The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	0	13808	5342923	protease,tRNA	Moraxella_phage(28.57%)	11	NA	NA
WP_000833093.1|582_1908_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_162837124.1|2292_3834_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_001995187.1|4499_4955_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000483524.1|4978_6019_-	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	51.0	9.5e-36
WP_001029999.1|6305_7940_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|7978_8263_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
WP_000745337.1|8664_9414_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001246201.1|9410_9602_+	YdiK family protein	NA	NA	NA	NA	NA
WP_000437706.1|9631_10261_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001995178.1|10394_12371_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	3.4e-50
WP_000414598.1|12791_13808_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.8	7.0e-68
>prophage 2
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	24911	25262	5342923		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000635963.1|24911_25262_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	4.9e-13
>prophage 3
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	30334	31921	5342923		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_000206587.1|30334_31921_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
>prophage 4
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	35131	36403	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001995163.1|35131_36403_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.7	3.9e-15
>prophage 5
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	43819	45762	5342923		Planktothrix_phage(100.0%)	2	NA	NA
WP_001294488.1|43819_44785_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.4e-20
WP_000030783.1|44781_45762_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.9e-17
>prophage 6
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	50398	52279	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001995177.1|50398_52279_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	32.8	1.7e-46
>prophage 7
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	60144	60981	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000248042.1|60144_60981_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	3.6e-46
>prophage 8
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	70487	72936	5342923		Sinorhizobium_phage(33.33%)	3	NA	NA
WP_042329063.1|70487_71138_-	nicotinamide mononucleotide transporter	NA	A0A0F6YPU8	Sinorhizobium_phage	25.4	5.4e-05
WP_000956261.1|71297_72101_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.5	1.3e-16
WP_001054826.1|72102_72936_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.9	1.1e-74
>prophage 9
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	82276	84057	5342923		Planktothrix_phage(100.0%)	2	NA	NA
WP_000205667.1|82276_83050_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.4e-20
WP_000079889.1|83046_84057_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	5.1e-18
>prophage 10
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	91060	92497	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_000715446.1|91060_92497_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	30.1	5.1e-56
>prophage 11
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	95533	96574	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571356.1|95533_96574_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-29
>prophage 12
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	103472	104882	5342923		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000413557.1|103472_104882_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.2	9.8e-44
>prophage 13
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	110381	112184	5342923		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000334169.1|110381_112184_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	39.6	2.0e-102
>prophage 14
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	116522	118771	5342923		Klosneuvirus(50.0%)	2	NA	NA
WP_000711567.1|116522_117416_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	30.0	1.1e-21
WP_000869555.1|117625_118771_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.1	2.1e-52
>prophage 15
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	128649	129363	5342923		Deep-sea_thermophilic_phage(100.0%)	1	NA	NA
WP_000822436.1|128649_129363_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	E5DV68	Deep-sea_thermophilic_phage	33.5	1.2e-16
>prophage 16
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	132564	134264	5342923		Bacillus_phage(50.0%)	2	NA	NA
WP_000406542.1|132564_133446_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.7e-14
WP_000711776.1|133421_134264_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-21
>prophage 17
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	149457	161630	5342923		Catovirus(25.0%)	7	NA	NA
WP_001029614.1|149457_150645_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	25.7	7.8e-10
WP_000090364.1|150762_152841_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.5	9.7e-64
WP_001137493.1|153048_153519_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142340.1|153548_153971_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000121830.1|154085_154334_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_000567936.1|154447_158059_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.2	5.2e-65
WP_000147554.1|158096_161630_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	7.9e-50
>prophage 18
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	165222	165756	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000415794.1|165222_165756_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	29.5	8.3e-12
>prophage 19
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	168767	170165	5342923	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_000152255.1|168767_170165_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.6	1.4e-50
>prophage 20
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	177896	180332	5342923	protease	Klebsiella_phage(100.0%)	1	NA	NA
WP_000971179.1|177896_180332_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	40.9	4.4e-132
>prophage 21
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	193684	208187	5342923	protease,tRNA	Tupanvirus(25.0%)	15	NA	NA
WP_000369671.1|193684_195184_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	4.0e-96
WP_000912264.1|195343_196342_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000387027.1|196365_196569_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001059445.1|196520_197036_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000358063.1|197032_197395_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_025985130.1|197395_198256_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.0	9.9e-23
