA	D6PH86	uncultured_phage	27.3	3.6e-05
WP_001189937.1|165031_165454_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001248859.1|165493_167374_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000892978.1|167377_168271_-	MoxR family ATPase	NA	R4TG24	Halovirus	29.1	5.7e-13
>prophage 13
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	185921	187493	5271029		Planktothrix_phage(50.0%)	2	NA	NA
WP_003169029.1|185921_186650_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.5	9.9e-40
WP_000916465.1|186662_187493_+	glutamine ABC transporter substrate-binding protein GlnH	NA	A0A1B1IT51	uncultured_Mediterranean_phage	25.4	1.1e-10
>prophage 14
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	193473	200329	5271029		Bacillus_phage(50.0%)	6	NA	NA
WP_000030276.1|193473_194427_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.5	1.8e-17
WP_000085757.1|194533_195055_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822563.1|195068_196460_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	8.2e-35
WP_000565454.1|196471_197149_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	3.7e-33
WP_000710406.1|197324_198575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487877.1|198877_200329_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.6	4.0e-141
>prophage 15
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	204957	206890	5271029		Bacillus_virus(50.0%)	2	NA	NA
WP_001196378.1|204957_205884_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	5.1e-17
WP_000795372.1|205870_206890_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	9.3e-20
>prophage 16
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	212010	217363	5271029		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_001132845.1|212010_212907_+	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.0	7.5e-05
WP_000716140.1|212903_213299_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_001217683.1|213317_214802_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	3.7e-17
WP_001074631.1|214804_215740_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000758999.1|215754_216681_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_000667661.1|216715_217363_+	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.8	8.8e-48
>prophage 17
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	221768	235984	5271029		Synechococcus_phage(16.67%)	15	NA	NA
WP_000645822.1|221768_222821_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948234.1|222939_223284_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730992.1|223537_224389_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676768.1|224462_225464_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	58.6	6.4e-90
WP_000373774.1|225571_226744_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_000948920.1|226731_228045_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	23.4	4.9e-05
WP_000128036.1|228052_229204_-	VanZ family protein	NA	NA	NA	NA	NA
WP_001268339.1|229376_229580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434783.1|229637_230450_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000495010.1|230582_231527_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	9.6e-11
WP_001105817.1|231747_233022_+	cell wall-binding protein	NA	W5QUL8	Bacillus_phage	66.4	7.3e-30
WP_000154012.1|233134_233353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001080034.1|233345_233819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041717.1|233935_234568_+	class A sortase	NA	NA	NA	NA	NA
WP_000443134.1|234598_235984_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	6.4e-64
>prophage 18
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	242830	244455	5271029		Moraxella_phage(50.0%)	2	NA	NA
WP_000487177.1|242830_244123_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	2.6e-43
WP_000301182.1|244254_244455_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	52.6	3.6e-08
>prophage 19
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	265674	268719	5271029		Leptospira_phage(100.0%)	1	NA	NA
WP_000375595.1|265674_268719_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	1.4e-66
>prophage 20
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	278597	281802	5271029		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001056054.1|278597_279758_-	SH3 domain-containing protein	NA	A0A0D4DC81	Staphylococcus_phage	34.6	1.2e-10
WP_000666826.1|280388_281084_+	thiaminase II	NA	NA	NA	NA	NA
WP_001256814.1|281052_281802_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.2e-32
>prophage 21
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	291462	293553	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_001248014.1|291462_293553_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.6	4.7e-42
>prophage 22
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	298581	300951	5271029		Moraxella_phage(50.0%)	2	NA	NA
WP_000482728.1|298581_299883_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.5	2.8e-53
WP_001136289.1|300084_300951_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	3.3e-58
>prophage 23
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	334256	337912	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_033687811.1|334256_335612_-	3D domain-containing protein	NA	J9PQW7	Bacillus_phage	71.8	1.6e-35
WP_001097707.1|336059_337235_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000609099.1|337237_337912_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.1e-36
>prophage 24
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	345038	346648	5271029		Orpheovirus(50.0%)	2	NA	NA
WP_000440961.1|345038_345818_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	36.0	6.2e-40
WP_000557719.1|345835_346648_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	30.8	3.3e-28
>prophage 25
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	361335	361821	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000898002.1|361335_361821_+	PRK06770 family protein	NA	G3MB13	Bacillus_virus	28.5	2.3e-08
>prophage 26
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	373568	375566	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_001035751.1|373568_375566_-	catalase	NA	A0A2K9L572	Tupanvirus	51.3	1.3e-150
>prophage 27
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	379914	389644	5271029		Bacillus_phage(60.0%)	8	NA	NA
WP_000423697.1|379914_381000_+	DUF3626 domain-containing protein	NA	A0A2H4UV60	Bodo_saltans_virus	23.8	1.9e-07
WP_000213637.1|381077_382517_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000493201.1|383107_384874_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	2.0e-46
WP_000116615.1|384870_386871_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	1.0e-38
WP_000732844.1|387143_387941_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000281493.1|387927_388626_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000623605.1|388654_389389_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	3.4e-40
WP_000013338.1|389440_389644_-	small acid-soluble spore protein, SasP family	NA	Q77YX0	Bacillus_phage	65.2	2.1e-16
>prophage 28
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	403943	409302	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000726507.1|403943_405683_-	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	58.6	9.6e-41
WP_002002173.1|405940_407431_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_000282025.1|407745_409302_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	5.6e-40
>prophage 29
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	419880	422370	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_001140717.1|419880_422370_+	S-layer homology domain-containing protein	NA	A0A140HM30	Bacillus_phage	28.3	1.1e-13
>prophage 30
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	427066	430166	5271029		Pseudomonas_phage(100.0%)	2	NA	NA
WP_000232127.1|427066_428482_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.9	1.0e-64
WP_000898515.1|428708_430166_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	46.6	9.0e-117
>prophage 31
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	436210	441463	5271029		Bacillus_phage(33.33%)	5	NA	NA
WP_000877266.1|436210_437800_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.8	7.7e-13
WP_001059311.1|437932_438886_+	RsmD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000529075.1|439089_439332_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	57.8	1.1e-06
WP_000868749.1|439470_440466_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_000960278.1|440485_441463_+	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	30.5	1.3e-18
>prophage 32
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	449044	454154	5271029		Planktothrix_phage(50.0%)	5	NA	NA
WP_001291175.1|449044_450037_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	5.7e-14
WP_000544152.1|450029_451001_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_156160297.1|451389_451536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735544.1|451584_452403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000079855.1|452828_454154_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	5.8e-46
>prophage 33
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	458372	465676	5271029		Staphylococcus_phage(66.67%)	5	NA	NA
WP_000427031.1|458372_461273_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	27.7	2.8e-29
WP_131369755.1|461465_461993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762858.1|462263_462830_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000819032.1|462852_464445_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.8	3.7e-124
WP_080000691.1|465034_465676_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.0	1.0e-11
>prophage 34
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	474446	476590	5271029		Geobacillus_virus(50.0%)	2	NA	NA
WP_000312176.1|474446_475307_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	37.8	2.1e-49
WP_042631242.1|475303_476590_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	58.4	1.9e-139
>prophage 35
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	484205	484463	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000432147.1|484205_484463_-	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	40.8	1.3e-07
>prophage 36
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	510054	516265	5271029		Bacillus_phage(66.67%)	5	NA	NA
WP_033687814.1|510054_510831_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	29.5	2.0e-22
WP_000017761.1|510900_511341_+	bacterioferritin	NA	NA	NA	NA	NA
WP_000025547.1|511519_512662_+	fused response regulator/phosphatase	NA	W8CYM9	Bacillus_phage	30.4	1.2e-10
WP_000429053.1|512700_513558_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000836712.1|513574_516265_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.6	2.5e-40
>prophage 37
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	522186	524466	5271029		Bacillus_virus(50.0%)	4	NA	NA
WP_000273536.1|522186_522327_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	63.4	6.1e-07
WP_000582789.1|522481_522844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539551.1|522870_523056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035870.1|523224_524466_+	DNA repair exonuclease	NA	A0A060AC66	Listeria_phage	28.9	2.7e-13
>prophage 38
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	530040	531042	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000249932.1|530040_531042_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	7.0e-20
>prophage 39
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	534599	540826	5271029		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_000500594.1|534599_535688_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.6	2.7e-89
WP_000724994.1|535687_535891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134188939.1|536130_537003_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000449227.1|537083_537284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000554487.1|537457_538309_+	DUF2935 domain-containing protein	NA	G5CQX5	Megavirus	26.2	3.1e-08
WP_000577667.1|538668_539118_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.2	9.8e-06
WP_000394287.1|539215_539776_+	glycerol uptake operon antiterminator GlpP	NA	NA	NA	NA	NA
WP_001272189.1|540004_540826_+	glycerol uptake facilitator protein GlpF	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	36.7	3.0e-29
>prophage 40
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	544443	545803	5271029	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085962607.1|544443_545803_+|transposase	IS3-like element ISBce15 family transposase	transposase	A0A1B1P773	Bacillus_phage	60.4	2.5e-89
>prophage 41
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	560458	562196	5271029		Mycobacterium_phage(50.0%)	2	NA	NA
WP_001016840.1|560458_560893_-	HIT family protein	NA	S5VWB9	Mycobacterium_phage	34.4	2.1e-05
WP_001292610.1|561452_562196_+	ABC transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	4.1e-25
>prophage 42
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	600453	601395	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_001082261.1|600453_601395_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	1.1e-19
>prophage 43
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	605531	610430	5271029		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001055166.1|605531_607064_+	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.2	1.3e-44
WP_000435473.1|607176_607428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000512003.1|608186_610430_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	1.7e-42
>prophage 44
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	627582	628596	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000830615.1|627582_628596_-	beta-channel forming cytolysin CytK	NA	R4WAV6	Staphylococcus_phage	31.9	1.3e-26
>prophage 45
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	635541	637998	5271029		Hokovirus(50.0%)	2	NA	NA
WP_001010423.1|635541_637284_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.9	6.5e-13
WP_000272701.1|637293_637998_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.2e-34
>prophage 46
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	643430	644090	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000739935.1|643430_644090_+	S-layer homology domain-containing protein	NA	A0A218KDG5	Bacillus_phage	32.3	1.4e-05
>prophage 47
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	649494	649698	5271029		Lactococcus_phage(100.0%)	1	NA	NA
WP_000301519.1|649494_649698_+	RNA chaperone/antiterminator CspA	NA	Q9AZD3	Lactococcus_phage	64.5	2.1e-16
>prophage 48
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	656265	660541	5271029		Bacillus_virus(50.0%)	3	NA	NA
WP_000572289.1|656265_659988_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	24.9	5.8e-19
WP_000255719.1|660000_660288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141566.1|660325_660541_-	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.9	3.4e-25
>prophage 49
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	664161	671241	5271029		Klosneuvirus(33.33%)	6	NA	NA
WP_000616648.1|664161_665352_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	9.8e-29
WP_000233490.1|665502_665868_+	YisL family protein	NA	NA	NA	NA	NA
WP_000616043.1|665926_666481_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_000333963.1|666719_668567_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	26.8	8.1e-22
WP_000727366.1|668755_669715_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069158.1|669774_671241_+	catalase	NA	A0A2K9L572	Tupanvirus	51.6	1.8e-125
>prophage 50
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	682541	685142	5271029		Cronobacter_phage(100.0%)	1	NA	NA
WP_000365381.1|682541_685142_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	4.5e-119
>prophage 51
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	690854	691601	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000966135.1|690854_691601_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	40.8	4.0e-44
>prophage 52
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	697688	699660	5271029		Planktothrix_phage(50.0%)	2	NA	NA
WP_000854348.1|697688_698732_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.1e-18
WP_000166346.1|698724_699660_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	23.7	1.1e-06
>prophage 53
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	704520	705195	5271029		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000362609.1|704520_705195_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	43.6	5.2e-27
>prophage 54
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	709198	711025	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000003393.1|709198_711025_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.7	4.7e-62
>prophage 55
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	718087	722888	5271029		Salmonella_phage(33.33%)	5	NA	NA
WP_000872722.1|718087_718828_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TNS0	Salmonella_phage	27.0	6.8e-12
WP_000654054.1|718902_720063_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_000427733.1|720205_721141_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.0	4.1e-06
WP_001004743.1|721147_721906_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000428855.1|722042_722888_-	O-methyltransferase	NA	A0A2R8FFV8	Cedratvirus	52.5	7.9e-57
>prophage 56
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	727395	729672	5271029		Enterobacteria_phage(33.33%)	3	NA	NA
WP_000676165.1|727395_728133_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	44.9	1.1e-51
WP_000864162.1|728141_728687_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.1	6.7e-33
WP_001024141.1|728703_729672_+	dTDP-glucose 4,6-dehydratase	NA	M1HHF3	Acanthocystis_turfacea_Chlorella_virus	44.7	1.4e-70
>prophage 57
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	734756	736823	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000191176.1|734756_736823_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.8	1.4e-78
>prophage 58
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	741041	747191	5271029		Acinetobacter_phage(75.0%)	5	NA	NA
WP_000107217.1|741041_742520_-	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	25.2	3.3e-10
WP_033687829.1|743403_744822_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000636355.1|744818_745406_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	1.9e-49
WP_001067345.1|745402_746428_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	3.0e-50
WP_000536690.1|746429_747191_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.8	2.2e-37
>prophage 59
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	763127	811471	5271029	integrase,terminase,bacteriocin,portal,capsid,protease	Bacillus_phage(27.27%)	55	762388:762404	803077:803093
762388:762404	attL	AAATGGTAATAAAGAAT	NA	NA	NA	NA
WP_000067629.1|763127_765047_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_000569912.1|765171_766428_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_000197127.1|766561_769429_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_000428510.1|770253_770463_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	41.1	1.3e-05
WP_001109905.1|770465_770843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178301.1|770871_771054_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
WP_001036567.1|771188_771545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195372.1|771563_771833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182254.1|773072_773264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771628.1|773292_773541_+	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_000516413.1|773581_773770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035976.1|774416_774884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086694.1|775030_775615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164232.1|775700_776045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000191135.1|776126_776906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035977.1|777012_777330_-	hypothetical protein	NA	A0A0A8WIE3	Clostridium_phage	36.3	1.5e-08
WP_000977940.1|777508_777712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511673.1|777695_777899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001000828.1|778090_778339_-	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	41.9	2.4e-06
WP_033688446.1|778514_778811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000828804.1|778824_779064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001058016.1|779200_780526_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	36.8	1.4e-63
WP_162484064.1|781188_781335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404510.1|781371_781521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404511.1|781594_781939_+	HNH endonuclease	NA	A0A0S2MXX9	Enterococcus_phage	41.4	3.4e-14
WP_001153942.1|782078_782519_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_000811159.1|782515_782776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000874865.1|782950_783196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000896384.1|783486_784788_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	35.1	4.6e-72
WP_001003089.1|784780_786517_+|capsid	phage major capsid protein	capsid	A0A1G5SCB8	Enterococcus_phage	37.8	1.3e-61
WP_000093742.1|786824_787319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000334962.1|787460_788198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035993.1|788321_789476_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	21.4	4.3e-05
WP_000090210.1|789789_790014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858633.1|790291_791047_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000251855.1|791412_791640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000247011.1|791795_793082_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_000767813.1|793273_793843_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000172840.1|793905_794493_+	M73 family metallopeptidase	NA	NA	NA	NA	NA
WP_000917469.1|794654_795521_+	DUF4047 domain-containing protein	NA	NA	NA	NA	NA
WP_000053731.1|795918_796512_+	camelysin	NA	NA	NA	NA	NA
WP_000578878.1|796587_796911_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000276214.1|796990_797125_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_001035926.1|797468_799856_+	immune inhibitor A	NA	NA	NA	NA	NA
WP_000116798.1|800027_801395_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000720319.1|801633_802617_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	31.2	9.3e-25
WP_000715491.1|802613_803462_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.4	1.0e-11
803077:803093	attR	ATTCTTTATTACCATTT	NA	NA	NA	NA
WP_000714199.1|803468_804269_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000772500.1|804307_805357_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000727802.1|805416_806064_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000856455.1|806174_808367_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_000490297.1|808467_808884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000448361.1|808982_809906_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000598985.1|809997_810603_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_000747596.1|810643_811471_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	67.7	3.7e-43
>prophage 60
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	817010	819086	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_000049878.1|817010_817682_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.3	2.1e-52
WP_000494832.1|817685_819086_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.7	1.1e-39
>prophage 61
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	823887	831277	5271029		Bacillus_phage(75.0%)	10	NA	NA
WP_001103777.1|823887_824199_+	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	33.0	3.3e-08
WP_000893036.1|824225_825077_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_000383325.1|825280_826075_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	39.5	1.6e-27
WP_000822337.1|826369_827689_-	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_000241212.1|827803_827989_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.7	2.4e-14
