The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	27174	35157	5179558		Bacillus_phage(33.33%)	8	NA	NA
WP_047940982.1|27174_28332_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	26.9	9.3e-16
WP_172885209.1|28328_29831_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	1.7e-46
WP_082138248.1|29848_29995_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_047940984.1|30012_30684_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	2.0e-42
WP_061797144.1|30761_32504_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	8.8e-26
WP_061797146.1|33058_33805_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	30.0	3.4e-11
WP_061797150.1|33962_34337_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061797154.1|34674_35157_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	41.4	3.0e-24
>prophage 2
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	671009	679544	5179558		Synechococcus_phage(42.86%)	8	NA	NA
WP_061801300.1|671009_671729_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	43.4	3.1e-46
WP_047944717.1|671721_671976_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D7SNZ9	Cyanophage	37.0	2.5e-06
WP_047944716.1|671972_672659_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_047944714.1|672642_674859_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	3.9e-164
WP_047944712.1|674843_676256_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.2	1.6e-49
WP_047944711.1|676335_677367_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	1.3e-61
WP_047944710.1|677383_677965_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	2.2e-26
WP_047944709.1|678008_679544_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.7	2.6e-74
>prophage 3
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	695760	800022	5179558	portal,capsid,integrase,protease,terminase,tRNA,head,tail,transposase,holin	uncultured_Caudovirales_phage(31.25%)	116	686456:686479	777596:777619
686456:686479	attL	CCGTGTTTCCTATATCTCAGGAAA	NA	NA	NA	NA
WP_047944998.1|695760_696051_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_047944997.1|696065_697523_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_047944996.1|697535_698963_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_172885217.1|699172_699487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047944994.1|699525_700146_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_047944993.1|700322_701999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047944992.1|702156_702726_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_047944991.1|702722_703193_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_047944990.1|703189_704275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800895.1|704359_705277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800894.1|705656_706616_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	31.0	2.9e-23
WP_061800893.1|706750_708118_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.6	8.7e-114
WP_061800891.1|708742_709726_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_061800890.1|710401_711571_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.0	9.3e-32
WP_061800889.1|711632_712097_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.6	5.3e-39
WP_082810107.1|712101_712431_-	helix-turn-helix transcriptional regulator	NA	R9TNF4	Paenibacillus_phage	66.3	4.5e-32
WP_061800888.1|712637_712862_+	hypothetical protein	NA	R9TME1	Paenibacillus_phage	50.0	8.0e-09
WP_061800887.1|712863_713136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800886.1|713269_713917_+	Rha family transcriptional regulator	NA	A0A2I7SCU0	Paenibacillus_phage	44.8	5.2e-32
WP_167555741.1|714141_714318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047943125.1|714334_714526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800885.1|714778_716293_+	AAA family ATPase	NA	A0A2H4J9G9	uncultured_Caudovirales_phage	77.4	2.3e-200
WP_061800884.1|716292_716724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053215722.1|716736_717636_+	recombinase RecT	NA	A0A2H4JA23	uncultured_Caudovirales_phage	84.1	3.6e-140
WP_061800883.1|717641_718388_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	80.2	5.8e-112
WP_061800882.1|718388_718754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082810106.1|718771_719662_+	replication protein	NA	A0A0K2CY89	Paenibacillus_phage	58.0	2.7e-39
WP_061800899.1|719639_720944_+	AAA family ATPase	NA	A0A2H4J268	uncultured_Caudovirales_phage	78.1	7.9e-197
WP_061800881.1|720956_721271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800880.1|721275_721833_+	hypothetical protein	NA	A0A2H4J564	uncultured_Caudovirales_phage	74.9	2.9e-76
WP_061800879.1|721835_722315_+	hypothetical protein	NA	A0A2H4J255	uncultured_Caudovirales_phage	74.8	1.7e-32
WP_061800878.1|722380_722731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800877.1|722854_723166_+	hypothetical protein	NA	A0A0S2MVE9	Bacillus_phage	59.2	7.7e-26
WP_061800876.1|723212_723446_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	52.0	1.6e-15
WP_061800875.1|723463_723739_+	hypothetical protein	NA	A0A0A0RPP5	Bacillus_phage	60.3	8.3e-16
WP_167555740.1|723735_723894_+	hypothetical protein	NA	A0A2H4J4Q1	uncultured_Caudovirales_phage	68.0	2.1e-11