WP_000909893.1|198230_199103_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_001995554.1|199096_199684_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.9	5.1e-71
WP_001189698.1|199689_201087_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.9	1.2e-38
WP_001261709.1|201307_202231_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	4.4e-109
WP_000656366.1|202335_203211_-	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_000578367.1|203217_204006_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_001079659.1|204230_206132_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.8	5.8e-116
WP_000981838.1|206217_206760_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L2A2	Tupanvirus	22.8	4.5e-05
WP_000655473.1|206756_208187_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7IXR9	Paramecium_bursaria_Chlorella_virus	26.2	9.4e-10
>prophage 22
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	217008	217545	5342923		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000648303.1|217008_217545_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 23
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	222244	224596	5342923		Tupanvirus(50.0%)	2	NA	NA
WP_000107420.1|222244_223198_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.2	6.0e-45
WP_001995553.1|223216_224596_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A167R6F2	Powai_lake_megavirus	30.2	2.1e-22
>prophage 24
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	232157	239761	5342923	tRNA	Streptococcus_phage(60.0%)	9	NA	NA
WP_000134150.1|232157_234140_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.4	2.4e-96
WP_000843036.1|234630_234915_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.1	3.9e-16
WP_000267810.1|234935_235811_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.4	7.4e-66
WP_000414341.1|235779_236070_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001055350.1|236056_236797_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000412056.1|236917_237268_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_000272429.1|237282_238110_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_000169577.1|238115_239099_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	31.2	1.3e-29
WP_000677233.1|239134_239761_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	50.5	1.4e-55
>prophage 25
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	248540	260275	5342923	tRNA	Bacteriophage(16.67%)	11	NA	NA
WP_000121569.1|248540_250229_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.1	4.3e-46
WP_000439010.1|250705_251206_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_000798719.1|251313_251853_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000148225.1|251978_252614_+	deoxynucleoside kinase	NA	A0MSS7	Spodoptera_exigua_ascovirus	26.2	7.4e-07
WP_001053585.1|252616_253285_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.6	2.8e-25
WP_000364202.1|253320_253713_-	DUF3797 domain-containing protein	NA	NA	NA	NA	NA
WP_000884181.1|254128_255403_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.0	3.1e-97
WP_000238799.1|255730_256321_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000186156.1|256339_257227_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_131260380.1|257387_258698_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.0	5.8e-22
WP_000264082.1|258811_260275_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.8	2.8e-94
>prophage 26
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	266679	273820	5342923		Bacillus_virus(66.67%)	5	NA	NA
WP_001282851.1|266679_269151_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.5	1.6e-113
WP_000435993.1|269239_271162_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.2	2.5e-138
WP_000470750.1|271200_272328_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000821367.1|272340_272553_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_001212527.1|272680_273820_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	37.0	5.7e-18
>prophage 27
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	282280	285566	5342923	protease	Leptospira_phage(25.0%)	4	NA	NA
WP_000799028.1|282280_283153_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.1	3.5e-15
WP_000516114.1|283343_284105_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	29.7	6.1e-24
WP_001051840.1|284097_284949_+	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	33.3	3.3e-18
WP_001020723.1|284969_285566_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.3e-24
>prophage 28
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	288649	289171	5342923		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000981967.1|288649_289171_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	62.4	1.8e-51
>prophage 29
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	292988	303476	5342923	protease	Bacillus_phage(33.33%)	8	NA	NA
WP_001286244.1|292988_294350_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	6.6e-122
WP_000100223.1|294565_295855_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.9	1.9e-70
WP_000971872.1|296770_297478_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	9.9e-45
WP_000755361.1|297481_299323_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000061580.1|299319_300636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383731.1|300616_301459_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_000522833.1|301442_302237_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	1.0e-42
WP_001994964.1|302300_303476_+|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	3.8e-09
>prophage 30
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	307041	325512	5342923		Streptococcus_phage(12.5%)	15	NA	NA
WP_000655840.1|307041_308859_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.5	1.4e-122
WP_000432434.1|308993_309977_-	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	7.6e-160
WP_000827032.1|310217_311249_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.5	9.8e-17
WP_000039362.1|311437_312883_+	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	32.8	1.4e-56
WP_000427905.1|312925_313486_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001099550.1|313650_314298_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_001994963.1|314521_315538_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.1	7.5e-94
WP_001128266.1|315681_316083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542569.1|316509_317100_+	acetamide transporter	NA	NA	NA	NA	NA
WP_002003926.1|317205_318087_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000094063.1|318175_318802_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	1.3e-56
WP_001994953.1|319018_320089_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001242467.1|320451_322020_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	1.6e-18