WP_001067916.1|828136_828580_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000448580.1|828681_829206_-	polyhydroxyalkanoic acid inclusion protein PhaP	NA	NA	NA	NA	NA
WP_000903022.1|829248_829701_-	poly-beta-hydroxybutyrate-responsive repressor	NA	NA	NA	NA	NA
WP_000566949.1|829899_830382_+	polyhydroxyalkanoic acid synthase subunit PhaR	NA	NA	NA	NA	NA
WP_000250412.1|830533_831277_+	acetoacetyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	1.9e-17
>prophage 62
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	837107	838109	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000006178.1|837107_838109_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	4.9e-29
>prophage 63
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	849644	851141	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000669137.1|849644_851141_-	DUF3149 domain-containing protein	NA	W8CYF6	Bacillus_phage	30.7	9.5e-21
>prophage 64
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	856088	858467	5271029		uncultured_Caudovirales_phage(25.0%)	4	NA	NA
WP_000711603.1|856088_856751_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	5.6e-66
WP_000368408.1|856750_857242_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	71.7	3.1e-61
WP_000036286.1|857234_857951_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.9	7.4e-56
WP_000918895.1|857969_858467_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.6	2.4e-53
>prophage 65
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	861689	869284	5271029		Bacillus_virus(50.0%)	7	NA	NA
WP_000959450.1|861689_862049_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.5	7.3e-36
WP_000995585.1|863043_863805_+	group I intron GIY-YIG endonuclease	NA	A0A024FSJ1	Bacillus_phage	48.8	2.5e-33
WP_001203038.1|865315_866284_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	74.1	1.2e-138
WP_000687513.1|866500_866881_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137725.1|866877_867576_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000647934.1|867572_868367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528804.1|868381_869284_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.7	8.2e-36
>prophage 66
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	877284	882470	5271029		Pseudomonas_phage(33.33%)	6	NA	NA
WP_000127943.1|877284_878451_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.2	4.1e-19
WP_000770518.1|878447_879962_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.7	6.8e-51
WP_000440293.1|879974_880121_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_001082815.1|880458_881628_+	N-acyl-aliphatic-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
WP_000929018.1|881854_882031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041153.1|882023_882470_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.7	7.0e-12
>prophage 67
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	897486	902252	5271029		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000095858.1|897486_899187_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	33.7	1.6e-64
WP_000822948.1|899183_899693_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_001151752.1|899719_900730_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000809584.1|900731_902252_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.2	1.6e-07
>prophage 68
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	913487	917309	5271029		Cedratvirus(50.0%)	3	NA	NA
WP_001984478.1|913487_914507_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	28.6	6.5e-29
WP_000285422.1|914539_915241_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000941729.1|915422_917309_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.1	1.3e-86
>prophage 69
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	920996	922133	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_000108776.1|920996_922133_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	30.2	1.2e-44
>prophage 70
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	928833	930105	5271029		Rhodococcus_phage(100.0%)	1	NA	NA
WP_000726093.1|928833_930105_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	37.2	2.6e-11
>prophage 71
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	954849	962755	5271029	integrase,transposase	Bacillus_phage(50.0%)	7	951747:951763	959996:960012
951747:951763	attL	ATTATGAAAAAAGCGAA	NA	NA	NA	NA
WP_000937254.1|954849_956112_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.5	5.9e-16
WP_000897347.1|956272_957118_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_001094858.1|957411_957606_-	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000806236.1|957725_958256_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
WP_000797500.1|958363_960175_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.0	6.5e-32
959996:960012	attR	TTCGCTTTTTTCATAAT	NA	NA	NA	NA
WP_000110707.1|960331_961039_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_042631237.1|961399_962755_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	33.2	1.2e-46
>prophage 72
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	967706	969857	5271029		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_000082669.1|967706_968621_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	9.9e-37
WP_001252616.1|968732_969857_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	24.3	9.1e-08
>prophage 73
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	975828	984801	5271029		Bacillus_phage(60.0%)	9	NA	NA
WP_000426862.1|975828_976545_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	41.7	1.2e-42
WP_000964667.1|976544_978320_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	36.0	1.6e-35
WP_000781291.1|978457_979039_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000645704.1|979123_979738_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	41.7	2.0e-17
WP_000711804.1|979768_980455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000810852.1|981002_981581_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151996.1|981704_981953_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.5e-16
WP_001176990.1|982220_983282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000762997.1|983271_984801_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	1.2e-55
>prophage 74
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	990511	991042	5271029		uncultured_phage(100.0%)	1	NA	NA
WP_001240643.1|990511_991042_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWN1	uncultured_phage	63.2	5.3e-59
>prophage 75
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1005206	1015403	5271029		Bacillus_phage(14.29%)	11	NA	NA
WP_001043860.1|1005206_1005479_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	1.0e-29
WP_001151482.1|1005599_1006169_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.3	2.4e-49
WP_002157308.1|1006382_1007132_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001187667.1|1007161_1007875_+	2-heptaprenyl-1,4-naphthoquinone methyltransferase	NA	NA	NA	NA	NA
WP_000776082.1|1007906_1008869_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.8	3.8e-07
WP_000415887.1|1008993_1009440_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.0e-27
WP_001269366.1|1009710_1010883_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.6	3.0e-46
WP_000526824.1|1010882_1011974_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_042631236.1|1012105_1013218_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.4	2.8e-17
WP_001168686.1|1013530_1014793_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001095923.1|1014866_1015403_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	52.0	1.3e-44
>prophage 76
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1022028	1022910	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000203305.1|1022028_1022910_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.2	1.0e-70
>prophage 77
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1026574	1037610	5271029	tRNA	Bacillus_phage(50.0%)	11	NA	NA
WP_000439302.1|1026574_1027768_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.4	2.0e-37
WP_001192046.1|1027752_1028733_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000026408.1|1028833_1029223_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_000851103.1|1029629_1030469_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	38.0	1.0e-48
WP_000706997.1|1030465_1031314_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000490176.1|1031326_1031710_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000044942.1|1031838_1034643_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	30.0	1.3e-68
WP_000358352.1|1034893_1035064_+	YpmA family protein	NA	NA	NA	NA	NA
WP_000758754.1|1035071_1035575_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_000761551.1|1035593_1036781_+	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_000728549.1|1036902_1037610_+	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	50.4	3.9e-25
>prophage 78
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1041577	1042180	5271029		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000155594.1|1041577_1042180_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	33.9	5.3e-23
>prophage 79
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1045808	1046363	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000862921.1|1045808_1046363_+	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	27.0	1.3e-10
>prophage 80
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1066428	1070462	5271029		Ralstonia_phage(50.0%)	4	NA	NA
WP_000084928.1|1066428_1067664_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	23.2	1.1e-09
WP_000606864.1|1067660_1068047_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000964960.1|1068739_1069465_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000757055.1|1069595_1070462_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	33.6	4.2e-21
>prophage 81
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1077958	1080651	5271029		Tupanvirus(50.0%)	2	NA	NA
WP_001023716.1|1077958_1079011_+	glycosyltransferase family 4 protein	NA	A0A2K9L0K5	Tupanvirus	24.4	6.7e-05
WP_000006047.1|1079103_1080651_+	hypothetical protein	NA	A0A143FQ34	Bacillus_phage	31.1	4.3e-24
>prophage 82
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1102163	1102361	5271029		Lactococcus_phage(100.0%)	1	NA	NA
WP_001161732.1|1102163_1102361_-	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	61.3	4.6e-16
>prophage 83
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1116400	1116718	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000678042.1|1116400_1116718_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	44.6	6.5e-12
>prophage 84
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1150547	1151456	5271029		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000075958.1|1150547_1151456_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	6.8e-46
>prophage 85
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1155617	1156403	5271029		Geobacillus_virus(100.0%)	1	NA	NA
WP_000635244.1|1155617_1156403_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	51.6	8.2e-32
>prophage 86
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1170219	1171431	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000212369.1|1170219_1171431_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	37.6	1.6e-05
>prophage 87
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1174544	1175537	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000354392.1|1174544_1175537_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	1.5e-22
>prophage 88
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1187702	1189526	5271029		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000334028.1|1187702_1189526_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.8	1.2e-33
>prophage 89
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1199273	1199933	5271029		Synechococcus_phage(100.0%)	1	NA	NA
WP_001104686.1|1199273_1199933_+	class I SAM-dependent methyltransferase	NA	A0A0E3FKP5	Synechococcus_phage	31.4	7.4e-10
>prophage 90
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1213640	1215194	5271029	transposase	Campylobacter_virus(100.0%)	1	NA	NA
WP_000859074.1|1213640_1215194_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	26.7	2.1e-10
>prophage 91
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1221427	1224233	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000694111.1|1221427_1222066_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.1	6.9e-05
WP_000397665.1|1222070_1223177_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_001093834.1|1223294_1224233_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	5.2e-25
>prophage 92
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1235961	1241100	5271029		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000011072.1|1235961_1239156_+	DEAD/DEAH box helicase	NA	M1HVH7	Acanthocystis_turfacea_Chlorella_virus	29.9	4.5e-36
WP_000047591.1|1239247_1239382_-	DUF3934 domain-containing protein	NA	NA	NA	NA	NA
WP_001983127.1|1239482_1239656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284908.1|1240116_1241100_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.7	2.1e-61
>prophage 93
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1248483	1251393	5271029		Vibrio_phage(50.0%)	2	NA	NA
WP_000797234.1|1248483_1249728_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0B5GYD7	Vibrio_phage	33.3	5.0e-07
WP_000755993.1|1249980_1251393_+	S-layer homology domain-containing protein	NA	A0A142F1E8	Bacillus_phage	35.3	3.3e-15
>prophage 94
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1264344	1265262	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000762263.1|1264344_1265262_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	55.2	2.0e-90
>prophage 95
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1270565	1271270	5271029		Orpheovirus(100.0%)	1	NA	NA
WP_000726880.1|1270565_1271270_-	polysaccharide deacetylase family protein	NA	A0A2I2L4G0	Orpheovirus	26.2	1.6e-10
>prophage 96
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1277232	1278945	5271029		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000816367.1|1277232_1278945_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.4	1.6e-72
>prophage 97
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1292693	1293137	5271029		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000702227.1|1292693_1293137_+	GNAT family N-acetyltransferase	NA	A0A0P0YNR7	Yellowstone_lake_phycodnavirus	30.1	4.8e-05
>prophage 98
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1302717	1304473	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_000414545.1|1302717_1303416_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	2.4e-35
WP_000695263.1|1303405_1304473_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	1.4e-26
>prophage 99
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1322127	1323429	5271029		Geobacillus_virus(100.0%)	1	NA	NA
WP_001983022.1|1322127_1323429_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.2	2.5e-134
>prophage 100
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1331187	1336086	5271029		uncultured_phage(50.0%)	3	NA	NA
WP_000721651.1|1331187_1332882_+	SH3 domain-containing protein	NA	D6QWN5	uncultured_phage	43.8	8.8e-15
WP_000458506.1|1333062_1333608_-	membrane protein	NA	NA	NA	NA	NA
WP_000766738.1|1333941_1336086_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	36.1	1.5e-72
>prophage 101
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1357888	1363736	5271029		Staphylococcus_phage(33.33%)	6	NA	NA
WP_001161513.1|1357888_1359379_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	3.2e-45
WP_002036184.1|1359383_1359800_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001020499.1|1359799_1360795_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000062021.1|1360976_1362194_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000149316.1|1362283_1363057_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.2	2.2e-13
WP_001196717.1|1363034_1363736_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	6.9e-14
>prophage 102
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1372705	1389937	5271029		Bacillus_phage(50.0%)	17	NA	NA
WP_000824073.1|1372705_1374421_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	24.4	1.9e-20
WP_000073494.1|1374423_1376148_+	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	32.4	1.7e-21
WP_000459100.1|1376437_1376659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695191.1|1376749_1377196_+	lipoprotein	NA	NA	NA	NA	NA
WP_001130814.1|1377283_1378285_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_000825876.1|1378487_1379441_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	4.6e-21
WP_172855416.1|1379685_1380288_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000789350.1|1380335_1380506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755548.1|1381205_1382468_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	2.6e-11
WP_001194301.1|1382566_1383331_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453764.1|1383571_1385332_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_003287820.1|1385393_1386098_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.2	1.4e-120
WP_001231491.1|1386094_1387168_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.8	7.2e-172
WP_000823559.1|1387192_1387780_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1387975_1388695_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_002036196.1|1388810_1388924_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	91.7	2.1e-05
WP_001258549.1|1389064_1389937_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	6.0e-68
>prophage 103
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1402330	1406811	5271029		Bacillus_phage(66.67%)	5	NA	NA
WP_001142163.1|1402330_1403020_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	5.9e-34
WP_000824513.1|1403016_1404378_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.6	2.9e-40
WP_000409386.1|1404478_1405300_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000873555.1|1405314_1405971_+	lipoprotein	NA	NA	NA	NA	NA
WP_000119508.1|1406130_1406811_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.7	1.7e-17
>prophage 104
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1414943	1426627	5271029	protease	Bacillus_phage(33.33%)	14	NA	NA
WP_000113545.1|1414943_1415150_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_033688475.1|1415386_1416616_+	MFS transporter	NA	NA	NA	NA	NA
WP_001287296.1|1416669_1417284_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000816382.1|1417434_1417602_+	DUF3933 family protein	NA	NA	NA	NA	NA
WP_000686815.1|1417710_1418676_-	patatin-like phospholipase family protein	NA	A0A0H3TN97	Faustovirus	28.3	3.6e-21
WP_000540419.1|1418763_1418904_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001041254.1|1419128_1419881_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000520831.1|1420026_1421187_+	peptidase	NA	NA	NA	NA	NA
WP_001048092.1|1421289_1421487_+	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000024996.1|1421518_1421980_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	6.5e-05
WP_000174880.1|1422027_1422846_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	1.6e-94
WP_001026017.1|1423117_1424998_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000648331.1|1425114_1425402_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	54.1	2.2e-11
WP_001089082.1|1425676_1426627_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	58.1	2.6e-96
>prophage 105
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1432244	1437110	5271029		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000533104.1|1432244_1434227_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	9.0e-27
WP_000539564.1|1434424_1434730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965075.1|1434981_1435350_+	DUF3979 family protein	NA	NA	NA	NA	NA
WP_002036214.1|1435384_1436425_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_000105198.1|1436666_1437110_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	3.6e-45
>prophage 106
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1440362	1441826	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_001168141.1|1440362_1441826_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.4	1.8e-16
>prophage 107
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1456145	1459831	5271029		Streptococcus_phage(50.0%)	4	NA	NA
WP_000283897.1|1456145_1456598_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.9	4.9e-29
WP_002036225.1|1456605_1457556_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824544.1|1457694_1459356_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000911686.1|1459414_1459831_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
>prophage 108
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1493801	1499298	5271029		Urbanus_proteus_nucleopolyhedrovirus(33.33%)	5	NA	NA
WP_000024457.1|1493801_1495010_+	glycosyl transferase	NA	A0A161C6Z7	Urbanus_proteus_nucleopolyhedrovirus	29.7	5.0e-12
WP_000755132.1|1495177_1496023_+	YitT family protein	NA	NA	NA	NA	NA
WP_000366301.1|1496069_1497470_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.0	3.2e-26
WP_001021909.1|1497600_1498023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000411321.1|1498170_1499298_+	metallophosphoesterase	NA	A0A127AVW0	Bacillus_phage	27.3	7.9e-12
>prophage 109
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1505829	1507476	5271029		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001097732.1|1505829_1507476_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	6.4e-79
>prophage 110
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1515090	1516260	5271029		Catovirus(100.0%)	1	NA	NA
WP_000588613.1|1515090_1516260_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.6	2.2e-41
>prophage 111
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1520885	1525448	5271029		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
WP_000466004.1|1520885_1522832_-	AarF/ABC1/UbiB kinase family protein	NA	E5ERK4	Ostreococcus_lucimarinus_virus	30.1	6.1e-36
WP_001174551.1|1522941_1523376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754998.1|1523461_1524433_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000844978.1|1524530_1524740_-	DUF3925 domain-containing protein	NA	NA	NA	NA	NA
WP_000219438.1|1524965_1525448_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.0	2.0e-25
>prophage 112
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1534076	1535552	5271029		Escherichia_phage(100.0%)	1	NA	NA
WP_000692686.1|1534076_1535552_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	4.2e-21
>prophage 113
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1539312	1541075	5271029		Indivirus(50.0%)	2	NA	NA
WP_001021678.1|1539312_1539645_+	thioredoxin	NA	A0A1V0SD63	Indivirus	47.5	3.1e-09
WP_000159926.1|1539698_1541075_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.1	3.7e-112
>prophage 114
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1564391	1573537	5271029		Streptomyces_phage(20.0%)	9	NA	NA
WP_000427803.1|1564391_1564664_+	stage V sporulation protein SpoVS	NA	A0A1J0GVV0	Streptomyces_phage	44.6	3.7e-08
WP_000722281.1|1564932_1565250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499706.1|1565932_1566694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165938.1|1566803_1567451_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.9	4.5e-12
WP_000783200.1|1567447_1569343_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.0	3.6e-57
WP_001260645.1|1569418_1570150_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000975125.1|1570255_1570510_+	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_000982007.1|1570668_1571004_+	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	61.5	4.9e-34
WP_001097732.1|1571890_1573537_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	6.4e-79
>prophage 115
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1577175	1581307	5271029	tRNA	ANMV-1_virus(50.0%)	2	NA	NA
WP_001245660.1|1577175_1578993_+	maturase	NA	A0A0C5K882	ANMV-1_virus	30.0	4.7e-14
WP_000384895.1|1579618_1581307_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.1	2.1e-77
>prophage 116
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1587818	1590920	5271029	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000754908.1|1587818_1590920_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.3	2.4e-151