WP_061800898.1|723975_724416_+	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	82.6	4.0e-60
WP_061800874.1|724557_725430_+	cation transporter	NA	NA	NA	NA	NA
WP_061800873.1|725854_726394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800872.1|726476_726824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485472.1|726864_727041_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	72.4	3.7e-17
WP_061800871.1|727596_727821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800870.1|727950_728847_+	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	56.2	3.0e-78
WP_156485471.1|729004_729151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485470.1|729210_729357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800869.1|729365_729575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061800868.1|729712_729958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061800867.1|730011_730407_+	hypothetical protein	NA	A0A2H4J9I7	uncultured_Caudovirales_phage	81.3	1.9e-29
WP_082810105.1|730393_730753_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	66.7	7.8e-38
WP_061800865.1|730878_731214_+	hypothetical protein	NA	D2XR14	Bacillus_phage	37.6	1.9e-09
WP_061800864.1|731210_732923_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	52.0	3.4e-163
WP_061800863.1|732944_734084_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	50.5	1.7e-107
WP_061800862.1|734080_734848_+|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	67.6	6.3e-77
WP_061800861.1|734869_736030_+|capsid	phage major capsid protein	capsid	A0A2H4J5D0	uncultured_Caudovirales_phage	48.1	1.1e-98
WP_061800897.1|736085_736349_+	hypothetical protein	NA	A0A059T7R0	Listeria_phage	61.8	1.1e-17
WP_061800860.1|736335_736704_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	46.2	1.6e-25
WP_061800859.1|736700_737093_+	hypothetical protein	NA	A0A2H4JA97	uncultured_Caudovirales_phage	50.4	4.7e-28
WP_061800858.1|737092_737476_+	DUF3168 domain-containing protein	NA	A0A059T681	Listeria_phage	30.3	9.6e-10
WP_047941202.1|737487_738093_+	hypothetical protein	NA	A0A2H4J4E0	uncultured_Caudovirales_phage	53.6	6.7e-50
WP_082810108.1|738127_738337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941201.1|738368_738719_+	hypothetical protein	NA	Q4ZD67	Staphylococcus_phage	51.3	5.5e-20
WP_061800856.1|738939_742467_+|tail	phage tail tape measure protein	tail	A0A1B2APW4	Phage_Wrath	26.0	4.7e-26
WP_047941199.1|742469_743174_+|tail	phage tail family protein	tail	A0A1B1P7Q0	Bacillus_phage	40.8	2.4e-38
WP_061800855.1|743173_747811_+|tail	phage tail protein	tail	Q8W5Z5	Listeria_phage	42.6	5.6e-80
WP_061800854.1|747873_748302_+	DUF1617 family protein	NA	NA	NA	NA	NA
WP_061800853.1|748301_748529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800852.1|748562_748967_+|holin	phage holin family protein	holin	A0A0A7RTU1	Clostridium_phage	33.6	3.2e-08
WP_061800851.1|749095_749998_+	peptidoglycan-binding protein	NA	A0A127AWA8	Bacillus_phage	51.8	2.8e-52
WP_061800850.1|750130_750319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061800849.1|750534_750897_-	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	52.1	5.8e-25
WP_061800848.1|750911_751241_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	52.8	6.0e-29
WP_061800847.1|751352_751571_+	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	45.1	1.9e-07
WP_061800846.1|751573_751834_+	YolD-like family protein	NA	A0A2I7SCS8	Paenibacillus_phage	48.7	6.7e-15
WP_061800845.1|751892_752264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156485469.1|752398_752548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082810102.1|753694_753838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941811.1|754296_755286_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_047941810.1|755547_755871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941809.1|756194_756941_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_047941808.1|757032_757236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941807.1|757385_757772_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_061800844.1|757866_759807_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	28.5	1.3e-67
WP_061800843.1|759823_760276_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047941804.1|760494_761655_+	radical SAM protein	NA	A0A0S2SXZ8	Bacillus_phage	68.0	9.3e-24
WP_061800842.1|761920_763219_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047941802.1|763294_764122_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_061800841.1|764121_765087_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_047941800.1|765293_767126_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_061800840.1|767106_768684_+	response regulator	NA	NA	NA	NA	NA
WP_047941798.1|768735_769335_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053215648.1|769584_771621_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_047941796.1|771740_771935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047941795.1|772068_772299_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_156485505.1|772651_774209_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	58.0	2.7e-71
WP_047941794.1|774309_774621_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047941793.1|774762_775617_+	VOC family protein	NA	NA	NA	NA	NA
