The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053987	Achromobacter denitrificans strain FDAARGOS_786 chromosome, complete genome	6736870	2833926	2871155	6736870	terminase,tail,head,holin,portal,integrase,capsid,protease	Pseudomonas_phage(22.73%)	54	2833787:2833837	2874938:2874988
2833787:2833837	attL	CCCGGATTGTGATTCCGGTTGTCGTGGGTTCGAGCCCCATCAGCCACCCCA	NA	NA	NA	NA
WP_062681424.1|2833926_2834967_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075873261.1|2834966_2835188_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_062681423.1|2835276_2836356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681422.1|2836357_2836600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681421.1|2836721_2836967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681420.1|2836966_2837347_-	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	51.3	5.0e-27
WP_062681419.1|2837343_2837724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681418.1|2837720_2838230_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	51.5	1.0e-11
WP_131828722.1|2838226_2839183_-	hypothetical protein	NA	A0A0U4JP11	Pseudomonas_phage	40.5	5.6e-43
WP_131828721.1|2839238_2839526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681416.1|2839552_2839786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172600295.1|2840094_2840298_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.2e-14
WP_131828720.1|2840380_2841301_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062681413.1|2841461_2842403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681412.1|2842943_2843627_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.1	3.4e-34
WP_075873259.1|2843713_2843911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131828719.1|2843924_2844173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131828718.1|2844367_2844658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681410.1|2844741_2845257_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	38.1	8.9e-27
WP_062681409.1|2845250_2845556_+	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	33.7	1.3e-06
WP_062681408.1|2845548_2845854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681407.1|2845844_2846327_+	DUF1364 family protein	NA	Q8W6N7	Burkholderia_virus	53.7	7.8e-17
WP_131828717.1|2846323_2847169_+	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	50.9	6.3e-46
WP_062681405.1|2847140_2847899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681404.1|2847904_2848318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075873257.1|2848317_2848995_+	hypothetical protein	NA	Q3HR05	Burkholderia_phage	48.2	3.5e-31
WP_172871166.1|2849009_2849921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062681402.1|2850383_2850755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165695612.1|2850874_2851105_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_062681401.1|2851215_2851644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681400.1|2851621_2853391_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	74.7	1.8e-265
WP_062681399.1|2853387_2854686_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	61.4	1.2e-144
WP_062681398.1|2854697_2855567_+|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	52.7	2.6e-79
WP_062681397.1|2855577_2856756_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	53.8	3.9e-102
WP_062681396.1|2856803_2857028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681395.1|2857030_2857360_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	57.4	1.0e-20
WP_062681467.1|2857359_2857734_+|head,tail	head-tail adaptor protein	head,tail	H2BDB4	Pseudomonas_virus	50.8	2.6e-28
WP_156494253.1|2857799_2857955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681394.1|2857951_2858437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681393.1|2858436_2858808_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075873267.1|2858869_2859367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681391.1|2859377_2859710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681390.1|2859781_2860039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681389.1|2860072_2863033_+|tail	phage tail tape measure protein	tail	A5H1M1	Xanthomonas_virus	32.5	6.0e-27
WP_062681388.1|2863034_2863382_+	hypothetical protein	NA	Q2NPH3	Xanthomonas_virus	33.3	2.1e-08
WP_062681387.1|2863383_2863860_+	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	25.9	9.1e-10
WP_062681386.1|2863861_2864248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681385.1|2864235_2868192_+	hypothetical protein	NA	I7HDJ4	Xanthomonas_virus	29.1	9.2e-47