>prophage 117
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1594379	1601859	5271029	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_000529802.1|1594379_1595678_+|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.5	2.1e-77
WP_000966846.1|1595878_1596643_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000241761.1|1596655_1597429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391132.1|1597457_1597820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001172765.1|1597851_1601859_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.3	1.5e-36
>prophage 118
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1608328	1617131	5271029		Bacillus_phage(50.0%)	7	NA	NA
WP_000404140.1|1608328_1609756_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	31.5	9.7e-07
WP_000657436.1|1609773_1610229_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_000786932.1|1611426_1611810_+	immunity 22 family protein	NA	NA	NA	NA	NA
WP_001221976.1|1612345_1613530_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	33.5	3.6e-31
WP_000570745.1|1613526_1614957_+	anion permease	NA	NA	NA	NA	NA
WP_000504574.1|1615085_1615769_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	6.4e-33
WP_000694894.1|1615772_1617131_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	3.3e-28
>prophage 119
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1629641	1630352	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000895238.1|1629641_1630352_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.4e-14
>prophage 120
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1636616	1638081	5271029		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000679592.1|1636616_1637573_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	1.5e-123
WP_000637198.1|1637592_1638081_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	48.1	2.5e-39
>prophage 121
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1644559	1650121	5271029		Staphylococcus_phage(50.0%)	5	NA	NA
WP_003266758.1|1644559_1645402_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	44.5	4.7e-25
WP_001129615.1|1645601_1646576_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000833353.1|1646911_1647499_+	SCO family protein	NA	NA	NA	NA	NA
WP_001288087.1|1647540_1648002_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_000333816.1|1648219_1650121_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	30.3	3.0e-35
>prophage 122
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1654360	1656316	5271029		Phage_Wrath(33.33%)	4	NA	NA
WP_000713491.1|1654360_1654849_+	lipoprotein	NA	A0A1B2APY6	Phage_Wrath	48.2	4.2e-34
WP_001983332.1|1654976_1655171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000816782.1|1655282_1655831_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	43.8	5.0e-36
WP_000540516.1|1655866_1656316_-	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	45.3	6.1e-32
>prophage 123
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1660909	1674403	5271029		Tupanvirus(20.0%)	13	NA	NA
WP_000649136.1|1660909_1661947_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.9e-29
WP_000836593.1|1662097_1663117_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000902507.1|1663113_1664016_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000845166.1|1664664_1665822_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.5	6.0e-23
WP_000728399.1|1665975_1667307_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_002036301.1|1667808_1667997_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000834281.1|1668039_1668258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526210.1|1668409_1669630_+	glycosyltransferase	NA	A0A1V0SAJ8	Catovirus	31.8	2.3e-41
WP_000767359.1|1669664_1670819_+	hypothetical protein	NA	Q6XM29	Feldmannia_irregularis_virus	37.0	3.9e-14
WP_000780361.1|1670964_1671501_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001275519.1|1671502_1672732_+	MFS transporter	NA	NA	NA	NA	NA
WP_001045791.1|1672795_1673353_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000614096.1|1673455_1674403_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	31.8	2.8e-26
>prophage 124
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1687198	1688317	5271029		Hokovirus(100.0%)	1	NA	NA
WP_002157242.1|1687198_1688317_+	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	24.6	1.9e-10
>prophage 125
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1698556	1700834	5271029		Bacillus_phage(50.0%)	5	NA	NA
WP_000101489.1|1698556_1699219_+	hypothetical protein	NA	A0A0E3X9J2	Bacillus_phage	58.1	9.4e-05
WP_000456537.1|1699223_1699391_-	DUF3930 family protein	NA	NA	NA	NA	NA
WP_000658451.1|1699540_1699720_+	YozD family protein	NA	NA	NA	NA	NA
WP_000473370.1|1699830_1700013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872036.1|1700012_1700834_+	protein kinase	NA	A0A2I2L395	Orpheovirus	32.7	6.0e-09
>prophage 126
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1703837	1711965	5271029	integrase	Bacillus_phage(75.0%)	10	1702261:1702277	1704641:1704657
1702261:1702277	attL	ATTAAAAAAGAACCTAT	NA	NA	NA	NA
WP_073806392.1|1703837_1704317_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	52.0	3.3e-28
WP_000459261.1|1704382_1704841_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
1704641:1704657	attR	ATTAAAAAAGAACCTAT	NA	NA	NA	NA
WP_000249923.1|1704862_1706068_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	47.4	1.4e-51
WP_000669607.1|1706249_1707401_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000637732.1|1708745_1709210_-	restriction endonuclease	NA	Q331T5	Clostridium_botulinum_C_phage	43.2	7.0e-15
WP_000649834.1|1709246_1709447_-	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	76.6	9.0e-20
WP_001267640.1|1709612_1709915_+	hypothetical protein	NA	A0A288WG38	Bacillus_phage	51.5	2.4e-24
WP_000156981.1|1709911_1710094_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	80.0	4.1e-19
WP_000571536.1|1710212_1711403_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.1	3.1e-147
WP_009879021.1|1711380_1711965_+	replication-relaxation family protein	NA	A0A288WFQ7	Bacillus_phage	77.0	1.9e-81
>prophage 127
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1717109	1718242	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000520721.1|1717109_1717382_+	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	67.8	1.9e-28
WP_000443219.1|1717502_1717640_-	DUF3956 family protein	NA	NA	NA	NA	NA
WP_000464537.1|1717843_1718242_+	CHRD domain-containing protein	NA	A0A2K9L200	Tupanvirus	38.3	6.6e-14
>prophage 128
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1724158	1725702	5271029		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001141565.1|1724158_1724374_-	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	79.4	1.7e-24
WP_001066870.1|1724583_1724919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990236.1|1725217_1725430_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	52.2	4.3e-12
WP_000970364.1|1725492_1725702_-	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	48.3	5.4e-07
>prophage 129
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1755284	1762442	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_001133946.1|1755284_1762442_+	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	27.7	1.3e-99
>prophage 130
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1765503	1768569	5271029		Bacillus_phage(100.0%)	4	NA	NA
WP_001043907.1|1765503_1765776_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	2.7e-27
WP_000577263.1|1765980_1766748_+	DUF3891 family protein	NA	NA	NA	NA	NA
WP_000666432.1|1766762_1767287_+	DinB family protein	NA	NA	NA	NA	NA
WP_000790944.1|1767375_1768569_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	75.1	1.7e-166
>prophage 131
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1774047	1776988	5271029	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_000663074.1|1774047_1775967_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	41.5	3.9e-144
WP_000106419.1|1776220_1776988_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.6e-32
>prophage 132
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1792515	1793166	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000668555.1|1792515_1793166_+	type A chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	52.1	2.7e-65
>prophage 133
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1799385	1802760	5271029		Phaeocystis_globosa_virus(50.0%)	5	NA	NA
WP_042631227.1|1799385_1800786_+	protoporphyrinogen oxidase	NA	R4THQ7	Phaeocystis_globosa_virus	32.0	8.9e-05
WP_000275228.1|1800846_1801395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885377.1|1801693_1802245_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000286198.1|1802284_1802470_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000176368.1|1802556_1802760_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	1.5e-17
>prophage 134
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1818846	1823731	5271029		Bacillus_phage(100.0%)	4	NA	NA
WP_000834768.1|1818846_1820601_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	4.5e-46
WP_001243527.1|1820593_1822390_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	6.4e-56
WP_000774126.1|1822497_1822758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135272.1|1822993_1823731_+	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	74.6	6.4e-103
>prophage 135
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1830865	1832254	5271029		Salmonella_phage(100.0%)	1	NA	NA
WP_001209445.1|1830865_1832254_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	35.3	1.5e-12
>prophage 136
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1835527	1836112	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000380330.1|1835527_1836112_+	class I SAM-dependent methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	32.5	7.7e-11
>prophage 137
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1852145	1853498	5271029		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001983287.1|1852145_1853498_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	6.7e-58
>prophage 138
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1860399	1861161	5271029		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000721684.1|1860399_1861161_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.1	3.6e-08
>prophage 139
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1877896	1880650	5271029		Salmonella_phage(50.0%)	3	NA	NA
WP_080000600.1|1877896_1878835_+	class A beta-lactamase Bla1	NA	A0A1B0VBP7	Salmonella_phage	44.4	6.1e-58
WP_001107043.1|1878894_1879440_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_000805139.1|1879648_1880650_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.8	4.0e-23
>prophage 140
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1895055	1896156	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000217988.1|1895055_1896156_-	RapH N-terminal domain-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.3	7.6e-84
>prophage 141
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1900493	1909642	5271029		Exiguobacterium_phage(33.33%)	5	NA	NA
WP_000791597.1|1900493_1901726_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0U4JE28	Exiguobacterium_phage	35.8	2.8e-18
WP_000709377.1|1902030_1903269_+	leukocidin/hemolysin toxin family protein	NA	NA	NA	NA	NA
WP_000520494.1|1903676_1904282_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061782.1|1904423_1905902_-	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.2	2.1e-28
WP_001225577.1|1906912_1909642_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.3	1.9e-11
>prophage 142
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1915621	1916347	5271029		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_001187083.1|1915621_1916347_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	2.0e-24
>prophage 143
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1922632	1927871	5271029		Klosneuvirus(50.0%)	4	NA	NA
WP_000775424.1|1922632_1923544_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.1	6.8e-38
WP_000939785.1|1923548_1924337_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000566963.1|1924339_1925881_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_000806467.1|1925930_1927871_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.4	3.7e-65
>prophage 144
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1930894	1933935	5271029		Bacillus_phage(66.67%)	3	NA	NA
WP_001160082.1|1930894_1931911_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.4	3.0e-18
WP_001243300.1|1932092_1933250_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	2.7e-31
WP_001038813.1|1933239_1933935_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.5	7.0e-43
>prophage 145
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1944245	1947945	5271029		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000786162.1|1944245_1945691_+	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	24.7	1.0e-11
WP_000472602.1|1945812_1946622_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767284.1|1946718_1947945_-	MFS transporter	NA	D0R099	Streptococcus_phage	21.0	4.7e-10
>prophage 146
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1954551	1955922	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000280097.1|1954551_1955922_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	42.3	1.7e-72
>prophage 147
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	1961539	2025543	5271029	head,integrase,terminase,portal,capsid,protease,tRNA,tail	Bacillus_phage(73.81%)	72	1957970:1957995	2005565:2005590
1957970:1957995	attL	GCATCCATTCGGGTGCTTTTTATTTT	NA	NA	NA	NA
WP_000558638.1|1961539_1963093_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128411.1|1963152_1963581_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285681.1|1963732_1964644_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238981.1|1964773_1965481_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000620169.1|1965477_1966461_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000376262.1|1966763_1967390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033688508.1|1967933_1969562_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	1.6e-53
WP_002036414.1|1969571_1970165_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000469929.1|1970549_1971086_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000404285.1|1971399_1972170_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	4.3e-33
WP_000144187.1|1972144_1974076_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000831676.1|1974143_1974812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165506.1|1974888_1975215_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517037.1|1975468_1976710_+	lipase	NA	NA	NA	NA	NA
WP_000695920.1|1976797_1977841_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471625.1|1977962_1979411_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001982146.1|1979415_1980330_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000144491.1|1980631_1981321_+	thiaminase II	NA	NA	NA	NA	NA
WP_001982105.1|1981514_1981976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099235.1|1982544_1982709_+	hypothetical protein	NA	A0A1B1P7C5	Bacillus_phage	85.2	5.9e-17
WP_001148160.1|1982792_1983005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000437061.1|1983177_1983384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796386.1|1984031_1984496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413152.1|1985076_1985748_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675849.1|1985816_1986926_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	1.8e-149
WP_001197705.1|1987686_1988883_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.8	1.5e-80
WP_000791796.1|1988909_1989065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000367270.1|1989328_1989679_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	37.9	4.8e-16
WP_001192728.1|1989865_1990090_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	45.1	3.6e-09
WP_000522183.1|1990130_1990397_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	72.9	2.0e-27
WP_000390253.1|1990396_1990561_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	63.0	1.0e-13
WP_001048905.1|1990590_1990767_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	86.2	9.4e-21
WP_000190242.1|1990771_1991491_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	85.9	5.8e-93
WP_033687866.1|1991459_1992263_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	97.7	1.6e-144
WP_000332469.1|1992277_1992472_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	84.4	2.6e-24
WP_000805173.1|1992497_1992671_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	96.5	1.1e-24
WP_000811853.1|1992685_1992940_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	5.5e-38
WP_000885286.1|1992951_1993377_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	41.9	4.2e-14
WP_000646514.1|1993392_1993848_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.2	1.9e-20
WP_000649313.1|1993890_1994187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456896.1|1994225_1994828_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	4.6e-43
WP_033688511.1|1996488_1996737_+	DUF3947 family protein	NA	NA	NA	NA	NA
WP_001164498.1|1997019_1997592_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	84.7	3.1e-89
WP_157404513.1|1998097_1998244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002036424.1|2000287_2000554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682210.1|2000638_2000938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398983.1|2001284_2001458_+	hypothetical protein	NA	A0A1B1P875	Bacillus_phage	89.5	9.8e-23
WP_000803282.1|2001475_2001598_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000866161.1|2001714_2001885_+	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	82.1	1.0e-08
WP_000166181.1|2001912_2002395_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.1e-71
WP_001012119.1|2002394_2002937_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	89.4	3.1e-86
WP_001170291.1|2003150_2004101_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001104804.1|2004496_2005219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778967.1|2005702_2005930_+	hypothetical protein	NA	D2XR60	Bacillus_phage	91.2	2.1e-28
2005565:2005590	attR	GCATCCATTCGGGTGCTTTTTATTTT	NA	NA	NA	NA
WP_000666395.1|2005916_2006252_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	92.8	1.9e-54
WP_000301144.1|2006377_2006689_+|terminase	P27 family phage terminase small subunit	terminase	D2XR14	Bacillus_phage	96.1	8.8e-46
WP_000621028.1|2006685_2008353_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	91.4	4.1e-307
WP_033687868.1|2008361_2009507_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.6	6.9e-181
WP_000401406.1|2009506_2010250_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	97.2	1.6e-130
WP_000234871.1|2010253_2011408_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	92.2	1.6e-201
WP_000447741.1|2011413_2011707_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	88.7	2.2e-43
WP_001247276.1|2011708_2012062_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	6.6e-58
WP_000997570.1|2012063_2012405_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	89.3	1.7e-50
WP_000172082.1|2012404_2012734_+	hypothetical protein	NA	D2XR22	Bacillus_phage	91.7	3.3e-51
WP_001004912.1|2012734_2013322_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.6	1.3e-87
WP_000415926.1|2013328_2013685_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	5.7e-41
WP_000918779.1|2013915_2017548_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.8	3.4e-189
WP_000094100.1|2017589_2019074_+|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	78.7	4.4e-236
WP_001260148.1|2019070_2023915_+|tail	phage tail protein	tail	I7ILV8	Bacillus_phage	44.6	0.0e+00
WP_000398737.1|2024006_2024243_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	2.2e-17
WP_000461726.1|2024242_2024482_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	1.1e-32
WP_000753428.1|2024478_2025543_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	96.3	1.1e-199
>prophage 148
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2037371	2038004	5271029		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001069233.1|2037371_2038004_+	Vat family streptogramin A O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.5	4.3e-23
>prophage 149
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2046854	2055438	5271029		Cryptophlebia_leucotreta_granulosis_virus(25.0%)	9	NA	NA
WP_000932132.1|2046854_2048033_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	23.5	1.2e-05
WP_000864381.1|2048082_2048763_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038224.1|2049172_2049721_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001182474.1|2049731_2051432_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	7.0e-12
WP_000282899.1|2051424_2052225_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2052360_2052468_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001012259.1|2052560_2053829_-	sensor histidine kinase	NA	A0A1B1IUJ1	uncultured_Mediterranean_phage	32.4	3.0e-07
WP_000651943.1|2053916_2054798_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000437680.1|2054925_2055438_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.8	4.4e-18
>prophage 150
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2061796	2062819	5271029		Mycobacterium_virus(100.0%)	1	NA	NA
WP_002037531.1|2061796_2062819_+	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	21.9	2.7e-11
>prophage 151
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2066876	2067839	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_001124134.1|2066876_2067839_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.2	6.1e-13
>prophage 152
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2070960	2072127	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000845175.1|2070960_2072127_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.3	8.2e-20
>prophage 153
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2077996	2078860	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000725552.1|2077996_2078860_+	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	39.3	2.1e-33
>prophage 154
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2085026	2085365	5271029		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_001160780.1|2085026_2085365_+	divalent cation tolerance protein CutA	NA	A0A1S5V250	Saudi_moumouvirus	35.0	1.5e-14
>prophage 155
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2093005	2097141	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_001242967.1|2093005_2093944_+	hypothetical protein	NA	A0A0E3D9P2	Bacillus_phage	53.5	2.6e-69
WP_000731520.1|2094904_2095867_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001165392.1|2096163_2097141_+	endonuclease	NA	A0A0K2CNR4	Brevibacillus_phage	30.4	1.7e-15
>prophage 156
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2104227	2104605	5271029		Microbacterium_phage(100.0%)	1	NA	NA
WP_000522463.1|2104227_2104605_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	35.1	1.6e-09
>prophage 157
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2117477	2117981	5271029		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001058773.1|2117477_2117981_-	mep operon protein MepB	NA	A0A2H4UW84	Bodo_saltans_virus	38.9	6.6e-19
>prophage 158
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2122555	2132151	5271029		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000857933.1|2122555_2123512_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	31.2	6.1e-29
WP_000164813.1|2123630_2125085_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000547612.1|2125140_2132151_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	2.3e-157
>prophage 159
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2145451	2146885	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706754.1|2145451_2146885_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	7.4e-23
>prophage 160
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2155046	2155808	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_001249062.1|2155046_2155808_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	38.2	2.4e-20
>prophage 161