WP_047941791.1|776829_777495_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_156485447.1|777664_779065_-	alkaline phosphatase	NA	NA	NA	NA	NA
777596:777619	attR	CCGTGTTTCCTATATCTCAGGAAA	NA	NA	NA	NA
WP_047941789.1|779212_779920_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_047941788.1|780033_781428_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_047941787.1|781530_782571_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_047941786.1|782753_782942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941785.1|783107_783824_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082138300.1|783826_783964_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_047941784.1|783960_784578_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_047941783.1|784581_785847_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_047941782.1|786445_786775_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095259380.1|786752_787328_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_047941780.1|787324_787945_+	NDxxF motif lipoprotein	NA	NA	NA	NA	NA
WP_144545838.1|788249_788924_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123258863.1|788945_789083_+	SapB/AmfS family lantipeptide	NA	NA	NA	NA	NA
WP_061799935.1|789145_791749_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_047941778.1|792981_794691_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.3	4.6e-80
WP_156485446.1|794874_795030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047941777.1|795588_798309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941776.1|798372_800022_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.1	2.1e-178
>prophage 4
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	1046380	1056376	5179558	integrase	Bacillus_phage(37.5%)	16	1044871:1044888	1060031:1060048
1044871:1044888	attL	TAGCTCAGTGGTAGAGCA	NA	NA	NA	NA
WP_061801081.1|1046380_1047349_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	50.5	2.6e-80
WP_061801080.1|1047609_1047999_+	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	37.4	6.3e-17
WP_061801079.1|1048327_1048708_+	DUF1642 domain-containing protein	NA	R4JGJ3	Bacillus_phage	30.8	2.2e-06
WP_156485483.1|1048803_1048977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801078.1|1048979_1049312_+	hypothetical protein	NA	A0A2H4J6U7	uncultured_Caudovirales_phage	37.8	5.9e-08
WP_061801077.1|1049304_1049712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801076.1|1049826_1050027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801075.1|1050039_1050240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801074.1|1050236_1050992_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	35.6	1.0e-23
WP_061801073.1|1050994_1051690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801072.1|1051686_1052442_+	hypothetical protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.1	7.8e-72
WP_061801070.1|1052638_1052857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801069.1|1052828_1053410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801068.1|1053624_1054971_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	59.0	8.0e-144
WP_082810122.1|1055132_1055270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082810121.1|1055323_1056376_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	47.3	1.3e-77
1060031:1060048	attR	TAGCTCAGTGGTAGAGCA	NA	NA	NA	NA
>prophage 5
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	1060340	1132480	5179558	portal,capsid,integrase,terminase,head,tail,transposase	Bacillus_phage(33.33%)	84	1107244:1107265	1137690:1137711
WP_061801062.1|1060340_1061135_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	38.9	3.3e-36
WP_156485480.1|1061151_1061307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801061.1|1061306_1061702_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	40.9	5.8e-18
WP_061801059.1|1061899_1064101_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	39.3	2.1e-125
WP_061801058.1|1064097_1064310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801057.1|1064310_1064937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801056.1|1064937_1065936_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.1	1.4e-76
WP_061801055.1|1065935_1066151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801084.1|1066174_1066642_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0N9ST03	Paenibacillus_phage	48.0	4.1e-07
WP_061801054.1|1066647_1066971_+	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	65.6	1.2e-18
WP_061801053.1|1067241_1067613_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	52.9	7.5e-28
WP_061801052.1|1067587_1069678_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	68.6	1.2e-282
WP_082810120.1|1069697_1070675_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	64.7	5.8e-120
WP_061801051.1|1070834_1071488_+	PhoH family protein	NA	F8WPX9	Bacillus_phage	43.0	3.4e-39
WP_061801050.1|1071481_1071769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172885260.1|1071775_1072258_+	HAD family hydrolase	NA	A0A0K2CNN3	Brevibacillus_phage	49.6	8.3e-27
WP_061801048.1|1072258_1072450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801047.1|1072450_1073239_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	66.0	3.4e-86
