The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053981	Bacillus thuringiensis strain FDAARGOS_793 chromosome, complete genome	5256259	1199325	1207702	5256259		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|1199325_1200633_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|1200721_1201441_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278823.1|1201433_1201688_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666777.1|1201684_1202368_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|1202351_1204571_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|1204555_1205971_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|1206077_1207118_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|1207114_1207702_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 2
NZ_CP053981	Bacillus thuringiensis strain FDAARGOS_793 chromosome, complete genome	5256259	2756328	2765647	5256259		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|2756328_2757591_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194301.1|2757689_2758454_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453763.1|2758694_2760455_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_171856546.1|2760516_2761221_+	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_001231497.1|2761217_2762291_+	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_000823554.1|2762315_2762903_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|2763099_2763819_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103838.1|2763968_2764640_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_001258513.1|2764774_2765647_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
>prophage 3
NZ_CP053981	Bacillus thuringiensis strain FDAARGOS_793 chromosome, complete genome	5256259	3543913	3551119	5256259		Geobacillus_phage(33.33%)	9	NA	NA
WP_001065246.1|3543913_3545281_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000720567.1|3545718_3546237_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001093444.1|3546446_3546833_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655496.1|3546898_3547606_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_000994639.1|3547627_3547981_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288934.1|3547994_3548399_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714651.1|3548646_3550032_+	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.5	1.1e-76
WP_000820167.1|3550034_3550247_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000540634.1|3550312_3551119_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 4
NZ_CP053981	Bacillus thuringiensis strain FDAARGOS_793 chromosome, complete genome	5256259	5084725	5145801	5256259	tRNA,bacteriocin,integrase,coat,protease	Bacillus_phage(33.33%)	53	5103171:5103190	5139181:5139200
WP_000125362.1|5084725_5085865_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354030.1|5085877_5086930_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|5086949_5087150_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344460.1|5087146_5088148_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000464508.1|5088153_5088771_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|5088959_5089904_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871185.1|5089916_5090447_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001079930.1|5090567_5091497_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000426920.1|5091564_5091885_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000721241.1|5092330_5092765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093533.1|5092798_5093443_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000690816.1|5093621_5095469_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025291.1|5095843_5096950_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092246.1|5096980_5097814_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138561.1|5097833_5099363_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|5099515_5100655_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|5100657_5101200_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510428.1|5101281_5101929_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|5102010_5102862_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026353.1|5102958_5104875_-	ABC transporter permease	NA	NA	NA	NA	NA
5103171:5103190	attL	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_001011372.1|5104924_5106847_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|5106821_5107598_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865391.1|5107691_5108774_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|5108763_5109471_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|5109610_5110897_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|5110896_5111445_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|5111508_5111799_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|5111802_5112147_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|5112158_5112467_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855457.1|5112636_5114025_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599073.1|5114092_5114953_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|5114945_5115692_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|5115825_5116623_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|5116625_5117312_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|5117347_5117893_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|5117907_5118759_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|5118800_5119820_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000366809.1|5120254_5121676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907107.1|5121635_5124677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913003.1|5124706_5126470_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001087615.1|5126456_5127209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081956.1|5128765_5130133_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000051680.1|5130160_5132353_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
WP_000849670.1|5132562_5132739_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001089676.1|5132761_5132968_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001212906.1|5133876_5134998_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000682196.1|5135404_5136706_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001013372.1|5137741_5138368_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226277.1|5138414_5138990_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360976.1|5139211_5140174_-	hypothetical protein	NA	NA	NA	NA	NA
5139181:5139200	attR	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_000582048.1|5140339_5141641_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072246.1|5141734_5144380_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	8.0e-164
WP_000366997.1|5144775_5145801_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
>prophage 1
NZ_CP053982	Bacillus thuringiensis strain FDAARGOS_793 plasmid unnamed1, complete sequence	55939	1465	46519	55939	plate,terminase,tail,portal,capsid	Bacillus_phage(57.78%)	63	NA	NA
WP_000128985.1|1465_2056_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.7	2.3e-10
WP_000473803.1|2166_2430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272608.1|2925_4191_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.6	1.7e-108
WP_001057807.1|4187_4529_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000249931.1|4698_5607_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001173690.1|5619_5973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001266380.1|6169_6931_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	1.3e-122
WP_001131587.1|6930_7155_-	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	79.4	5.2e-24
WP_000151216.1|7157_7439_-	hypothetical protein	NA	D2XR31	Bacillus_phage	84.9	4.8e-35
WP_001152008.1|7480_8149_-	hypothetical protein	NA	A0A2H4J9X9	uncultured_Caudovirales_phage	74.8	7.9e-52
WP_042329765.1|8163_9753_-|plate	BppU family phage baseplate upper protein	plate	D2XPZ7	Bacillus_virus	41.4	2.9e-76
WP_000222205.1|9813_10080_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000289463.1|10089_11937_-|tail	phage tail protein	tail	A0A2P1JTV8	Anoxybacillus_phage	44.2	2.9e-128
WP_000383069.1|11948_12830_-|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.6	1.7e-73
WP_000235292.1|12829_15556_-	hypothetical protein	NA	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_001229383.1|15571_15832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001210040.1|15909_16326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000852141.1|16391_16856_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000273213.1|16870_17272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168162.1|17274_17766_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.9	1.1e-39
WP_000056960.1|17750_18143_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_001128458.1|18142_18532_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	3.2e-21
WP_001131834.1|18537_18720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059035.1|18736_19654_-|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	34.8	1.2e-45
WP_000746379.1|19669_20857_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	46.5	2.8e-76
WP_001169137.1|20903_21830_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.3	4.5e-45
WP_000182666.1|21816_23355_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	38.6	1.3e-94
WP_042513780.1|23354_24671_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	71.0	2.5e-182
WP_000113786.1|24642_25572_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	91.1	8.2e-132
WP_000504255.1|26128_26953_-	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	60.6	1.2e-73
WP_000583549.1|26965_27550_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	6.5e-26
WP_000393224.1|28052_28283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432046.1|28371_28698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042329745.1|29773_30160_-	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	97.7	7.5e-63
WP_000529718.1|30297_30927_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.8	5.9e-49
WP_001114345.1|30929_31109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001292053.1|31133_31322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784801.1|31324_31522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000455713.1|32918_33518_-	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	45.6	1.9e-44
WP_011731650.1|33558_33768_-	hypothetical protein	NA	I1TLG8	Bacillus_phage	95.7	2.0e-33
WP_000932236.1|33805_34303_-	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	31.1	1.0e-16
WP_000712437.1|34307_34484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201869.1|34494_34776_-	glutaredoxin family protein	NA	M4W5X4	Bacillus_phage	56.3	1.1e-15
WP_000434347.1|35078_35219_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	93.5	3.8e-17
WP_000219525.1|35227_35941_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	51.4	4.1e-38
WP_000811957.1|35952_36216_-	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_011731652.1|36212_36500_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	80.0	6.4e-35
WP_000332351.1|36414_36678_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_041184387.1|36690_37572_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000073890.1|37522_38338_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_000487938.1|38338_38560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043060.1|38759_39434_-	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000780697.1|39430_39913_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_000655888.1|39925_40075_-	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	72.1	1.8e-09
WP_001006520.1|40532_41303_-	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_080011779.1|41342_41564_-	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_000578778.1|41695_42046_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_000721629.1|42366_42516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189353.1|42555_43704_-	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000859163.1|44200_44548_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_000448836.1|44752_45457_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000831284.1|45476_45821_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000451516.1|45955_46519_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