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2168703	2170083	5271029		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000041201.1|2168703_2170083_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	2.1e-51
>prophage 162
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2180081	2195671	5271029		Geobacillus_phage(20.0%)	20	NA	NA
WP_000370609.1|2180081_2181287_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.7	1.5e-29
WP_001227634.1|2181458_2182316_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000991625.1|2182361_2182943_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	50.0	3.9e-47
WP_000337490.1|2182964_2183651_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_001125378.1|2183794_2184115_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_000364536.1|2184119_2184782_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_000545576.1|2184889_2185324_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001065248.1|2185454_2186822_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.6	3.3e-20
WP_000124903.1|2187179_2188373_-	glycosyl transferase family 1	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	26.9	6.2e-07
WP_001982255.1|2188457_2189102_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	40.3	5.3e-29
WP_001226297.1|2189167_2189686_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.2	6.8e-43
WP_001093446.1|2189895_2190282_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655495.1|2190347_2191055_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	6.1e-18
WP_001034777.1|2191076_2191214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218991.1|2191319_2192123_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000994641.1|2192198_2192534_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288948.1|2192546_2192951_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714665.1|2193198_2194584_+	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.5	7.8e-78
WP_000820164.1|2194586_2194799_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	1.9e-12
WP_000540637.1|2194864_2195671_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	68.9	2.1e-107
>prophage 163
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2200067	2206841	5271029	protease	Bodo_saltans_virus(50.0%)	5	NA	NA
WP_001059506.1|2200067_2202137_-	UvrD-helicase domain-containing protein	NA	A0A2H4UW05	Bodo_saltans_virus	25.3	3.1e-14
WP_000125195.1|2202500_2203367_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001004301.1|2203386_2204130_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000274895.1|2204314_2204698_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000494283.1|2204723_2206841_-	DNA helicase RecQ	NA	A0A1V0SDA9	Indivirus	32.1	2.1e-82
>prophage 164
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2215004	2215670	5271029		Apis_mellifera_filamentous_virus(100.0%)	1	NA	NA
WP_000850061.1|2215004_2215670_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	42.4	2.1e-28
>prophage 165
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2235301	2236303	5271029		Clostridium_phage(100.0%)	1	NA	NA
WP_000755450.1|2235301_2236303_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	46.0	4.3e-25
>prophage 166
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2243797	2245814	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_001037277.1|2243797_2245174_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.1e-14
WP_000865971.1|2245166_2245814_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	6.5e-35
>prophage 167
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2252939	2253080	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000566789.1|2252939_2253080_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	65.7	9.8e-05
>prophage 168
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2276978	2277851	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000560935.1|2276978_2277851_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	3.3e-13
>prophage 169
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2286704	2287460	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000218627.1|2286704_2287460_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.5	1.9e-33
>prophage 170
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2292717	2293515	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_140157313.1|2292717_2293515_-	BA2930 family N-acetyltransferase	NA	O64018	Bacillus_phage	54.2	8.8e-82
>prophage 171
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2303276	2308123	5271029		Pseudomonas_phage(33.33%)	3	NA	NA
WP_000346934.1|2303276_2303948_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	40.2	1.8e-27
WP_000808762.1|2304007_2305981_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.3	2.5e-138
WP_000633862.1|2306497_2308123_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.9	3.0e-52
>prophage 172
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2317734	2321387	5271029		Pacmanvirus(33.33%)	3	NA	NA
WP_001197258.1|2317734_2318835_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.1	1.5e-23
WP_001269434.1|2318853_2320026_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.2	2.9e-41
WP_001273582.1|2320310_2321387_-	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	8.1e-14
>prophage 173
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2327014	2330002	5271029		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000898755.1|2327014_2327548_-	acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	43.7	1.3e-41
WP_000387600.1|2327561_2327867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070094.1|2327968_2328484_+	kinase	NA	NA	NA	NA	NA
WP_000755670.1|2328535_2330002_-	SH3 domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	73.0	6.6e-35
>prophage 174
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2333381	2334986	5271029		Hepacivirus(100.0%)	1	NA	NA
WP_000892287.1|2333381_2334986_-	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	23.8	3.1e-33
>prophage 175
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2343275	2344757	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000426489.1|2343275_2344757_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	2.9e-22
>prophage 176
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2356733	2362392	5271029	transposase	Streptococcus_phage(75.0%)	5	NA	NA
WP_001006634.1|2356733_2357981_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	51.4	8.8e-105
WP_000744740.1|2358010_2359114_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.4	8.2e-70
WP_000360702.1|2359812_2360631_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.3	2.0e-33
WP_000239256.1|2361196_2361517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_131371395.1|2361486_2362392_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.8	1.2e-26
>prophage 177
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2368494	2370988	5271029		Bacillus_phage(50.0%)	2	NA	NA
WP_000916226.1|2368494_2369682_-	RNA-splicing ligase RtcB	NA	A0A222Z820	Bacillus_phage	79.4	5.9e-183
WP_000171468.1|2369956_2370988_-	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	28.9	3.5e-30
>prophage 178
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2384561	2386019	5271029		Burkholderia_virus(100.0%)	1	NA	NA
WP_001186941.1|2384561_2386019_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.2	2.8e-62
>prophage 179
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2394723	2401647	5271029		Klosneuvirus(33.33%)	5	NA	NA
WP_001286481.1|2394723_2395941_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.8	4.2e-27
WP_000504442.1|2396212_2397592_+	catalase	NA	A0A2K9L572	Tupanvirus	39.5	3.4e-73
WP_000723230.1|2397715_2398243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000531399.1|2398356_2400111_-	adenine deaminase	NA	NA	NA	NA	NA
WP_000747156.1|2400480_2401647_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	29.1	5.5e-24
>prophage 180
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2405656	2407600	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000207834.1|2405656_2407600_+	tetracycline resistance ribosomal protection protein	NA	A0A1B0RXH7	Streptococcus_phage	37.0	4.0e-112
>prophage 181
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2412656	2414213	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000710830.1|2412656_2414213_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	6.2e-39
>prophage 182
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2432476	2436084	5271029		Bacillus_virus(50.0%)	4	NA	NA
WP_000432461.1|2432476_2433349_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	3.6e-12
WP_001167463.1|2433336_2433726_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000697736.1|2434204_2435227_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000522868.1|2435412_2436084_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	2.8e-33
>prophage 183
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2445545	2445860	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000358169.1|2445545_2445860_-	DUF3892 domain-containing protein	NA	G3MB34	Bacillus_virus	38.3	3.4e-05
>prophage 184
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2464748	2466296	5271029	transposase	Campylobacter_virus(100.0%)	1	NA	NA
WP_000859088.1|2464748_2466296_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	26.9	2.7e-10
>prophage 185
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2485106	2487713	5271029		Hokovirus(100.0%)	1	NA	NA
WP_000094201.1|2485106_2487713_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	6.3e-44
>prophage 186
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2495242	2498645	5271029		Bacillus_phage(66.67%)	5	NA	NA
WP_000069660.1|2495242_2495455_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	1.6e-14
WP_000680271.1|2495729_2496206_+	YndM family protein	NA	NA	NA	NA	NA
WP_000512133.1|2496241_2496757_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_000002841.1|2497051_2497264_-	small acid-soluble spore protein, SasP family	NA	A0A217EQS5	Bacillus_phage	63.8	7.1e-15
WP_000649079.1|2497511_2498645_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.8	2.5e-13
>prophage 187
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2502540	2504103	5271029	transposase	Listeria_phage(50.0%)	3	NA	NA
WP_000893556.1|2502540_2502918_+	HTH-type transcriptional regulator AnsR	NA	A8ATJ9	Listeria_phage	36.7	5.0e-11
WP_000028487.1|2503231_2503363_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001292173.1|2503461_2504103_-	hypothetical protein	NA	D2XPX7	Bacillus_virus	47.5	4.6e-57
>prophage 188
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2507508	2508327	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_001041308.1|2507508_2508327_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.0	5.3e-34
>prophage 189
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2523911	2526501	5271029		Tupanvirus(50.0%)	2	NA	NA
WP_000829759.1|2523911_2525552_-	catalase	NA	A0A2K9L572	Tupanvirus	45.4	2.5e-99
WP_001074318.1|2525664_2526501_-	bromoperoxidase	NA	R4JMP9	Mycobacterium_phage	26.6	3.1e-13
>prophage 190
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2534404	2535430	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000839428.1|2534404_2535430_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	41.4	3.1e-71
>prophage 191
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2538515	2539946	5271029		Hokovirus(100.0%)	1	NA	NA
WP_001179957.1|2538515_2539946_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.9	3.2e-58
>prophage 192
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2546419	2546974	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000054743.1|2546419_2546974_+	streptothricin N-acetyltransferase SatA	NA	E4ZFP7	Streptococcus_phage	47.7	7.6e-24
>prophage 193
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2553551	2553956	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000428348.1|2553551_2553956_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	71.4	7.1e-48
>prophage 194
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2559700	2560363	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000354604.1|2559700_2560363_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.3	2.2e-38
>prophage 195
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2564947	2565712	5271029		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000792665.1|2564947_2565712_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	1.2e-19
>prophage 196
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2574695	2584618	5271029	transposase	Mycobacterium_phage(66.67%)	8	NA	NA
WP_000428446.1|2574695_2576771_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	27.4	3.7e-07
WP_001982172.1|2577593_2577752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239256.1|2577854_2578175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_131371395.1|2578144_2579050_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.8	1.2e-26
WP_000323761.1|2579520_2579826_-	monooxygenase	NA	NA	NA	NA	NA
WP_000153831.1|2580043_2580394_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001048553.1|2580718_2581138_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000359077.1|2581420_2584618_-	bifunctional P-450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	37.4	7.3e-79
>prophage 197
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2589821	2591866	5271029		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_001264530.1|2589821_2590496_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	33.3	1.1e-08
WP_000826694.1|2590492_2591866_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	5.8e-25
>prophage 198
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2598851	2600369	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_033687942.1|2598851_2600369_-	serine hydrolase	NA	G8IDB2	Mycobacterium_phage	31.0	2.5e-13
>prophage 199
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2613373	2614045	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000202585.1|2613373_2614045_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	4.7e-36
>prophage 200
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2617422	2620470	5271029		Bacillus_phage(66.67%)	3	NA	NA
WP_000839510.1|2617422_2618799_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	40.3	2.2e-56
WP_000781977.1|2618800_2619478_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	53.0	5.9e-63
WP_000747495.1|2619630_2620470_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.8	1.4e-42
>prophage 201
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2636373	2637489	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000116967.1|2636373_2637489_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.4	1.3e-107
>prophage 202
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2640723	2644823	5271029		Bacillus_phage(25.0%)	4	NA	NA
WP_000272550.1|2640723_2641989_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.9	3.4e-104
WP_001057779.1|2641985_2642327_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	40.0	4.7e-08
WP_001161885.1|2642370_2642745_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.1	3.4e-28
WP_000472742.1|2642840_2644823_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.4	4.2e-16
>prophage 203
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2662687	2664955	5271029		Streptococcus_phage(100.0%)	2	NA	NA
WP_000490247.1|2662687_2663860_-	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	50.9	1.9e-109
WP_001982232.1|2663872_2664955_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	53.3	1.0e-104
>prophage 204
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2676814	2679572	5271029		Geobacillus_virus(50.0%)	2	NA	NA
WP_000312112.1|2676814_2677558_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	42.4	1.7e-47
WP_001022201.1|2677796_2679572_-	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	40.5	8.0e-43
>prophage 205
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2686341	2687259	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002036736.1|2686341_2687259_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.3	5.3e-06
>prophage 206
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2699645	2701307	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_033687968.1|2699645_2701307_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.4	7.3e-22
>prophage 207
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2712035	2722414	5271029	tRNA	Pseudomonas_phage(40.0%)	8	NA	NA
WP_000659143.1|2712035_2713160_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	44.2	3.2e-05
WP_001097732.1|2713518_2715165_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	6.4e-79
WP_000366927.1|2715908_2716382_-	HIT family protein	NA	NA	NA	NA	NA
WP_000286237.1|2716406_2716895_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_001097732.1|2717115_2718762_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	6.4e-79
WP_000710854.1|2719846_2720323_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000425975.1|2720663_2721941_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	30.4	3.5e-40
WP_001100385.1|2722102_2722414_+	hypothetical protein	NA	A0A0M4R382	Bacillus_phage	34.8	5.6e-08
>prophage 208
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2729670	2730396	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000570195.1|2729670_2730396_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.9	2.1e-13
>prophage 209
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2744159	2744918	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000005814.1|2744159_2744918_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	1.1e-30
>prophage 210
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2765196	2773436	5271029		Synechococcus_phage(50.0%)	8	NA	NA
WP_000667676.1|2765196_2765865_-	fructose-6-phosphate aldolase	NA	A0A0E3HNZ3	Synechococcus_phage	47.5	3.7e-49
WP_001195906.1|2765916_2766810_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	36.9	2.2e-57
WP_000193020.1|2766914_2768909_-	transketolase	NA	NA	NA	NA	NA
WP_000445343.1|2768948_2770433_-	glucose-6-phosphate dehydrogenase	NA	M4QQY0	Cyanophage	36.6	4.6e-76
WP_080773572.1|2770783_2770951_-	glucose-6-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_015945647.1|2770902_2771052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410342.1|2771065_2772019_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_000647232.1|2772440_2773436_+	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	27.4	7.5e-06
>prophage 211
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2776929	2779158	5271029		Lonomia_obliqua_multiple_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_000826234.1|2776929_2779158_-	enhancin	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.1	1.0e-34
>prophage 212
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2791212	2792385	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_000229052.1|2791212_2792385_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L0U7	Tupanvirus	37.2	4.8e-52
>prophage 213
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2801690	2803907	5271029		Planktothrix_phage(50.0%)	2	NA	NA
WP_000985519.1|2801690_2802239_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	32.4	4.3e-11
WP_001259969.1|2802404_2803907_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	9.5e-37
>prophage 214
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2818627	2819389	5271029		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000072129.1|2818627_2819389_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.8	2.6e-27
>prophage 215
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2826257	2827295	5271029		Mycobacterium_virus(100.0%)	1	NA	NA
WP_000769747.1|2826257_2827295_+	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	23.6	2.7e-06
>prophage 216
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2836176	2838575	5271029		Salmonella_phage(50.0%)	3	NA	NA
WP_000758004.1|2836176_2837376_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.8	2.4e-22
WP_000570025.1|2837740_2838307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390469.1|2838350_2838575_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	86.5	1.2e-25
>prophage 217
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2846536	2847571	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000902706.1|2846536_2847571_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.4e-16
>prophage 218
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2857675	2860108	5271029		Bacillus_phage(50.0%)	2	NA	NA
WP_000628696.1|2857675_2858200_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	65.9	2.7e-55
WP_001095168.1|2858206_2860108_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	24.9	4.4e-15
>prophage 219
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2866100	2867234	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000915215.1|2866100_2867234_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.5	7.4e-18
>prophage 220
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2871319	2872264	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001226323.1|2871319_2872264_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	34.3	4.1e-38
>prophage 221
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2878615	2882951	5271029	protease	Microcystis_phage(33.33%)	5	NA	NA
WP_000164883.1|2878615_2880082_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.1e-44
WP_001102724.1|2880336_2881431_+	RapH N-terminal domain-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	62.5	1.2e-121
WP_000592015.1|2881427_2881616_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000275806.1|2881689_2882289_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_000813610.1|2882423_2882951_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	33.3	4.5e-18
>prophage 222
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2887606	2893656	5271029		Sinorhizobium_phage(50.0%)	4	NA	NA
WP_000426884.1|2887606_2888947_-	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	25.8	2.3e-05
WP_001084180.1|2889391_2889958_-	acyltransferase	NA	NA	NA	NA	NA
WP_001084739.1|2889950_2891081_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000064846.1|2891100_2893656_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.2e-10
>prophage 223
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2898048	2898726	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000115703.1|2898048_2898726_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.8	1.6e-20
>prophage 224
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2905379	2910441	5271029		Bacillus_virus(25.0%)	8	NA	NA
WP_000426505.1|2905379_2906225_-	exonuclease	NA	G3MBN3	Bacillus_virus	27.6	1.4e-13
WP_001179150.1|2906414_2906615_-	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	64.6	5.0e-18
WP_000449516.1|2906831_2907731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062763.1|2907747_2908191_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.1	3.8e-10
WP_000070938.1|2908332_2908953_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000620846.1|2909039_2909435_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_001268363.1|2909431_2909773_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000966324.1|2909883_2910441_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.7	4.4e-40
>prophage 225
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2967912	2982330	5271029		Bacillus_phage(28.57%)	13	NA	NA
WP_002036859.1|2967912_2968338_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	44.1	2.3e-12
WP_000349666.1|2968546_2968918_-	VOC family protein	NA	NA	NA	NA	NA
WP_001041454.1|2968968_2969775_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000626603.1|2969767_2970661_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	3.0e-22
WP_002036855.1|2970816_2971419_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000719760.1|2971442_2972474_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001147474.1|2972625_2975049_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.2	1.3e-99
WP_001062207.1|2975050_2977015_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.9	4.8e-129
WP_000151390.1|2977390_2977804_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000542634.1|2977883_2979125_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001044683.1|2979327_2980005_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	3.2e-40