WP_061801046.1|1073240_1073498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801045.1|1073499_1073949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082810123.1|1073944_1074490_+	hypothetical protein	NA	J9Q953	Bacillus_phage	43.3	2.5e-35
WP_061801043.1|1074490_1075759_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2H4J169	uncultured_Caudovirales_phage	41.8	2.5e-94
WP_061801042.1|1075768_1076131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801041.1|1076213_1076621_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	40.2	6.8e-14
WP_061801040.1|1076617_1077007_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	40.4	3.5e-07
WP_061801039.1|1077248_1077806_+	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	51.7	1.3e-07
WP_061801038.1|1077802_1078045_+	hypothetical protein	NA	A0A0K2FMK5	Brevibacillus_phage	49.0	3.6e-15
WP_061801037.1|1078297_1078684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801036.1|1079464_1080019_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	50.5	5.2e-41
WP_061801035.1|1080081_1080516_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	55.6	2.2e-34
WP_061801034.1|1080532_1082239_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	51.3	7.7e-168
WP_061801033.1|1082260_1083829_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	49.4	3.2e-136
WP_061801032.1|1083874_1084444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801031.1|1084468_1084828_+|head	head decoration protein	head	A0A142F1L9	Bacillus_phage	51.9	1.4e-23
WP_061801030.1|1084867_1085884_+|capsid	major capsid protein	capsid	A0A142F1M0	Bacillus_phage	52.5	4.0e-95
WP_061801029.1|1085883_1086069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801028.1|1086081_1086453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801027.1|1086449_1087238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801026.1|1087239_1087638_+	hypothetical protein	NA	A0A142F1M4	Bacillus_phage	36.8	1.9e-13
WP_061801025.1|1087634_1087976_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_172885219.1|1088145_1088415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801023.1|1088414_1088849_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_061801022.1|1088893_1089259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485478.1|1089204_1089588_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_061801020.1|1089574_1091887_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	55.3	6.1e-83
WP_061801019.1|1091887_1092694_+|tail	phage tail family protein	tail	A0A0U4JNQ7	Bacillus_phage	27.9	3.7e-19
WP_061801018.1|1092710_1094420_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	29.3	9.2e-12
WP_061801017.1|1094488_1095652_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_061801016.1|1095658_1097530_+|tail	phage tail protein	tail	A0A0U4B063	Bacillus_phage	55.7	2.0e-145
WP_156485477.1|1097526_1097706_+	hypothetical protein	NA	A0A2H4J229	uncultured_Caudovirales_phage	58.6	3.4e-10
WP_061801015.1|1097727_1097940_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	50.0	8.1e-11
WP_061801014.1|1097939_1099085_+	LysM peptidoglycan-binding domain-containing protein	NA	A9QTG1	Bacillus_phage	66.0	5.0e-70
WP_061801013.1|1099111_1099300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801012.1|1099397_1099805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801011.1|1099885_1100191_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	49.5	1.5e-18
WP_061801010.1|1100472_1101297_+	ParM/StbA family protein	NA	E5DV70	Deep-sea_thermophilic_phage	48.6	4.4e-68
WP_061801009.1|1101280_1101499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801008.1|1101648_1101999_+	hypothetical protein	NA	W8EK86	Geobacillus_phage	50.0	2.7e-19
WP_061801007.1|1102019_1102253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801006.1|1102234_1104853_+	hypothetical protein	NA	W8EEX6	Geobacillus_phage	43.3	1.3e-201
WP_167555744.1|1104855_1105020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801005.1|1105012_1105357_+	YolD-like family protein	NA	O64030	Bacillus_phage	35.4	9.8e-14
WP_061801082.1|1105379_1105598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061801004.1|1105830_1106037_-	helix-turn-helix transcriptional regulator	NA	A0A0A0RMC4	Bacillus_phage	53.2	3.5e-11
WP_061801003.1|1106160_1106976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1107244:1107265	attL	GGTATCATTAGATTAATTTATG	NA	NA	NA	NA
WP_061801288.1|1107384_1108494_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	63.1	5.2e-133
WP_061801287.1|1108593_1108914_-	DUF771 domain-containing protein	NA	A0A2H4J5V1	uncultured_Caudovirales_phage	42.5	9.7e-08
WP_061801286.1|1109391_1110210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801285.1|1110247_1111021_+	DUF1385 domain-containing protein	NA	NA	NA	NA	NA
WP_054788369.1|1111278_1111587_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061801284.1|1112010_1112361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061801283.1|1112538_1113609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801282.1|1113608_1114232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485496.1|1114345_1114549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801280.1|1115269_1119076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801279.1|1119158_1120562_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_061801278.1|1120575_1121262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801277.1|1121889_1124451_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.9	4.3e-106