WP_062681384.1|2868193_2868865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681383.1|2868864_2869383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681382.1|2869461_2869815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062681381.1|2869825_2870095_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_062681380.1|2870091_2870625_+	hypothetical protein	NA	A0A0H5AXX8	Pseudomonas_phage	47.7	7.5e-29
WP_062681466.1|2870651_2871155_+	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	37.8	2.2e-06
2874938:2874988	attR	CCCGGATTGTGATTCCGGTTGTCGTGGGTTCGAGCCCCATCAGCCACCCCA	NA	NA	NA	NA
>prophage 2
NZ_CP053987	Achromobacter denitrificans strain FDAARGOS_786 chromosome, complete genome	6736870	4113573	4121975	6736870	tRNA	Moraxella_phage(28.57%)	9	NA	NA
WP_062682610.1|4113573_4114158_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.0	3.3e-22
WP_062682555.1|4114334_4114709_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	28.9	5.5e-10
WP_062682556.1|4114851_4115856_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062682557.1|4116083_4117376_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.6	9.3e-65
WP_062682558.1|4117498_4118530_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	2.1e-91
WP_062682559.1|4118720_4119359_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_062682560.1|4119538_4120297_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	4.9e-66
WP_062682561.1|4120281_4121106_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	4.3e-31
WP_062682562.1|4121123_4121975_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.2	4.9e-14
>prophage 3
NZ_CP053987	Achromobacter denitrificans strain FDAARGOS_786 chromosome, complete genome	6736870	5870409	5894116	6736870		Pseudomonas_phage(43.75%)	36	NA	NA
WP_062682989.1|5870409_5871507_-	DUF4043 family protein	NA	A0A0S3UG53	Pseudomonas_phage	25.0	2.7e-12
WP_075873244.1|5871518_5872271_-	lipase chaperone	NA	NA	NA	NA	NA
WP_062682991.1|5872382_5874452_-	hypothetical protein	NA	A0A248SKZ2	Klebsiella_phage	26.0	1.4e-33
WP_062682992.1|5874448_5875894_-	hypothetical protein	NA	X5IGD1	Pseudomonas_phage	38.0	7.4e-79
WP_062682993.1|5875835_5876294_-	hypothetical protein	NA	A0A2I7RPR2	Vibrio_phage	34.3	2.0e-09
WP_131828710.1|5876388_5876838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131828711.1|5876843_5877026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062682995.1|5877124_5877547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082775836.1|5877543_5877918_-	hypothetical protein	NA	R9ZZU8	Cellulophaga_phage	63.5	1.9e-31
WP_062682996.1|5878286_5878502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062682997.1|5878504_5879860_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	36.0	5.9e-62
WP_131828712.1|5879856_5880774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062683065.1|5880770_5881175_-	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	50.9	1.6e-23
WP_082775832.1|5881167_5881785_-	HNH endonuclease	NA	A0A2I7RT07	Vibrio_phage	40.0	1.1e-20
WP_062683000.1|5881784_5882240_-	recombination protein NinB	NA	NA	NA	NA	NA
WP_087881359.1|5882241_5882508_-	DNA-binding protein	NA	E5E3P2	Burkholderia_phage	51.9	9.5e-17
WP_156494257.1|5882618_5882792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062683002.1|5882897_5883173_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_062683003.1|5883174_5883369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062683004.1|5883391_5883685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165695611.1|5883683_5884112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_131828714.1|5884593_5885109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082775834.1|5885278_5886064_+	pentapeptide repeat-containing protein	NA	A0A2P9HXG2	Yersinia_phage	56.9	5.7e-09
WP_062683005.1|5886101_5886347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088146988.1|5886349_5886718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062683007.1|5886803_5887169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087881360.1|5887168_5887336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062683008.1|5887337_5888438_+	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	46.7	7.7e-36
WP_087881363.1|5888538_5889219_+	ERF family protein	NA	B5WZW4	Pseudomonas_phage	92.5	2.9e-78
WP_062683009.1|5889218_5889854_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	38.5	2.0e-20
WP_062683010.1|5890802_5891045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131828715.1|5891041_5892019_+	hypothetical protein	NA	A0A2H5BQE8	Pseudomonas_phage	77.0	1.2e-37
WP_062683012.1|5892011_5892524_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	66.0	9.7e-58
WP_062683013.1|5892516_5892702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062683014.1|5892698_5892896_+	excisionase family protein	NA	NA	NA	NA	NA
WP_062683015.1|5892892_5894116_+	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	37.7	4.8e-63