WP_000867062.1|2980024_2980477_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	51.7	2.2e-37
WP_000939611.1|2980473_2982330_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	45.4	1.7e-160
>prophage 226
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2986187	2990006	5271029		Clostridium_phage(50.0%)	4	NA	NA
WP_000526926.1|2986187_2987135_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	39.0	1.1e-51
WP_000269072.1|2987250_2987826_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001083881.1|2988075_2988333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666353.1|2988356_2990006_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.9	8.0e-29
>prophage 227
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	2997287	3000972	5271029		Paenibacillus_phage(50.0%)	4	NA	NA
WP_000432574.1|2997287_2997731_-	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	33.7	8.8e-07
WP_001247878.1|2997835_2998417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077980.1|2998424_2999516_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_000513163.1|2999508_3000972_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	1.0e-27
>prophage 228
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3008707	3009160	5271029		uncultured_marine_virus(100.0%)	1	NA	NA
WP_000402953.1|3008707_3009160_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0F7LBB1	uncultured_marine_virus	39.5	6.6e-10
>prophage 229
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3024816	3026334	5271029		Catovirus(100.0%)	1	NA	NA
WP_000631847.1|3024816_3026334_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.8	1.5e-101
>prophage 230
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3043476	3044388	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000180642.1|3043476_3044388_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.3e-40
>prophage 231
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3049640	3056809	5271029		Bacillus_phage(50.0%)	5	NA	NA
WP_001983578.1|3049640_3051368_-	S-layer homology domain-containing protein	NA	Q9ZXD7	Bacillus_phage	55.0	6.2e-40
WP_075395428.1|3051583_3052150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000386801.1|3052156_3053176_-	NERD domain-containing protein	NA	A0A1L2JY40	Aeribacillus_phage	27.5	1.9e-25
WP_000136731.1|3053294_3055058_-	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	23.2	1.9e-15
WP_000862474.1|3055057_3056809_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	1.1e-47
>prophage 232
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3060229	3064008	5271029		Streptococcus_phage(50.0%)	4	NA	NA
WP_000166240.1|3060229_3061342_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	44.7	2.0e-79
WP_000047908.1|3061640_3062444_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_001000752.1|3062443_3063238_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_000569256.1|3063234_3064008_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.6e-11
>prophage 233
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3067921	3075377	5271029	terminase	Phage_Wrath(40.0%)	9	NA	NA
WP_000413738.1|3067921_3068542_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976115.1|3068629_3069436_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000032391.1|3069436_3069979_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102618.1|3069971_3070295_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001983518.1|3070979_3071162_+	hypothetical protein	NA	A0A1B2APY5	Phage_Wrath	84.4	3.6e-07
WP_017561975.1|3071285_3072002_+	hypothetical protein	NA	D2XR34	Bacillus_phage	92.6	1.1e-35
WP_001983561.1|3072224_3073265_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	42.8	1.4e-18
WP_000534160.1|3073282_3073591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002036934.1|3073652_3075377_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	70.0	2.4e-209
>prophage 234
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3080895	3081852	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000438185.1|3080895_3081852_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	44.0	6.0e-53
>prophage 235
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3088598	3089531	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000734623.1|3088598_3089531_-	3D domain-containing protein	NA	A7KV71	Bacillus_phage	72.5	2.7e-34
>prophage 236
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3101249	3107360	5271029		Bacillus_phage(33.33%)	7	NA	NA
WP_001043904.1|3101249_3101522_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	74.4	6.1e-27
WP_001005303.1|3101633_3104051_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.2	4.1e-122
WP_000436976.1|3104146_3104353_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000349636.1|3104541_3104844_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_000849096.1|3105135_3105363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001098332.1|3105694_3106522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000025770.1|3106538_3107360_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	1.6e-14
>prophage 237
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3110689	3112710	5271029		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_000668831.1|3110689_3111448_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.7	2.3e-63
WP_000551309.1|3111602_3112199_+	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_001089816.1|3112179_3112710_+	methylated-DNA--protein-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	48.2	2.8e-15
>prophage 238
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3131736	3136523	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000771018.1|3131736_3132534_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.0	4.7e-35
WP_000272384.1|3132797_3134135_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791049.1|3134603_3136523_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.9	1.4e-96
>prophage 239
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3140374	3146248	5271029		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000337572.1|3140374_3141361_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	32.6	2.7e-32
WP_000516476.1|3141617_3143561_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	7.6e-63
WP_000196014.1|3143569_3146248_-	DNA mismatch repair protein MutS	NA	A0A2P0VN50	Tetraselmis_virus	21.9	1.8e-33
>prophage 240
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3153310	3153571	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000404341.1|3153310_3153571_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
>prophage 241
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3156724	3157150	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_001115374.1|3156724_3157150_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	70.5	2.7e-45
>prophage 242
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3163127	3174343	5271029		Bodo_saltans_virus(20.0%)	8	NA	NA
WP_000411952.1|3163127_3164414_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.4	2.2e-10
WP_000772436.1|3164414_3165689_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.6	2.9e-55
WP_000008843.1|3165887_3166847_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001074497.1|3166847_3167906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456939.1|3167898_3169431_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.4e-11
WP_000730595.1|3169539_3170607_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	35.1	1.1e-50
WP_000114176.1|3170696_3171422_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118783.1|3171961_3174343_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
>prophage 243
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3183537	3184779	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000592985.1|3183537_3184779_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.2	1.3e-55
>prophage 244
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3188585	3200150	5271029	tRNA	Indivirus(33.33%)	10	NA	NA
WP_000766711.1|3188585_3189557_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	1.9e-06
WP_000399337.1|3189600_3190524_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776441.1|3190610_3190967_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582364.1|3190982_3191264_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036341.1|3191260_3193321_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	5.0e-20
WP_001286523.1|3193325_3193637_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071128.1|3193637_3193910_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102609.1|3193921_3195028_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359097.1|3195045_3195516_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000059985.1|3195848_3200150_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	38.7	3.1e-24
>prophage 245
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3205332	3206109	5271029		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000971301.1|3205332_3206109_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.8	1.4e-23
>prophage 246
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3210443	3216841	5271029	protease,tRNA	Erwinia_phage(33.33%)	5	NA	NA
WP_000550088.1|3210443_3211835_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.8	2.5e-47
WP_000526272.1|3211857_3212400_-|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_001101227.1|3212442_3213342_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	4.1e-35
WP_001991958.1|3213407_3214712_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_001286969.1|3214762_3216841_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.0	8.6e-105
>prophage 247
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3220218	3220992	5271029		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001174714.1|3220218_3220992_-	ribonuclease HII	NA	V5LS77	Emiliania_huxleyi_virus	43.1	1.3e-18
>prophage 248
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3231632	3233472	5271029		Acanthamoeba_polyphaga_lentillevirus(33.33%)	3	NA	NA
WP_001146873.1|3231632_3232370_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	34.8	3.0e-28
WP_000786062.1|3232428_3232662_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	43.7	7.1e-08
WP_000911782.1|3232731_3233472_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.6e-21
>prophage 249
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3243865	3245839	5271029		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000904759.1|3243865_3245839_-	serine/threonine protein kinase PrkC	NA	A0A2H4UVE2	Bodo_saltans_virus	30.3	5.6e-21
>prophage 250
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3249028	3259132	5271029	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_000598790.1|3249028_3249973_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	1.4e-09
WP_000279468.1|3249996_3250467_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	9.0e-18
WP_000666733.1|3250478_3252884_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000911735.1|3252880_3254086_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	4.9e-44
WP_000933970.1|3254258_3254471_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001257738.1|3254473_3255091_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	37.3	3.8e-24
WP_001251456.1|3255104_3255368_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_000564120.1|3255435_3256311_-	YicC family protein	NA	NA	NA	NA	NA
WP_001104787.1|3256411_3259132_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.2	1.0e-84
>prophage 251
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3265927	3266560	5271029		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000711449.1|3265927_3266560_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	33.1	7.8e-09
>prophage 252
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3272162	3282511	5271029	tRNA	Halovirus(25.0%)	9	NA	NA
WP_000828679.1|3272162_3273260_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.3	3.8e-59
WP_001108379.1|3273256_3274543_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000018857.1|3274526_3275441_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.2	2.9e-28
WP_000435935.1|3275589_3276873_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.6	1.3e-66
WP_001156487.1|3277019_3277562_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000005838.1|3277764_3278673_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000642181.1|3278677_3279136_-	lipoprotein signal peptidase LspA	NA	NA	NA	NA	NA
WP_001004661.1|3279260_3279590_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_000455924.1|3279745_3282511_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	28.0	2.0e-85
>prophage 253
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3287057	3288714	5271029		Bacillus_phage(50.0%)	2	NA	NA
WP_000197753.1|3287057_3287837_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
WP_000976948.1|3287994_3288714_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
>prophage 254
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3310432	3310939	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000246473.1|3310432_3310939_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	1.4e-11
>prophage 255
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3314243	3316861	5271029		Catovirus(50.0%)	3	NA	NA
WP_000662594.1|3314243_3315035_-	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	29.0	4.0e-10
WP_000273102.1|3315148_3316378_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_000200598.1|3316369_3316861_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.9	8.5e-27
>prophage 256
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3320836	3325062	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000735392.1|3320836_3321871_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	34.5	3.4e-17
WP_001160950.1|3322077_3322443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914978.1|3323229_3325062_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	1.7e-32
>prophage 257
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3328343	3330179	5271029		Flavobacterium_phage(100.0%)	1	NA	NA
WP_153576971.1|3328343_3330179_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	1.3e-08
>prophage 258
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3339861	3341190	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000358083.1|3339861_3341190_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	41.6	8.9e-79
>prophage 259
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3352231	3353644	5271029		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000260113.1|3352231_3353644_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	4.7e-46
>prophage 260
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3357934	3358489	5271029		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957056.1|3357934_3358489_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.8	1.4e-17
>prophage 261
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3369017	3372277	5271029		Bacillus_virus(50.0%)	4	NA	NA
WP_000717880.1|3369017_3369254_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	46.1	5.3e-11
WP_001233810.1|3369368_3369857_-	DUF3993 domain-containing protein	NA	NA	NA	NA	NA
WP_000564304.1|3370039_3371257_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000660903.1|3371512_3372277_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	40.2	4.7e-40
>prophage 262
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3387489	3387924	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000811492.1|3387489_3387924_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	56.1	4.7e-37
>prophage 263
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3400884	3401985	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000818946.1|3400884_3401985_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.3	2.0e-20
>prophage 264
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3407807	3408257	5271029		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000540520.1|3407807_3408257_-	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	42.5	4.8e-29
>prophage 265
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3436241	3440873	5271029		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_001214094.1|3436241_3437144_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	37.1	1.4e-40
WP_000376225.1|3437222_3437795_-	segregation/condensation protein ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	1.4e-17
WP_001199758.1|3437953_3438697_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.6	3.2e-09
WP_000510194.1|3438866_3438962_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000283600.1|3439060_3439579_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000908398.1|3439599_3439968_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_000853783.1|3440435_3440873_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.8	1.6e-16
>prophage 266
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3449657	3454014	5271029		Bacillus_phage(50.0%)	6	NA	NA
WP_000350729.1|3449657_3450416_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	58.1	8.9e-68
WP_001243400.1|3450428_3450869_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_000059131.1|3450869_3451220_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_000831985.1|3451390_3452581_-	serine-type D-Ala-D-Ala carboxypeptidase DacF	NA	NA	NA	NA	NA
WP_000548036.1|3452747_3453167_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000922160.1|3453132_3454014_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	6.8e-19
>prophage 267
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3459571	3465085	5271029		Geobacillus_virus(33.33%)	5	NA	NA
WP_001243079.1|3459571_3460876_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.1	3.1e-137
WP_001078446.1|3460883_3461705_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	3.2e-71
WP_001046067.1|3461717_3462902_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_001984077.1|3463307_3464051_-	FixH family protein	NA	NA	NA	NA	NA
WP_000390080.1|3464194_3465085_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	6.9e-43
>prophage 268
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3468132	3469904	5271029		Klosneuvirus(50.0%)	2	NA	NA
WP_000747239.1|3468132_3469047_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.3	9.0e-06
WP_000547997.1|3469076_3469904_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.7	4.7e-70
>prophage 269
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3479578	3483003	5271029		Staphylococcus_phage(100.0%)	4	NA	NA
WP_000131958.1|3479578_3480691_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	41.2	6.7e-64
WP_000493927.1|3480672_3481317_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.6	4.6e-41
WP_000469012.1|3481329_3482523_+	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.3	4.3e-117
WP_000230893.1|3482541_3483003_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.3	3.4e-46
>prophage 270
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3486045	3489315	5271029		Emiliania_huxleyi_virus(50.0%)	3	NA	NA
WP_001075618.1|3486045_3487233_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	5.4e-43
WP_000012484.1|3487198_3487927_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000144314.1|3487926_3489315_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.8	2.7e-17
>prophage 271
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3496891	3499015	5271029		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000108880.1|3496891_3497842_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.4	1.9e-22
WP_000623331.1|3497854_3499015_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	2.8e-28
>prophage 272
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3504424	3505264	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000027272.1|3504424_3505264_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.3	7.7e-28
>prophage 273
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3509200	3510439	5271029		Caldibacillus_phage(100.0%)	1	NA	NA
WP_001208841.1|3509200_3510439_-	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	32.0	4.3e-19
>prophage 274
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3514924	3518915	5271029		Planktothrix_phage(50.0%)	6	NA	NA
WP_000590197.1|3514924_3515647_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.3e-31
WP_001046917.1|3515639_3516299_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000735482.1|3516335_3517115_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001998211.1|3517364_3517778_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000366596.1|3517920_3518328_-	YjdF family protein	NA	NA	NA	NA	NA
WP_001984100.1|3518450_3518915_-	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	40.1	1.8e-26
>prophage 275
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3523962	3525384	5271029		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001051291.1|3523962_3525384_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	1.8e-45
>prophage 276
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3531300	3532029	5271029		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000172562.1|3531300_3532029_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.4	2.6e-16
>prophage 277
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3543462	3545708	5271029		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_000415260.1|3543462_3544821_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	31.2	8.6e-45
WP_000226720.1|3544847_3545708_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.4	1.9e-42
>prophage 278
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3555218	3555797	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_001163839.1|3555218_3555797_+	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	27.0	6.5e-10
>prophage 279
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3560384	3561047	5271029		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000643912.1|3560384_3561047_-	HAD family hydrolase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	30.0	6.1e-12
>prophage 280
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3573276	3579288	5271029		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_000795698.1|3573276_3574752_-	aminomethyl-transferring glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	41.3	4.4e-87
WP_000903231.1|3574748_3576092_-	aminomethyl-transferring glycine dehydrogenase subunit 1	NA	E3SN07	Prochlorococcus_phage	41.2	1.3e-64
WP_000631769.1|3576112_3577213_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_001100022.1|3577605_3579288_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.4	1.2e-56
>prophage 281
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3582437	3583088	5271029		Klosneuvirus(100.0%)	1	NA	NA
WP_000183878.1|3582437_3583088_-	2OG-Fe(II) oxygenase	NA	A0A1V0SIE1	Klosneuvirus	31.5	5.6e-18
>prophage 282
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3589018	3590638	5271029	head,protease	Staphylococcus_phage(100.0%)	1	NA	NA
WP_158319813.1|3589018_3590638_-|head,protease	HK97 family phage prohead protease	head,protease	A0A060AB24	Staphylococcus_phage	48.4	9.3e-38
>prophage 283
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3593887	3597236	5271029		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000086455.1|3593887_3594271_-	HNH endonuclease	NA	A0A060AKD6	Staphylococcus_phage	46.7	3.1e-24
WP_144405020.1|3594267_3594585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232350.1|3594626_3595055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002037027.1|3595097_3595247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857958.1|3595649_3596384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157404514.1|3596432_3596600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000828709.1|3596751_3596997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000141450.1|3596993_3597236_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	46.4	2.3e-09
>prophage 284
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3600984	3602466	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000659015.1|3600984_3602466_-	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	30.6	1.9e-42
>prophage 285
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3609317	3616247	5271029		Dickeya_phage(50.0%)	3	NA	NA