WP_061801276.1|1124450_1125689_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.0	5.6e-19
WP_061801275.1|1125704_1128794_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_172885261.1|1128908_1129835_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.3	1.1e-40
WP_061801336.1|1130025_1131315_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	32.5	2.0e-43
WP_061801337.1|1131314_1132073_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.3e-53
WP_172885220.1|1132048_1132480_-|transposase	transposase	transposase	NA	NA	NA	NA
1137690:1137711	attR	GGTATCATTAGATTAATTTATG	NA	NA	NA	NA
>prophage 6
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	1831915	1839340	5179558	protease	Bacillus_phage(28.57%)	10	NA	NA
WP_047941540.1|1831915_1832128_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	32.9	1.0e-05
WP_047941542.1|1832367_1833249_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047941543.1|1833451_1834111_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.6e-68
WP_061799655.1|1834115_1834598_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	75.5	5.9e-65
WP_061799649.1|1834590_1835319_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	46.2	2.2e-55
WP_047941547.1|1835351_1835915_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.5	2.5e-46
WP_061799647.1|1836049_1836556_+	RNA polymerase sigma factor	NA	A0A1V0DZZ1	Clostridioides_phage	36.8	2.2e-14
WP_061799645.1|1836545_1837244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047941551.1|1837285_1838677_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_061799641.1|1838860_1839340_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.7	1.1e-23
>prophage 7
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	2764753	2814428	5179558	portal,capsid,integrase,terminase,head,tail,holin	Bacillus_phage(36.17%)	82	2762350:2762366	2781266:2781282
2762350:2762366	attL	GAATTAGAAAGTATATT	NA	NA	NA	NA
WP_061795921.1|2764753_2765875_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	44.0	5.2e-80
WP_061795923.1|2766130_2766484_-	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	29.6	2.5e-12
WP_061795926.1|2766865_2767087_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061795931.1|2767123_2767327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795934.1|2767361_2767589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795938.1|2767699_2769700_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	55.2	1.7e-190
WP_061795941.1|2769701_2769950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795943.1|2769946_2770207_+	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	45.2	7.1e-17
WP_061795945.1|2770228_2771140_+	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	77.5	1.1e-109
WP_061795947.1|2771136_2771838_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	74.7	2.1e-103
WP_156485365.1|2771889_2772057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795949.1|2772053_2772461_+	hypothetical protein	NA	Q5YA89	Bacillus_phage	47.0	7.2e-24
WP_061795955.1|2772457_2772808_+	hypothetical protein	NA	A0A219VG58	Leuconostoc_phage	38.3	5.5e-12
WP_061795960.1|2772804_2773086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795965.1|2773154_2773334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485366.1|2773353_2773500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795971.1|2773949_2774261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795973.1|2774276_2774642_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	49.6	1.4e-23
WP_172885266.1|2775257_2775545_+	DUF3310 domain-containing protein	NA	A0A0U4IIT9	Bacillus_phage	80.0	1.4e-29
WP_167555717.1|2775541_2775709_+	hypothetical protein	NA	R4JF30	Bacillus_phage	66.7	1.0e-08
WP_061795977.1|2775705_2776059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795979.1|2776061_2776334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795981.1|2776345_2776837_+	hypothetical protein	NA	O64162	Bacillus_phage	48.1	8.7e-40
WP_061795983.1|2776836_2777052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795985.1|2777051_2777288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795987.1|2777309_2777504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082809979.1|2777592_2777802_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061795989.1|2777832_2778078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061795991.1|2778285_2778498_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061796531.1|2778639_2779305_+	ORF6N domain-containing protein	NA	A0A0S2SXM6	Bacillus_phage	62.1	2.6e-71
WP_061795992.1|2779318_2779621_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	39.4	8.3e-09
WP_082809980.1|2780377_2781295_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	40.7	8.6e-49
2781266:2781282	attR	GAATTAGAAAGTATATT	NA	NA	NA	NA
WP_156485368.1|2781306_2781468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061795999.1|2781467_2781725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485369.1|2781702_2781855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796001.1|2781861_2782131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796002.1|2782216_2782789_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_061796006.1|2783049_2783577_+	HNH endonuclease	NA	A0A1B1INA7	uncultured_Mediterranean_phage	43.6	2.4e-11