WP_000649714.1|3609317_3612716_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	51.7	4.8e-12
WP_000770331.1|3612715_3614548_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000103885.1|3615134_3616247_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	28.2	2.6e-15
>prophage 286
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3620036	3627665	5271029		Streptococcus_phage(33.33%)	9	NA	NA
WP_000871216.1|3620036_3620666_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.2	5.4e-34
WP_000524853.1|3620836_3621010_+	DUF2759 domain-containing protein	NA	NA	NA	NA	NA
WP_000391706.1|3621089_3622073_-	glucokinase	NA	NA	NA	NA	NA
WP_000253699.1|3622092_3622293_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_001206424.1|3622396_3622975_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_001265616.1|3623079_3623229_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000679305.1|3623298_3625653_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	32.3	4.4e-20
WP_033688599.1|3626027_3626684_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000226683.1|3626849_3627665_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	1.3e-16
>prophage 287
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3634411	3635023	5271029		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_001052031.1|3634411_3635023_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	62.2	4.5e-70
>prophage 288
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3639364	3651839	5271029	tRNA	Anomala_cuprea_entomopoxvirus(16.67%)	12	NA	NA
WP_001059649.1|3639364_3640135_-	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	2.6e-14
WP_000435958.1|3640376_3641255_-	YitT family protein	NA	NA	NA	NA	NA
WP_001048962.1|3641404_3641659_+	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_000912466.1|3641677_3642574_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.0	6.1e-23
WP_000194030.1|3642804_3644115_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.3	4.0e-47
WP_000484153.1|3644295_3645048_+	VrrA protein	NA	NA	NA	NA	NA
WP_000706671.1|3645137_3646091_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_000036214.1|3646128_3647250_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	52.0	6.4e-22
WP_001006552.1|3647246_3647954_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_000828148.1|3648119_3648476_-	cytochrome c-550	NA	NA	NA	NA	NA
WP_000764058.1|3648861_3649983_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	3.8e-38
WP_000528216.1|3650042_3651839_-	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	30.3	5.3e-42
>prophage 289
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3659925	3663110	5271029		Rhizobium_phage(50.0%)	4	NA	NA
WP_000840510.1|3659925_3660885_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	48.8	2.0e-48
WP_000792478.1|3660888_3662088_-	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_000732266.1|3662264_3662558_-	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_000054571.1|3662666_3663110_-	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	44.8	5.9e-19
>prophage 290
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3666851	3670007	5271029		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_000043938.1|3666851_3667967_-	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.1	9.9e-23
WP_000034699.1|3668171_3670007_-	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	3.1e-138
>prophage 291
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3673562	3682000	5271029		Streptococcus_phage(25.0%)	8	NA	NA
WP_001030953.1|3673562_3675386_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	7.0e-26
WP_001983721.1|3675596_3675959_-	YqxA family protein	NA	NA	NA	NA	NA
WP_000662639.1|3675958_3677065_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_001274011.1|3677246_3677504_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001279912.1|3677586_3678597_-	DNA polymerase III subunit delta	NA	D9ZNJ1	Clostridium_phage	24.2	1.7e-05
WP_000997609.1|3678943_3679078_+	YqzM family protein	NA	NA	NA	NA	NA
WP_033688128.1|3679106_3681428_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	36.0	4.3e-36
WP_000439782.1|3681442_3682000_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.7	2.4e-30
>prophage 292
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3690497	3691211	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000051382.1|3690497_3691211_-	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	28.5	8.3e-15
>prophage 293
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3703946	3706700	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000754110.1|3703946_3706700_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.8	2.4e-22
>prophage 294
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3713706	3714525	5271029		Indivirus(100.0%)	1	NA	NA
WP_000626544.1|3713706_3714525_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.8	2.2e-11
>prophage 295
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3719866	3721927	5271029		Pandoravirus(50.0%)	2	NA	NA
WP_001201906.1|3719866_3721000_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.4	9.4e-21
WP_001103859.1|3721003_3721927_-	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.0	1.8e-62
>prophage 296
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3727114	3729999	5271029		Phage_TP(66.67%)	3	NA	NA
WP_000537085.1|3727114_3727753_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.6	2.1e-33
WP_000217969.1|3727770_3729051_-	U32 family peptidase	NA	Q6DW11	Phage_TP	30.1	9.6e-38
WP_000742780.1|3729069_3729999_-	U32 family peptidase	NA	Q6DW11	Phage_TP	33.2	1.2e-21
>prophage 297
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3733189	3740988	5271029	tRNA	Tupanvirus(50.0%)	7	NA	NA
WP_000811835.1|3733189_3735832_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.3	4.8e-68
WP_000209458.1|3736314_3736659_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000793108.1|3736697_3737765_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000242545.1|3737941_3738154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053553.1|3738188_3738317_-	YrzQ family protein	NA	NA	NA	NA	NA
WP_000469281.1|3738335_3738524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528067.1|3738651_3740988_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.4	1.0e-53
>prophage 298
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3744875	3761552	5271029	tRNA	Bacillus_phage(33.33%)	13	NA	NA
WP_000812935.1|3744875_3746162_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.8	2.2e-119
WP_000857702.1|3746199_3746841_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000903177.1|3747134_3747902_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000840895.1|3748251_3750027_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	7.1e-15
WP_003161280.1|3750039_3751311_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001242605.1|3751665_3751842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104596.1|3751927_3752119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266956.1|3752387_3752828_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001262809.1|3752845_3755029_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_000346214.1|3755239_3755752_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	6.5e-30
WP_000941269.1|3755799_3758139_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	2.0e-86
WP_000409725.1|3758240_3759134_-	cation transporter	NA	NA	NA	NA	NA
WP_001119059.1|3759287_3761552_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.0	2.5e-33
>prophage 299
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3765051	3768762	5271029	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000991116.1|3765051_3765312_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.3	2.5e-06
WP_000125362.1|3765339_3766479_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354028.1|3766491_3767544_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|3767563_3767764_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344456.1|3767760_3768762_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	5.2e-07
>prophage 300
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3778687	3779827	5271029		Faustovirus(100.0%)	1	NA	NA
WP_000973794.1|3778687_3779827_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
>prophage 301
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3785990	3786767	5271029		Pithovirus(100.0%)	1	NA	NA
WP_000114531.1|3785990_3786767_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
>prophage 302
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3803191	3809701	5271029	coat,tRNA	Klosneuvirus(100.0%)	4	NA	NA
WP_000072245.1|3803191_3805837_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.2e-164
WP_000366998.1|3806230_3807256_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002037253.1|3807318_3808332_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_001224512.1|3808411_3809701_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
>prophage 303
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3816507	3822058	5271029	protease	Moraxella_phage(33.33%)	3	NA	NA
WP_000097301.1|3816507_3818838_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	6.6e-178
WP_033688613.1|3819021_3820692_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	9.6e-14
WP_000472282.1|3820798_3822058_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	1.3e-148
>prophage 304
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3828303	3828912	5271029		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000815943.1|3828303_3828912_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
>prophage 305
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3840358	3841834	5271029		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000677181.1|3840358_3841834_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	52.3	1.6e-142
>prophage 306
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3847960	3857132	5271029		Staphylococcus_phage(20.0%)	10	NA	NA
WP_000163244.1|3847960_3848362_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	66.4	8.7e-46
WP_001174221.1|3848387_3848717_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	45.3	8.2e-10
WP_000205173.1|3848815_3849331_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000615584.1|3849345_3849870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000521207.1|3850077_3851130_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000849744.1|3851708_3853286_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	28.1	4.1e-22
WP_000398824.1|3853269_3854778_-	recombinase family protein	NA	A0A2H4J3Q1	uncultured_Caudovirales_phage	24.6	5.6e-13
WP_001118762.1|3854788_3854941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632662.1|3854985_3855339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000558659.1|3855470_3857132_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	8.5e-63
>prophage 307
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3860520	3860700	5271029		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000659493.1|3860520_3860700_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	82.1	2.4e-16
>prophage 308
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3869553	3872401	5271029		Planktothrix_phage(50.0%)	3	NA	NA
WP_001034325.1|3869553_3870570_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	6.7e-18
WP_000108441.1|3870571_3871558_+	dipeptide ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000958971.1|3871627_3872401_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.3	9.6e-17
>prophage 309
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3879161	3880046	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000058133.1|3879161_3880046_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	6.0e-23
>prophage 310
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3890428	3890743	5271029		Indivirus(100.0%)	1	NA	NA
WP_001018943.1|3890428_3890743_-	thioredoxin	NA	A0A1V0SD63	Indivirus	41.0	8.7e-09
>prophage 311
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3894302	3895988	5271029		Hepacivirus(100.0%)	1	NA	NA
WP_000414737.1|3894302_3895988_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	30.2	5.4e-57
>prophage 312
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3903764	3908219	5271029		Staphylococcus_phage(25.0%)	6	NA	NA
WP_000221092.1|3903764_3904688_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.1e-46
WP_000247682.1|3904813_3905749_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.5	9.5e-11
WP_000018062.1|3905750_3906443_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	8.0e-07
WP_001293578.1|3906611_3906785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|3906785_3906980_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255955.1|3907019_3908219_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	4.7e-71
>prophage 313
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3911655	3913399	5271029		Bacillus_virus(50.0%)	2	NA	NA
WP_000403748.1|3911655_3912426_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	9.9e-14
WP_001036836.1|3912415_3913399_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	9.3e-17
>prophage 314
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3921649	3933980	5271029	tRNA	Lactobacillus_phage(25.0%)	11	NA	NA
WP_000893731.1|3921649_3924010_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	45.1	1.3e-16
WP_000867542.1|3924029_3925748_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.7e-13
WP_000565408.1|3925803_3926343_-	CvpA family protein	NA	NA	NA	NA	NA
WP_000082701.1|3926344_3926614_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000071577.1|3926738_3927674_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_000925540.1|3927790_3928060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001098949.1|3928056_3928308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039589.1|3928348_3928483_-	YuzL family protein	NA	NA	NA	NA	NA
WP_000432163.1|3928575_3929967_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.4	3.4e-81
WP_000498183.1|3930506_3932927_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000388219.1|3932945_3933980_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.1	2.4e-31
>prophage 315
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3943228	3961870	5271029	tRNA	Bacillus_phage(50.0%)	17	NA	NA
WP_000365050.1|3943228_3943720_-	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	37.2	6.7e-24
WP_001138362.1|3944190_3944547_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001125945.1|3944584_3944785_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000973214.1|3944806_3945310_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.8	4.8e-17
WP_000786086.1|3945703_3947641_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	1.4e-112
WP_000569612.1|3947947_3948829_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_000400112.1|3949109_3950048_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	36.2	1.7e-44
WP_000415044.1|3950081_3951488_-	DnaD domain protein	NA	A0A0S2MVK1	Bacillus_phage	36.4	6.9e-05
WP_001203687.1|3951615_3952077_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_002003660.1|3952362_3952746_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	3.0e-19
WP_000198972.1|3953135_3954164_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000219304.1|3954273_3954876_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_000281740.1|3954927_3955560_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_001114480.1|3955632_3956463_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.2	6.6e-24
WP_000412819.1|3956475_3959109_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.2	2.8e-44
WP_001032128.1|3959394_3961158_-	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	39.3	4.7e-43
WP_001065226.1|3961150_3961870_-	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	42.1	1.6e-42
>prophage 316
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3970369	3972127	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232664.1|3970369_3972127_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	44.4	3.3e-12
>prophage 317
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3977286	3980613	5271029		Streptomyces_phage(100.0%)	1	NA	NA
WP_000673746.1|3977286_3980613_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	35.0	1.0e-179
>prophage 318
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	3993432	3993696	5271029		Marinitoga_camini_virus(100.0%)	1	NA	NA
WP_002003636.1|3993432_3993696_+	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	41.4	5.2e-07
>prophage 319
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4013256	4017666	5271029	tRNA	Staphylococcus_phage(33.33%)	4	NA	NA
WP_000817749.1|4013256_4014843_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	35.9	3.1e-78
WP_000124489.1|4015024_4015222_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	67.2	5.0e-15
WP_000989283.1|4015302_4016517_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_000638961.1|4016523_4017666_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.0	1.3e-33
>prophage 320
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4025978	4030817	5271029	tRNA	Pectobacterium_phage(50.0%)	5	NA	NA
WP_000512096.1|4025978_4027235_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.2	3.4e-80
WP_001293794.1|4027611_4027857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057192.1|4027837_4028383_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000066437.1|4028363_4028819_-	lipoprotein	NA	NA	NA	NA	NA
WP_000862042.1|4029098_4030817_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.5	1.2e-205
>prophage 321
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4034975	4037121	5271029		Bacillus_phage(100.0%)	2	NA	NA
WP_001982862.1|4034975_4035665_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	2.8e-36
WP_000023881.1|4035666_4037121_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	3.7e-30
>prophage 322
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4051060	4057208	5271029		Mycobacterium_phage(50.0%)	4	NA	NA
WP_042631260.1|4051060_4054825_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.8	8.6e-87
WP_000813337.1|4055046_4055391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001006759.1|4055784_4056399_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000784592.1|4056395_4057208_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	60.3	1.2e-38
>prophage 323
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4070993	4077489	5271029		Staphylococcus_phage(33.33%)	9	NA	NA
WP_000558881.1|4070993_4072265_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.8	1.7e-26
WP_001228027.1|4072549_4073986_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.8	1.1e-26
WP_000098837.1|4074017_4074341_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000437669.1|4074341_4074773_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_000498984.1|4075197_4075425_+	DUF3973 domain-containing protein	NA	NA	NA	NA	NA
WP_000621751.1|4075459_4075642_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_000533800.1|4075643_4075880_-	DUF2553 family protein	NA	NA	NA	NA	NA
WP_001982618.1|4076136_4076631_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_000286666.1|4076703_4077489_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.2e-24
>prophage 324
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4088612	4088918	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000141221.1|4088612_4088918_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	42.2	2.1e-12
>prophage 325
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4095269	4111175	5271029	integrase,tRNA	Staphylococcus_phage(50.0%)	15	4101090:4101107	4106772:4106789
WP_000180554.1|4095269_4095692_+	hypothetical protein	NA	A0A0K2CNN3	Brevibacillus_phage	52.7	6.3e-31
WP_000677576.1|4095736_4096642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000009448.1|4096901_4099310_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.9	0.0e+00
WP_001137545.1|4099784_4100978_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	49.5	9.1e-99
4101090:4101107	attL	CGGTAAATGAAATTATAT	NA	NA	NA	NA
WP_000380194.1|4101305_4102529_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_001026038.1|4102532_4103030_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000454202.1|4103064_4103631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	35.2	1.6e-24
WP_000897752.1|4103980_4105840_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000165840.1|4105858_4106620_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	31.2	2.0e-14
WP_000527715.1|4106937_4107960_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
4106772:4106789	attR	CGGTAAATGAAATTATAT	NA	NA	NA	NA
WP_001129338.1|4108096_4108246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840870.1|4108261_4108525_-	YtzC family protein	NA	NA	NA	NA	NA
WP_000868024.1|4108636_4109596_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	70.6	8.4e-55
WP_000764478.1|4109592_4110165_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	52.9	1.6e-48
WP_000959726.1|4110341_4111175_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.0	4.8e-14
>prophage 326
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4120701	4124007	5271029		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000163125.1|4120701_4121901_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.4	9.2e-160
WP_000108802.1|4122420_4124007_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.6	2.0e-194
>prophage 327
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4131333	4132143	5271029		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000498300.1|4131333_4132143_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.6	2.4e-10
>prophage 328
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4136386	4137151	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000009042.1|4136386_4137151_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.0	3.3e-38
>prophage 329
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4140999	4143925	5271029		Staphylococcus_phage(100.0%)	7	NA	NA
WP_000276389.1|4140999_4141479_-	antimutator 8-oxo-(dGTP/GTP)ase	NA	A0A2H4PQM4	Staphylococcus_phage	33.3	2.8e-19
WP_000435820.1|4141563_4141881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912934.1|4141964_4142114_+	YtzI protein	NA	NA	NA	NA	NA
WP_000944463.1|4142115_4142346_+	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
WP_000911979.1|4142359_4142590_+	YczI family protein	NA	NA	NA	NA	NA
WP_001141369.1|4143086_4143560_-	S-ribosylhomocysteine lyase LuxS	NA	NA	NA	NA	NA
WP_000809330.1|4143688_4143925_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	72.6	5.3e-27
>prophage 330
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4150314	4151187	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000411239.1|4150314_4151187_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.2	1.1e-32
>prophage 331
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4159632	4168049	5271029	transposase	Bacillus_phage(50.0%)	10	NA	NA
WP_000715411.1|4159632_4161486_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.9	9.6e-31
WP_001097105.1|4161482_4162172_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.4e-35
WP_000771605.1|4162211_4162832_-	class D sortase	NA	NA	NA	NA	NA
WP_000728003.1|4162921_4163368_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000415602.1|4163544_4163877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002156638.1|4164060_4164276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019306.1|4164436_4164964_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	31.8	1.7e-12
WP_000167888.1|4165264_4166167_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_033688618.1|4166227_4166908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483108.1|4167089_4168049_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	26.5	1.7e-15
>prophage 332
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4172424	4173195	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000859653.1|4172424_4173195_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	9.5e-33
>prophage 333
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4180415	4181168	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000393254.1|4180415_4181168_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	3.3e-30
>prophage 334
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4193425	4198839	5271029		Bacillus_phage(33.33%)	5	NA	NA