WP_061796008.1|2783566_2784028_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	63.6	1.3e-45
WP_061796009.1|2784047_2784341_+	hypothetical protein	NA	A0A0E3M1D5	Bacillus_phage	47.3	4.4e-15
WP_156485370.1|2784441_2784615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796012.1|2784592_2784787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172885237.1|2784874_2785330_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	79.2	1.4e-68
WP_061796016.1|2785342_2785618_+	hypothetical protein	NA	A0A0Y0ATQ5	Bacillus_phage	47.2	3.1e-10
WP_061796018.1|2785614_2786247_+	dUTP diphosphatase	NA	A0A2H4J260	uncultured_Caudovirales_phage	50.0	8.9e-45
WP_061796020.1|2786257_2786500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796022.1|2786620_2787025_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	66.9	3.4e-42
WP_061796024.1|2787149_2787638_+	hypothetical protein	NA	A0A0U3TGS2	Bacillus_phage	45.3	3.8e-27
WP_061796026.1|2787640_2788063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796028.1|2788115_2788376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796030.1|2788429_2788885_+	hypothetical protein	NA	A0A0U4II82	Bacillus_phage	29.9	8.1e-08
WP_061796032.1|2789670_2790591_+|terminase	terminase small subunit	terminase	A0A0A7RTY1	Clostridium_phage	51.0	6.6e-73
WP_061796034.1|2790559_2791906_+|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	80.0	3.6e-205
WP_061796037.1|2791917_2793234_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	42.3	1.4e-79
WP_061796039.1|2793310_2793991_+	DUF4355 domain-containing protein	NA	A0A2H4J4U9	uncultured_Caudovirales_phage	47.7	9.9e-18
WP_061796041.1|2794004_2794376_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	69.9	6.6e-40
WP_061796042.1|2794393_2795440_+|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	80.8	2.3e-159
WP_061796047.1|2795487_2795727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796049.1|2795716_2796085_+|head,tail	phage head-tail connector protein	head,tail	A0A0A7RTF6	Clostridium_phage	35.0	4.0e-05
WP_061796052.1|2796081_2797203_+|capsid	phage minor capsid protein	capsid	A0A1B1P858	Bacillus_phage	56.1	1.5e-103
WP_061796054.1|2797216_2797555_+	hypothetical protein	NA	A0A1B1P893	Bacillus_phage	37.1	1.1e-14
WP_061796056.1|2797551_2797902_+|capsid	minor capsid protein	capsid	B5LPR8	Bacillus_virus	50.9	1.2e-27
WP_053215779.1|2797898_2798291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796058.1|2798293_2798749_+	hypothetical protein	NA	A5GYM5	Lactococcus_phage	47.7	3.4e-30
WP_061796063.1|2798763_2799147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485371.1|2799151_2799799_+	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	39.2	1.5e-26
WP_061796070.1|2799799_2803213_+	tape measure protein	NA	A0A059T7P2	Listeria_phage	60.8	8.4e-81
WP_061796072.1|2803209_2803923_+|tail	phage tail family protein	tail	D2XPZ5	Bacillus_virus	31.2	1.0e-17
WP_156485372.1|2803924_2804098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796074.1|2804123_2804339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061796076.1|2804420_2809226_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	43.4	2.4e-81
WP_156485373.1|2809287_2809719_+	hypothetical protein	NA	Q5YA56	Bacillus_phage	44.7	2.3e-20
WP_061796080.1|2809718_2809952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796082.1|2810015_2810378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061796084.1|2810393_2810663_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	61.6	2.0e-22
WP_061796087.1|2810719_2811700_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	52.4	8.3e-50
WP_061796089.1|2812211_2812457_+	hypothetical protein	NA	A0A290FZJ4	Caldibacillus_phage	50.7	1.0e-12
WP_061796091.1|2812844_2813201_-	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	34.2	8.9e-10
WP_061796094.1|2813215_2813545_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	51.9	1.8e-28
WP_156485374.1|2813558_2813843_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_061796099.1|2813946_2814165_+	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	43.7	2.5e-07
WP_061796101.1|2814167_2814428_+	YolD-like family protein	NA	A0A2I7SCS8	Paenibacillus_phage	50.0	1.5e-14
>prophage 8
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	3501480	3550889	5179558	portal,capsid,terminase,tail,transposase,holin	Bacillus_phage(30.95%)	62	NA	NA
WP_061801334.1|3501480_3502980_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	26.7	3.9e-30
WP_061801332.1|3504038_3504527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801331.1|3504860_3505460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485505.1|3505857_3507415_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	58.0	2.7e-71
WP_061801175.1|3507597_3508161_+	DUF5067 domain-containing protein	NA	A0A1W6JND4	Staphylococcus_phage	34.1	5.9e-08
WP_061801174.1|3508208_3508469_-	YolD-like family protein	NA	A0A2I7SCS8	Paenibacillus_phage	45.9	3.7e-13
WP_061801173.1|3508471_3508690_-	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	45.1	1.9e-07
WP_061801172.1|3508797_3509127_+	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	54.1	4.6e-29
WP_061801171.1|3509141_3509504_+	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	49.6	2.9e-24
WP_156485490.1|3509469_3509613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801170.1|3509782_3510736_+	hypothetical protein	NA	A0A1S5SBK8	Streptococcus_phage	28.0	2.5e-19
WP_061801169.1|3510719_3510920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167555746.1|3511074_3511299_-	LysM peptidoglycan-binding domain-containing protein	NA	B6D7J9	Listeria_phage	47.8	1.1e-05
WP_061801168.1|3511969_3512368_-|holin	phage holin family protein	holin	Q2I8E7	Bacillus_phage	49.2	4.4e-34
WP_061801167.1|3512402_3512630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801166.1|3512629_3513061_-	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	36.1	5.7e-11
WP_061801165.1|3513123_3517998_-|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	43.0	1.2e-83
WP_172885241.1|3518034_3518748_-|tail	phage tail family protein	tail	D2XPZ5	Bacillus_virus	30.5	1.0e-17
WP_082810127.1|3518744_3522158_-	tape measure protein	NA	A0A059T7P2	Listeria_phage	58.3	1.1e-69
WP_061801162.1|3522158_3522797_-	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	41.2	9.0e-29
WP_061801161.1|3522810_3523194_-	hypothetical protein	NA	A0A2H4JH35	uncultured_Caudovirales_phage	29.6	1.7e-06
WP_061801160.1|3523208_3523661_-	hypothetical protein	NA	A5GYM5	Lactococcus_phage	47.7	2.6e-30
WP_061801159.1|3523663_3524056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801158.1|3524052_3524403_-|capsid	minor capsid protein	capsid	B5LPR8	Bacillus_virus	51.7	9.3e-28
WP_061801157.1|3524399_3524741_-	hypothetical protein	NA	A0A1B1P893	Bacillus_phage	34.2	8.2e-13
WP_156485489.1|3524733_3525135_-	hypothetical protein	NA	A0A1B1P889	Bacillus_phage	42.4	2.4e-19
WP_061801155.1|3525134_3525431_-	hypothetical protein	NA	A0A1B1P891	Bacillus_phage	62.7	6.0e-12
WP_061801154.1|3525465_3526371_-	hypothetical protein	NA	B5LPR4	Bacillus_virus	64.1	1.3e-105
WP_061801152.1|3527408_3528506_-|capsid	phage minor capsid protein	capsid	A0A1B1P858	Bacillus_phage	53.5	1.9e-103
WP_061801151.1|3528502_3529993_-|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	63.5	5.5e-170
WP_061801150.1|3530007_3531303_-|terminase	PBSX family phage terminase large subunit	terminase	B5LPR0	Bacillus_virus	82.5	2.3e-212
WP_061801149.1|3531289_3532207_-|terminase	terminase small subunit	terminase	M4ZS05	Bacillus_phage	43.5	3.0e-57
WP_061801148.1|3532286_3532556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801147.1|3532974_3533430_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	59.6	2.3e-47
WP_047944080.1|3533433_3533619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801146.1|3533715_3534462_-	UPF0489 family protein	NA	NA	NA	NA	NA
WP_047944078.1|3534458_3534659_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	71.2	2.9e-18
WP_047944077.1|3534825_3535293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047944076.1|3535435_3536017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047944075.1|3536948_3537491_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	39.1	4.2e-27
WP_047944074.1|3537515_3537905_-	hypothetical protein	NA	A0A0Y0AFD7	Bacillus_phage	46.5	1.1e-24
WP_047944073.1|3538035_3538419_+	VOC family protein	NA	NA	NA	NA	NA
WP_162837593.1|3538700_3538862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047944072.1|3538945_3539308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801145.1|3539320_3540127_-	DNA adenine methylase	NA	R4IBV6	Listeria_phage	51.2	3.6e-67
WP_047944069.1|3540340_3540742_+	VOC family protein	NA	NA	NA	NA	NA
WP_047944068.1|3540840_3541614_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	58.7	9.4e-81
WP_061801144.1|3541715_3542273_-	hypothetical protein	NA	Q3HKY3	Bacillus_phage	34.9	4.6e-21
WP_082810126.1|3542326_3542830_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	65.0	2.8e-41
WP_061801143.1|3542849_3543695_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_053215775.1|3543699_3544158_-	HNH endonuclease	NA	A0A2K9VH78	Gordonia_phage	51.7	5.7e-09
WP_061801142.1|3544337_3545216_-	recombinase RecT	NA	A8ATY6	Listeria_phage	64.4	4.3e-90
WP_061801141.1|3545215_3546163_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	63.9	2.6e-109
WP_061801140.1|3546266_3546479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167555745.1|3546685_3546841_-	hypothetical protein	NA	A0A1B1P7M3	Bacillus_phage	51.1	4.9e-05
WP_061801139.1|3546854_3547118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801138.1|3547120_3547750_-	helix-turn-helix domain-containing protein	NA	D2XR41	Bacillus_phage	38.5	4.0e-29
WP_061801137.1|3547798_3548500_-	ORF6C domain-containing protein	NA	A0A0S2SXM6	Bacillus_phage	38.8	4.9e-44
WP_061801136.1|3548785_3549061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047944055.1|3549382_3549571_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047944054.1|3549730_3550144_+	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	48.6	3.4e-29
WP_061801135.1|3550310_3550889_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2JY13	Aeribacillus_phage	58.5	3.5e-56
>prophage 9
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	3645485	3704405	5179558	coat,protease,transposase,tRNA	Bacillus_virus(28.57%)	50	NA	NA