WP_000822492.1|4193425_4194124_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	5.2e-38
WP_000403268.1|4194379_4195486_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_000449549.1|4195486_4196932_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.2	4.1e-69
WP_000963873.1|4197138_4197957_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_001103368.1|4198026_4198839_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	W0LNB3	Mycobacterium_phage	32.7	6.1e-06
>prophage 335
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4204015	4208966	5271029		Lactococcus_phage(50.0%)	4	NA	NA
WP_001193054.1|4204015_4204216_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.9e-18
WP_001147838.1|4204542_4205325_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_001260128.1|4205489_4206212_+	lipase family protein	NA	NA	NA	NA	NA
WP_000494082.1|4206557_4208966_-	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	7.1e-10
>prophage 336
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4226134	4226815	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000386684.1|4226134_4226815_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	1.6e-15
>prophage 337
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4236462	4237002	5271029		Goatpox_virus(100.0%)	1	NA	NA
WP_000746504.1|4236462_4237002_-	superoxide dismutase [Cu-Zn]	NA	A0A075CHD1	Goatpox_virus	34.7	3.7e-07
>prophage 338
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4241780	4250916	5271029	tRNA	Klosneuvirus(20.0%)	9	NA	NA
WP_000287154.1|4241780_4243157_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140609.1|4243194_4243578_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810349.1|4243673_4244417_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252161.1|4244467_4245061_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000832652.1|4245106_4245994_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.1	5.9e-79
WP_001104191.1|4246102_4247827_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
WP_001158742.1|4247970_4248576_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_000487984.1|4248658_4250143_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	7.4e-58
WP_000920106.1|4250289_4250916_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.8e-14
>prophage 339
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4253934	4254924	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000829779.1|4253934_4254924_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
>prophage 340
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4269394	4270330	5271029		Paenibacillus_phage(50.0%)	2	NA	NA
WP_000833129.1|4269394_4269748_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.0	6.5e-13
WP_000573822.1|4269976_4270330_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	4.8e-16
>prophage 341
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4273602	4274262	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000470279.1|4273602_4274262_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	5.8e-23
>prophage 342
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4279056	4281511	5271029	coat	Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000431159.1|4279056_4279293_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125503.1|4279611_4279827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581265.1|4279897_4280899_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000655323.1|4281019_4281511_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.4	1.2e-41
>prophage 343
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4299558	4303293	5271029		Mycobacterium_phage(33.33%)	4	NA	NA
WP_000009523.1|4299558_4299990_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020769.1|4299979_4301200_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	5.2e-118
WP_000152181.1|4301199_4302492_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929160.1|4302507_4303293_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	1.3e-08
>prophage 344
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4309537	4309903	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000218967.1|4309537_4309903_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	6.7e-21
>prophage 345
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4317996	4319680	5271029		Clostridioides_phage(50.0%)	3	NA	NA
WP_000813828.1|4317996_4318224_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.6	3.4e-07
WP_000074920.1|4318405_4318954_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001242595.1|4318957_4319680_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.2	9.6e-11
>prophage 346
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4326905	4330820	5271029		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000436772.1|4326905_4327823_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	43.9	1.0e-65
WP_001290584.1|4328133_4328391_-	YusU family protein	NA	NA	NA	NA	NA
WP_001018866.1|4328439_4328742_-	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_002003782.1|4328819_4330820_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.0	1.8e-11
>prophage 347
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4339995	4340889	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000530036.1|4339995_4340889_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.2	1.0e-25
>prophage 348
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4347846	4357929	5271029	tRNA	Bacillus_phage(40.0%)	7	NA	NA
WP_000148833.1|4347846_4348512_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.8e-35
WP_000201938.1|4348489_4349932_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	2.6e-15
WP_000410512.1|4350071_4350974_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000021575.1|4351015_4352650_-|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	33.0	1.1e-73
WP_001072243.1|4353085_4353904_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000878460.1|4354317_4356012_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.4	1.4e-12
WP_001009435.1|4356237_4357929_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.3e-13
>prophage 349
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4365838	4367913	5271029		Clostridium_phage(50.0%)	4	NA	NA
WP_001041890.1|4365838_4366279_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	65.8	1.6e-48
WP_000656318.1|4366733_4366931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390891.1|4366946_4367231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002003806.1|4367349_4367913_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	24.4	2.2e-10
>prophage 350
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4383843	4384683	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000793531.1|4383843_4384683_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.9	7.5e-84
>prophage 351
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4388990	4390250	5271029	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001021109.1|4388990_4390250_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	2.0e-88
>prophage 352
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4394109	4395612	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000455047.1|4394109_4395612_-	DUF4077 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.5	7.1e-08
>prophage 353
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4404003	4405020	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000041820.1|4404003_4405020_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	3.0e-58
>prophage 354
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4409128	4412142	5271029		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001123905.1|4409128_4409596_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	1.4e-47
WP_000391100.1|4409721_4412142_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
>prophage 355
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4415848	4417144	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000103950.1|4415848_4417144_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.6	3.8e-183
>prophage 356
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4429115	4435805	5271029		Streptococcus_phage(40.0%)	8	NA	NA
WP_001049162.1|4429115_4429697_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|4430021_4430270_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006561.1|4430293_4431244_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	6.6e-52
WP_000712178.1|4431333_4432287_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.5	9.9e-64
WP_000138464.1|4432290_4433172_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|4433192_4433651_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455203.1|4433879_4434686_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288072.1|4434848_4435805_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.9	1.4e-89
>prophage 357
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4441722	4444599	5271029		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000045565.1|4441722_4444599_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 358
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4451665	4462358	5271029		uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_001099993.1|4451665_4452559_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	2.5e-08
WP_001219211.1|4452610_4452979_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000497622.1|4452983_4453529_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000153737.1|4453794_4455429_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.5	2.9e-71
WP_000637521.1|4455534_4455846_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944595.1|4455911_4457627_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	5.3e-60
WP_000261266.1|4457939_4459142_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_002037436.1|4459233_4460718_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.2	5.5e-21
WP_000645021.1|4460788_4461682_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594327.1|4461671_4462358_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.4	3.4e-26
>prophage 359
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4468297	4478354	5271029		Streptococcus_phage(42.86%)	10	NA	NA
WP_001990088.1|4468297_4468495_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
WP_033688220.1|4468621_4469326_-	comF operon protein ComFC	NA	NA	NA	NA	NA
WP_033688222.1|4469325_4470675_-	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	37.2	5.3e-63
WP_000734327.1|4470801_4472100_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.5	5.7e-14
WP_000400857.1|4472352_4472667_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000844766.1|4472840_4473683_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.0	2.3e-16
WP_000926685.1|4473922_4474558_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	1.4e-37
WP_000392763.1|4474632_4475760_+	LCP family protein	NA	NA	NA	NA	NA
WP_000140128.1|4475793_4476909_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.9	2.7e-20
WP_000287639.1|4476983_4478354_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	41.6	1.9e-92
>prophage 360
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4490275	4491757	5271029		Heterosigma_akashiwo_virus(50.0%)	2	NA	NA
WP_001123952.1|4490275_4491358_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	34.0	3.5e-09
WP_000456829.1|4491385_4491757_+	S-adenosylmethionine decarboxylase proenzyme	NA	A0A222YVV4	Synechococcus_phage	40.4	2.4e-18
>prophage 361
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4499159	4500044	5271029		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000421945.1|4499159_4500044_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	3.1e-11
>prophage 362
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4504374	4505733	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000110058.1|4504374_4505733_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	29.1	3.2e-52
>prophage 363
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4512503	4526159	5271029		Vibrio_phage(33.33%)	9	NA	NA
WP_000435503.1|4512503_4512869_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	41.5	2.6e-12
WP_000665359.1|4513415_4515344_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.4	1.7e-102
WP_002037445.1|4515822_4516707_+	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_000760311.1|4516917_4518681_+	SH3 domain-containing protein	NA	A7KUS1	Bacillus_phage	42.4	9.2e-15
WP_001051021.1|4519026_4520238_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.4	9.4e-19
WP_000654669.1|4520489_4521245_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000988765.1|4521241_4522543_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001230127.1|4523103_4524621_-	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	29.4	7.1e-32
WP_000733312.1|4525286_4526159_+	3D domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	74.3	1.9e-37
>prophage 364
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4531874	4534631	5271029		Pneumococcus_phage(100.0%)	1	NA	NA
WP_000610081.1|4531874_4534631_+	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.4	4.9e-31
>prophage 365
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4540465	4541146	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631600.1|4540465_4541146_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-34
>prophage 366
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4545809	4552468	5271029		Tupanvirus(50.0%)	6	NA	NA
WP_000054041.1|4545809_4547240_-	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	26.7	5.5e-10
WP_000699579.1|4547251_4547923_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	6.5e-38
WP_001084648.1|4548050_4549043_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	4.0e-52
WP_000727091.1|4549213_4550125_-	transcription antiterminator LytR	NA	NA	NA	NA	NA
WP_000884318.1|4550280_4550715_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_042631257.1|4551352_4552468_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.9	2.7e-20
>prophage 367
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4559087	4565010	5271029		Catovirus(33.33%)	5	NA	NA
WP_000860092.1|4559087_4561220_-	bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	A0A1V0SAH6	Catovirus	38.5	3.0e-12
WP_080000668.1|4561206_4562403_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_000756019.1|4562409_4562805_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.0	2.2e-17
WP_000457986.1|4563574_4564576_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_000544012.1|4564737_4565010_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	48.0	1.0e-13
>prophage 368
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4568391	4571570	5271029		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000170849.1|4568391_4569234_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	9.7e-31
WP_001185943.1|4569415_4570423_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000672631.1|4570550_4571570_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	43.8	9.0e-47
>prophage 369
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4598160	4599402	5271029		Aeromonas_phage(100.0%)	1	NA	NA
WP_000349816.1|4598160_4599402_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
>prophage 370
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4604854	4605895	5271029		Pandoravirus(100.0%)	1	NA	NA
WP_000557336.1|4604854_4605895_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	43.5	9.7e-65
>prophage 371
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4609679	4610264	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000280861.1|4609679_4610264_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.5e-34
>prophage 372
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4616458	4619192	5271029		Bacillus_phage(50.0%)	3	NA	NA
WP_000398594.1|4616458_4616827_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.4	1.8e-10
WP_000912432.1|4617028_4617553_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_000170457.1|4617584_4619192_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.0	2.4e-147
>prophage 373
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4629030	4632791	5271029		Bacillus_virus(100.0%)	2	NA	NA
WP_000605874.1|4629030_4629984_+	UV DNA damage repair endonuclease UvsE	NA	G3MAQ2	Bacillus_virus	35.3	1.4e-38
WP_033688255.1|4630112_4632791_+	DUF4084 domain-containing protein	NA	G3MA91	Bacillus_virus	43.2	6.7e-33
>prophage 374
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4660872	4661598	5271029		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000042769.1|4660872_4661598_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.2	1.4e-17
>prophage 375
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4665518	4672514	5271029		Cafeteria_roenbergensis_virus(33.33%)	7	NA	NA
WP_000262734.1|4665518_4666823_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	26.8	1.2e-22
WP_000787737.1|4666969_4667914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000212060.1|4668104_4668917_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.6e-14
WP_001260776.1|4668932_4669949_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000388278.1|4669945_4671001_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000526077.1|4671312_4671537_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_000868349.1|4671821_4672514_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	46.6	3.1e-06
>prophage 376
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4677441	4678713	5271029		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000722838.1|4677441_4678713_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.3	2.5e-22
>prophage 377
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4684435	4688901	5271029		Pandoravirus(33.33%)	5	NA	NA
WP_000683470.1|4684435_4685113_-	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	45.1	5.4e-48
WP_001206490.1|4685132_4686125_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000207742.1|4686117_4687035_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	2.4e-38
WP_011733543.1|4687031_4687913_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000181986.1|4687923_4688901_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.2	2.7e-16
>prophage 378
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4691975	4693274	5271029		Orpheovirus(100.0%)	1	NA	NA
WP_000504765.1|4691975_4693274_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	24.6	4.7e-08
>prophage 379
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4700690	4701746	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000942894.1|4700690_4701746_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.9e-23
>prophage 380
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4711051	4712353	5271029		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000901873.1|4711051_4712353_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.7	3.0e-07
>prophage 381
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4717469	4719023	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_000055390.1|4717469_4719023_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.5	2.5e-48
>prophage 382
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4722772	4727904	5271029		Salmonella_phage(50.0%)	3	NA	NA
WP_001170714.1|4722772_4723744_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.0	2.0e-59
WP_000659615.1|4723774_4724647_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001033512.1|4724787_4727904_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.3	4.8e-75
>prophage 383
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4732369	4763199	5271029	protease	Streptococcus_phage(14.29%)	26	NA	NA
WP_000933567.1|4732369_4734139_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.6	7.4e-65
WP_001103422.1|4734467_4735766_+	MFS transporter	NA	NA	NA	NA	NA
WP_001242469.1|4735862_4737431_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.1e-19
WP_000047612.1|4737787_4738858_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000094049.1|4739074_4739701_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	4.5e-57
WP_000976956.1|4739789_4740671_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000542560.1|4740776_4741367_-	acetamide transporter	NA	NA	NA	NA	NA
WP_001128266.1|4741793_4742195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996163.1|4742338_4743355_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.4	4.4e-94
WP_000995317.1|4743578_4744226_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000427903.1|4744390_4744951_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000039360.1|4744993_4746439_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	32.8	1.8e-56
WP_000827032.1|4746626_4747658_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.5	9.8e-17
WP_000432434.1|4747898_4748882_+	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	7.6e-160
WP_000655837.1|4749016_4750834_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.2	4.0e-122
WP_000713639.1|4750871_4751750_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001027003.1|4751932_4752412_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001052827.1|4752471_4752657_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_000008050.1|4752710_4753886_-|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	2.9e-09
WP_000522833.1|4753949_4754744_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	1.0e-42
WP_000383727.1|4754727_4755570_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_000061592.1|4755550_4756867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755373.1|4756863_4758705_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000971872.1|4758708_4759416_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	9.9e-45
WP_000100223.1|4760332_4761622_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.9	1.9e-70
WP_001286244.1|4761837_4763199_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	6.6e-122
>prophage 384
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4767016	4767538	5271029		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000981967.1|4767016_4767538_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	62.4	1.8e-51
>prophage 385
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4770621	4773907	5271029	protease	Bacillus_virus(25.0%)	4	NA	NA
WP_001020723.1|4770621_4771218_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.3e-24
WP_001051842.1|4771238_4772090_-	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	32.8	4.3e-18
WP_000516114.1|4772082_4772844_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	29.7	6.1e-24
WP_000799028.1|4773034_4773907_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.1	3.5e-15
>prophage 386
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4782368	4789509	5271029		Bacillus_virus(66.67%)	5	NA	NA
WP_001212527.1|4782368_4783508_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	37.0	5.7e-18
WP_000821367.1|4783635_4783848_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_000470750.1|4783860_4784988_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000435993.1|4785026_4786949_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.2	2.5e-138
WP_001282849.1|4787037_4789509_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.6	3.2e-114
>prophage 387
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4795912	4807645	5271029	tRNA	Klosneuvirus(16.67%)	11	NA	NA
WP_000264082.1|4795912_4797376_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.8	2.8e-94
WP_125164927.1|4797489_4798797_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	27.9	1.3e-21
WP_000186156.1|4798958_4799846_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000238799.1|4799864_4800455_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000884181.1|4800782_4802057_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.0	3.1e-97
WP_000364201.1|4802472_4802865_+	DUF3797 domain-containing protein	NA	NA	NA	NA	NA
WP_001053585.1|4802900_4803569_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.6	2.8e-25
WP_000148227.1|4803571_4804207_-	deoxynucleoside kinase	NA	A0MSS7	Spodoptera_exigua_ascovirus	26.2	5.6e-07
WP_000798745.1|4804332_4804872_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000439010.1|4804979_4805480_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_000121570.1|4805956_4807645_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.8	6.2e-45
>prophage 388