WP_061801225.1|3645485_3645818_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_016201698.1|3645830_3646139_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_082810135.1|3646314_3647748_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_172885267.1|3647894_3648686_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_047943603.1|3648753_3649524_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_047943602.1|3649773_3650577_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_047943601.1|3650578_3651256_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_047943600.1|3651855_3652371_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_047943599.1|3652367_3653258_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_047943598.1|3653279_3654302_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_095258089.1|3654470_3655154_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_061801229.1|3655214_3655793_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_061801230.1|3656100_3657201_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_061801231.1|3657302_3657758_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_061801232.1|3657788_3658553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047943593.1|3658549_3659200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047943592.1|3659202_3660195_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_047943591.1|3660262_3661009_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_047943590.1|3661024_3661453_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_047943589.1|3661556_3662762_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_061801233.1|3662764_3663805_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_061801234.1|3663816_3665481_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_061801235.1|3665508_3666867_-	VanW family protein	NA	NA	NA	NA	NA
WP_061801236.1|3666886_3667621_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_061801237.1|3667633_3668995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061801238.1|3669151_3669646_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_047943582.1|3669629_3670211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061801239.1|3670225_3672274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156485505.1|3672426_3673984_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	58.0	2.7e-71
WP_061798656.1|3674111_3676964_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_082138389.1|3677231_3678785_-	cofactor assembly of complex C subunit B	NA	A0A127AWB9	Bacillus_phage	34.8	8.1e-15
WP_061798658.1|3679129_3680431_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_061798660.1|3680576_3683222_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	1.5e-162
WP_047943613.1|3683685_3684738_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_047943577.1|3684965_3686189_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_061798662.1|3686484_3687237_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_061798664.1|3687247_3688213_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061798789.1|3688499_3689240_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_061798666.1|3689248_3689992_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	42.4	3.5e-40
WP_061798668.1|3690198_3691488_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_047943572.1|3691502_3692477_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_061798672.1|3692492_3693257_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_061798674.1|3693249_3694185_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_047943569.1|3694223_3695048_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_061798676.1|3695253_3696603_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_061798678.1|3696969_3697458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047943566.1|3697634_3698222_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_047943565.1|3698218_3700546_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	2.9e-178
WP_047943564.1|3701069_3702743_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	34.5	9.6e-14
WP_047943563.1|3703139_3704405_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.5	8.6e-148
>prophage 10
NZ_CP053989	Bacillus circulans strain FDAARGOS_783 chromosome, complete genome	5179558	4512312	4523586	5179558		Enterobacteria_phage(57.14%)	9	NA	NA
WP_047944452.1|4512312_4513332_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	8.9e-79
WP_061798109.1|4513332_4514187_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.3	7.5e-39
WP_061798112.1|4514183_4514750_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.8	2.8e-42
WP_047942549.1|4514770_4515649_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.9	3.1e-104
WP_061798114.1|4516137_4517673_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.1	4.7e-07
WP_047944455.1|4517673_4517871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061798116.1|4518022_4518967_-	LCP family protein	NA	NA	NA	NA	NA
WP_156485411.1|4519725_4520463_+	SCP-like extracellular protein	NA	A0A0E3T7R5	Bacillus_phage	55.0	2.8e-34
WP_061798118.1|4520550_4523586_-	glucosaminidase domain-containing protein	NA	Q4ZC50	Staphylococcus_virus	45.6	1.7e-37