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4816423	4824027	5271029	tRNA	Streptococcus_phage(60.0%)	9	NA	NA
WP_000677237.1|4816423_4817050_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	50.5	1.1e-55
WP_000169577.1|4817085_4818069_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	31.2	1.3e-29
WP_000272429.1|4818074_4818902_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_000412056.1|4818916_4819267_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_001055361.1|4819387_4820128_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000414342.1|4820114_4820405_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000267808.1|4820373_4821249_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.4	9.7e-66
WP_000843036.1|4821269_4821554_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.1	3.9e-16
WP_071735796.1|4822017_4824027_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.2	1.4e-96
>prophage 389
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4829471	4833938	5271029		Klosneuvirus(33.33%)	5	NA	NA
WP_000702475.1|4829471_4830320_+	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	24.1	9.2e-05
WP_000869808.1|4830442_4830817_+	RidA family protein	NA	NA	NA	NA	NA
WP_000454041.1|4830969_4831263_+	septation regulator SpoVG	NA	NA	NA	NA	NA
WP_000071032.1|4831586_4832966_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A167R6F2	Powai_lake_megavirus	30.7	9.4e-23
WP_000107420.1|4832984_4833938_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.2	6.0e-45
>prophage 390
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4838638	4839175	5271029		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000648307.1|4838638_4839175_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 391
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4847996	4862499	5271029	protease,tRNA	Tupanvirus(25.0%)	15	NA	NA
WP_000655471.1|4847996_4849427_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1HYT7	Acanthocystis_turfacea_Chlorella_virus	24.0	2.3e-08
WP_000981838.1|4849423_4849966_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L2A2	Tupanvirus	22.8	4.5e-05
WP_001079659.1|4850051_4851953_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.8	5.8e-116
WP_000578367.1|4852177_4852966_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_000656366.1|4852972_4853848_+	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001261708.1|4853952_4854876_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.6	1.0e-94
WP_001189680.1|4855096_4856494_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.9	1.2e-38
WP_000602287.1|4856499_4857087_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.9	5.1e-71
WP_000909893.1|4857080_4857953_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_025985130.1|4857927_4858788_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.0	9.9e-23
WP_000358063.1|4858788_4859151_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_001059445.1|4859147_4859663_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000387027.1|4859614_4859818_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000912262.1|4859841_4860840_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000369671.1|4860999_4862499_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	4.0e-96
>prophage 392
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4875849	4878285	5271029	protease	Klebsiella_phage(100.0%)	1	NA	NA
WP_000971179.1|4875849_4878285_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	40.9	4.4e-132
>prophage 393
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4886018	4887416	5271029	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_000152271.1|4886018_4887416_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.8	1.8e-50
>prophage 394
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4890427	4890961	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_000415794.1|4890427_4890961_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	29.5	8.3e-12
>prophage 395
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4894553	4906726	5271029		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_000147554.1|4894553_4898087_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	7.9e-50
WP_000567936.1|4898124_4901736_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.2	5.2e-65
WP_000121830.1|4901849_4902098_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001142340.1|4902212_4902635_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001137493.1|4902664_4903135_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000090364.1|4903342_4905421_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.5	9.7e-64
WP_001029614.1|4905538_4906726_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	25.7	7.8e-10
>prophage 396
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4921918	4923618	5271029		Planktothrix_phage(50.0%)	2	NA	NA
WP_000711776.1|4921918_4922761_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-21
WP_000406513.1|4922736_4923618_+	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	6.6e-14
>prophage 397
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4926819	4927533	5271029		Deep-sea_thermophilic_phage(100.0%)	1	NA	NA
WP_000822436.1|4926819_4927533_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	E5DV68	Deep-sea_thermophilic_phage	33.5	1.2e-16
>prophage 398
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4937413	4939662	5271029		Streptococcus_phage(50.0%)	2	NA	NA
WP_000869550.1|4937413_4938559_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.5	3.2e-53
WP_000711572.1|4938768_4939662_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	30.4	2.3e-22
>prophage 399
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4944030	4945833	5271029		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000334158.1|4944030_4945833_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	39.7	7.7e-102
>prophage 400
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4953360	4954770	5271029		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000413557.1|4953360_4954770_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.2	9.8e-44
>prophage 401
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4963324	4964365	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571359.1|4963324_4964365_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	1.3e-29
>prophage 402
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4967399	4968836	5271029		Tupanvirus(100.0%)	1	NA	NA
WP_000715446.1|4967399_4968836_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	30.1	5.1e-56
>prophage 403
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4975839	4977620	5271029		Planktothrix_phage(100.0%)	2	NA	NA
WP_000079889.1|4975839_4976850_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	5.1e-18
WP_000205664.1|4976846_4977620_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	5.4e-20
>prophage 404
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4986960	4989437	5271029		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000060183.1|4986960_4987794_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.9	4.1e-74
WP_000956260.1|4987795_4988599_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.9	2.0e-17
WP_000621361.1|4988786_4989437_+	nicotinamide mononucleotide transporter	NA	A0A0F6YPU8	Sinorhizobium_phage	24.1	9.2e-05
>prophage 405
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	4998943	4999780	5271029		Streptococcus_phage(100.0%)	1	NA	NA
WP_000248042.1|4998943_4999780_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	3.6e-46
>prophage 406
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5006095	5011044	5271029		Streptococcus_phage(33.33%)	4	NA	NA
WP_000150900.1|5006095_5007976_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	32.7	7.4e-47
WP_000902011.1|5008126_5009320_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000619343.1|5009316_5009973_+	response regulator transcription factor	NA	A0A2K9L4R0	Tupanvirus	37.6	5.5e-05
WP_000960157.1|5010111_5011044_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.8	1.0e-33
>prophage 407
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5017818	5019761	5271029		Planktothrix_phage(100.0%)	2	NA	NA
WP_000030783.1|5017818_5018799_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.9e-17
WP_001294504.1|5018795_5019761_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	4.0e-20
>prophage 408
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5025652	5026924	5271029		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000799743.1|5025652_5026924_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.9	7.8e-16
>prophage 409
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5030142	5031729	5271029		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_000206587.1|5030142_5031729_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
>prophage 410
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5036801	5037152	5271029		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000635963.1|5036801_5037152_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	4.9e-13
>prophage 411
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5048255	5061749	5271029	protease,tRNA	Moraxella_phage(25.0%)	11	NA	NA
WP_000414600.1|5048255_5049272_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.1	1.4e-68
WP_001985364.1|5049692_5051669_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	3.4e-50
WP_000437700.1|5051802_5052432_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246201.1|5052461_5052653_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745340.1|5052649_5053399_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917306.1|5053800_5054085_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
WP_001029999.1|5054123_5055758_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_172855417.1|5056162_5057704_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_000833093.1|5058088_5059414_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_000929883.1|5059558_5060260_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_000719243.1|5060243_5061749_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	9.2e-32
>prophage 412
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5076044	5078759	5271029		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000074586.1|5076044_5076974_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	8.8e-41
WP_000686988.1|5077042_5078056_-	HAMP domain-containing histidine kinase	NA	A0A2K9L114	Tupanvirus	24.6	9.6e-09
WP_000651977.1|5078045_5078759_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	2.9e-36
>prophage 413
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5085305	5086097	5271029		Bacillus_phage(100.0%)	1	NA	NA
WP_000483025.1|5085305_5086097_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	59.3	3.2e-84
>prophage 414
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5091905	5103472	5271029		Synechococcus_phage(25.0%)	11	NA	NA
WP_000839367.1|5091905_5092391_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.6	2.3e-24
WP_000196802.1|5092387_5093539_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000625683.1|5093535_5094843_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|5094931_5095651_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278820.1|5095643_5095898_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|5095894_5096578_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|5096561_5098781_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|5098765_5100181_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|5100287_5101328_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|5101324_5101912_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
WP_000745427.1|5101936_5103472_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	54.3	3.9e-78
>prophage 415
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5107551	5111820	5271029		Bacillus_phage(50.0%)	2	NA	NA
WP_033688400.1|5107551_5109795_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-136
WP_000031433.1|5109810_5111820_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.0	2.9e-126
>prophage 416
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5117199	5118219	5271029		Planktothrix_phage(100.0%)	1	NA	NA
WP_000622981.1|5117199_5118219_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	2.1e-32
>prophage 417
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5126661	5127567	5271029		Catovirus(100.0%)	1	NA	NA
WP_000977674.1|5126661_5127567_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	31.1	4.9e-28
>prophage 418
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5138882	5145766	5271029	tRNA	Erysipelothrix_phage(33.33%)	7	NA	NA
WP_000105053.1|5138882_5140259_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	5.0e-117
WP_000566682.1|5140355_5141345_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002035617.1|5141605_5142154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251701.1|5142426_5142945_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.1	7.3e-21
WP_000233740.1|5143038_5143746_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000217540.1|5143946_5144642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704462.1|5144656_5145766_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.1	4.3e-18
>prophage 419
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5150739	5152266	5271029		Lactococcus_phage(100.0%)	1	NA	NA
WP_000599486.1|5150739_5152266_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	9.1e-19
>prophage 420
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5159799	5160849	5271029		Bacillus_virus(100.0%)	1	NA	NA
WP_001078276.1|5159799_5160849_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.2	2.2e-16
>prophage 421
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5168889	5169672	5271029		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001208278.1|5168889_5169672_+	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	42.6	4.6e-43
>prophage 422
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5176128	5178354	5271029		Planktothrix_phage(50.0%)	2	NA	NA
WP_000616940.1|5176128_5176851_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.8e-33
WP_000410242.1|5177061_5178354_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.7	2.4e-12
>prophage 423
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5193668	5195858	5271029		Indivirus(100.0%)	1	NA	NA
WP_001140209.1|5193668_5195858_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	25.4	2.4e-28
>prophage 424
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5203747	5208911	5271029		Bacillus_virus(33.33%)	3	NA	NA
WP_000016062.1|5203747_5204497_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.5e-30
WP_000025955.1|5204884_5206429_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.2	2.9e-49
WP_000837187.1|5206886_5208911_-	cellulose binding domain-containing protein	NA	A0A1X9VNM7	Mimivirus	33.0	4.1e-59
>prophage 425
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5214600	5233335	5271029	tRNA	Caulobacter_phage(37.5%)	17	NA	NA
WP_000356459.1|5214600_5215914_-	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	23.9	1.1e-07
WP_000383852.1|5216067_5216361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040956.1|5216708_5218139_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	41.5	3.1e-101
WP_158319812.1|5218460_5219072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666125.1|5219454_5220333_+	ROK family protein	NA	NA	NA	NA	NA
WP_001121586.1|5220461_5221058_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	33.8	3.7e-24
WP_000146731.1|5221081_5221666_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.7	3.7e-29
WP_000236653.1|5221746_5222325_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.7	1.1e-28
WP_000025696.1|5222398_5223190_+	TerC family protein	NA	S5MAL1	Bacillus_phage	63.4	4.9e-77
WP_000492839.1|5223299_5224931_+	YceG family protein	NA	NA	NA	NA	NA
WP_001064413.1|5224949_5226032_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_000073712.1|5226067_5228734_-	cation-translocating P-type ATPase	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	29.3	2.8e-84
WP_000366197.1|5228925_5229150_-	DUF1128 domain-containing protein	NA	NA	NA	NA	NA
WP_000250910.1|5229324_5229789_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_001085396.1|5229842_5230358_+	DUF4075 domain-containing protein	NA	NA	NA	NA	NA
WP_001226523.1|5230364_5231225_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001083795.1|5231409_5233335_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.3	9.4e-122
>prophage 426
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5248796	5250176	5271029		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000615206.1|5248796_5250176_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.3	2.3e-85
>prophage 427
NZ_CP053991	Bacillus cereus strain FDAARGOS_781 chromosome, complete genome	5271029	5258002	5267887	5271029		Mycobacterium_phage(25.0%)	8	NA	NA
WP_000371836.1|5258002_5259241_+	serine hydrolase	NA	A0A0K1LTU3	Mycobacterium_phage	25.6	9.6e-19
WP_000335517.1|5259394_5259796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000899467.1|5259812_5260007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001266456.1|5260020_5261565_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001088935.1|5261557_5262799_+	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	24.2	4.5e-16
WP_000037028.1|5262795_5263761_+	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	34.0	6.7e-36
WP_001130002.1|5263753_5265298_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042631251.1|5265637_5267887_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.1	1.3e-183
>prophage 1
NZ_CP053990	Bacillus cereus strain FDAARGOS_781 plasmid unnamed1, complete sequence	51528	0	51182	51528	tail,capsid,portal,plate,terminase	Bacillus_phage(57.45%)	74	NA	NA
WP_033688695.1|3714_3975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631181.1|4052_4439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631180.1|4504_4969_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_042631179.1|4983_5385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631178.1|5387_5882_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	48.8	6.9e-37
WP_042631177.1|5866_6259_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_042631176.1|6258_6648_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	2.7e-20
WP_042631175.1|6653_6836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631174.1|6852_7770_-|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	34.8	1.2e-45
WP_042631173.1|7785_8991_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	45.5	3.1e-78
WP_042631172.1|9037_9964_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	36.1	1.1e-46
WP_042631171.1|9950_11483_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	41.5	2.4e-96
WP_000178976.1|11482_12802_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	69.4	3.5e-176
WP_000810408.1|12773_13568_-	hypothetical protein	NA	D2XPX8	Bacillus_virus	68.1	2.0e-65
WP_042631170.1|13636_13897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157404518.1|14361_14517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401823.1|14531_14774_-	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	68.8	1.8e-22
WP_042631169.1|15055_15313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631168.1|16491_16878_-	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	96.9	1.7e-62
WP_042631167.1|17113_17530_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	70.1	1.9e-48
WP_000398979.1|17531_17708_-	hypothetical protein	NA	A0A1B1P875	Bacillus_phage	94.7	5.3e-24
WP_042631204.1|17725_18055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631166.1|18087_18348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650110.1|18377_18644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631165.1|18640_18829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631164.1|18946_19231_-	hypothetical protein	NA	A0A1B1P8C3	Bacillus_phage	87.2	6.6e-40
WP_042631163.1|19330_19609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631162.1|19645_19840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678895.1|19879_20188_-	hypothetical protein	NA	A0A2H4J3B9	uncultured_Caudovirales_phage	51.0	5.5e-08
WP_042631161.1|20226_20436_-	hypothetical protein	NA	I1TLG8	Bacillus_phage	97.1	3.9e-34
WP_042631160.1|20474_20972_-	dUTP diphosphatase	NA	M4W9N7	Bacillus_phage	35.2	2.6e-15
WP_172855413.1|20985_21153_-	hypothetical protein	NA	A0A0U3SD36	Bacillus_phage	61.8	2.1e-09
WP_000201627.1|21163_21412_-	glutaredoxin family protein	NA	B5LPN1	Bacillus_virus	92.7	5.9e-37
WP_042631159.1|21478_21673_-	hypothetical protein	NA	A0A1B1P7U9	Bacillus_phage	75.0	1.1e-19
WP_042631158.1|21669_22098_-	hypothetical protein	NA	A0A1S5SDX2	Streptococcus_phage	36.9	3.3e-11
WP_080335271.1|22087_22222_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	79.1	2.1e-12
WP_042631157.1|22230_22653_-	hypothetical protein	NA	A0A1B1P8A6	Bacillus_phage	54.2	2.9e-15
WP_042631156.1|22649_23216_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.0	1.8e-09
WP_001257508.1|23226_23499_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	65.5	1.5e-25
WP_042631203.1|23495_24788_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	41.4	4.1e-89
WP_000412107.1|24765_25044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405013.1|25056_25926_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	47.4	1.1e-24
WP_002037579.1|25960_26224_-	hypothetical protein	NA	A0A1B1P8A5	Bacillus_phage	49.3	2.2e-13
WP_000002672.1|26392_27220_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	68.1	2.5e-100
WP_000387974.1|27234_28170_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.8	3.4e-101
WP_000572096.1|28171_28372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172855414.1|28577_28718_-	hypothetical protein	NA	A0A1B1P8A8	Bacillus_phage	93.5	1.9e-16
WP_042631201.1|28830_29601_-	phage antirepressor KilAC domain-containing protein	NA	A0A1B1P8B0	Bacillus_phage	100.0	8.2e-69
WP_042631200.1|30067_30412_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	97.4	7.9e-56
WP_001226631.1|30717_30864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405014.1|30906_31800_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	38.8	2.4e-51
WP_042631198.1|32542_32887_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.4	5.4e-20
WP_042631197.1|33076_34216_+	excalibur calcium-binding domain-containing protein	NA	A0A0A7AR49	Bacillus_phage	52.5	4.8e-41
WP_000468107.1|34272_35034_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000923178.1|35135_35489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631196.1|37080_37908_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	41.1	2.3e-53
WP_033691956.1|37900_38260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042631195.1|38355_38619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042631194.1|38663_39254_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	45.1	3.9e-10
WP_042631193.1|39330_39930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042631192.1|40014_40503_-	hypothetical protein	NA	A6XML4	Bacillus_virus	53.8	6.7e-16
WP_080335274.1|40522_41098_-	replication-relaxation family protein	NA	B3RH37	Bacillus_virus	63.2	1.5e-67
WP_042631191.1|41039_42335_-	cell division protein FtsK	NA	B3RH36	Bacillus_virus	44.9	5.7e-107
WP_042631190.1|42889_43726_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_042631189.1|43849_44047_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	56.2	1.4e-12
WP_042631188.1|44157_44514_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_042631187.1|44556_45621_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	96.6	4.8e-200
WP_042631186.1|45617_45821_-	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	95.5	1.6e-32
WP_042631207.1|45822_46059_-	hemolysin XhlA family protein	NA	A0A1B1P887	Bacillus_phage	63.2	1.4e-16
WP_042631185.1|46224_46584_+	DUF1413 domain-containing protein	NA	NA	NA	NA	NA
WP_042631184.1|46694_47366_-	hypothetical protein	NA	A0A1B1P882	Bacillus_phage	61.7	1.4e-51
WP_042631206.1|47381_48998_-|plate	BppU family phage baseplate upper protein	plate	D2XPZ7	Bacillus_virus	58.4	3.6e-74
WP_001985685.1|49058_49325_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042631183.1|49334_51182_-|tail	phage tail protein	tail	A0A2P1JTV8	Anoxybacillus_phage	56.6	1.2e-129