WP_042516425.1|322115_323414_-	MFS transporter	NA	NA	NA	NA	NA
WP_000933568.1|323742_325512_+	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.5	1.7e-64
>prophage 31
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	329977	335109	5342923		Leptospira_phage(50.0%)	3	NA	NA
WP_001033517.1|329977_333094_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.9	5.3e-74
WP_000659620.1|333234_334107_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001170714.1|334137_335109_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.0	2.0e-59
>prophage 32
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	338857	340411	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_000055393.1|338857_340411_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.5	2.5e-48
>prophage 33
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	345525	346827	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000901871.1|345525_346827_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.7	3.0e-07
>prophage 34
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	356181	357237	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000942888.1|356181_357237_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.3	3.2e-23
>prophage 35
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	362241	366513	5342923	transposase	Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
WP_001994925.1|362241_363399_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	61.1	3.4e-127
WP_000760208.1|364047_364743_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_000504765.1|365214_366513_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	24.6	4.7e-08
>prophage 36
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	369587	374053	5342923		Enterobacteria_phage(33.33%)	5	NA	NA
WP_000181982.1|369587_370565_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.2	2.7e-16
WP_011733543.1|370575_371457_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000207741.1|371453_372371_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	2.4e-38
WP_001206490.1|372363_373356_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000683466.1|373375_374053_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	44.7	7.0e-48
>prophage 37
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	379776	381048	5342923		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000722837.1|379776_381048_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	6.6e-23
>prophage 38
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	385085	392082	5342923		Bacillus_phage(33.33%)	7	NA	NA
WP_000868347.1|385085_385778_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	46.6	3.1e-06
WP_000526077.1|386063_386288_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_000388281.1|386599_387655_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_001260776.1|387651_388668_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000212064.1|388683_389496_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.6e-14
WP_000787743.1|389686_390631_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000262739.1|390777_392082_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	26.8	6.8e-23
>prophage 39
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	396003	396729	5342923		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000042765.1|396003_396729_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.7	6.2e-18
>prophage 40
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	421829	422732	5342923		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000411145.1|421829_422732_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.9e-24
>prophage 41
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	427046	430807	5342923		Bacillus_virus(100.0%)	2	NA	NA
WP_011181932.1|427046_429725_-	DUF4084 domain-containing protein	NA	G3MA91	Bacillus_virus	43.2	6.7e-33
WP_000605877.1|429853_430807_-	UV DNA damage repair endonuclease UvsE	NA	G3MAQ2	Bacillus_virus	35.3	1.9e-38
>prophage 42
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	448404	448611	5342923		Clostridioides_phage(100.0%)	1	NA	NA
WP_001994931.1|448404_448611_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	44.3	5.1e-10
>prophage 43
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	457833	460567	5342923		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_000170458.1|457833_459441_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.7	1.6e-146
WP_000912417.1|459472_459997_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_000398594.1|460198_460567_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.4	1.8e-10
>prophage 44
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	466801	467389	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000280862.1|466801_467389_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.5e-34
>prophage 45
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	471046	472087	5342923		Pandoravirus(100.0%)	1	NA	NA
WP_000557338.1|471046_472087_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	43.5	1.7e-64
>prophage 46
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	477498	478740	5342923		Aeromonas_phage(100.0%)	1	NA	NA
WP_000349816.1|477498_478740_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
>prophage 47
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	505764	511566	5342923		Pseudomonas_phage(33.33%)	7	NA	NA
WP_000672629.1|505764_506784_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	43.8	6.9e-47
WP_001994994.1|506911_507919_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001995018.1|508100_508943_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	2.6e-31
WP_001995003.1|508942_509647_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001214943.1|509808_510714_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000008905.1|510854_510989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000544012.1|511293_511566_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	48.0	1.0e-13
>prophage 48
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	515049	518479	5342923		Streptococcus_phage(50.0%)	4	NA	NA
WP_001995009.1|515049_515793_+	capsular polysaccharide biosynthesis protein	NA	A0A1X9I5E1	Streptococcus_phage	32.5	1.7e-18
WP_001995016.1|515782_516484_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001994996.1|516592_517360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994980.1|517600_518479_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.0	9.7e-82
>prophage 49
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	525179	532956	5342923		Tupanvirus(60.0%)	7	NA	NA
WP_001994983.1|525179_526502_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.3	4.1e-92
WP_000279909.1|526650_527694_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.6	9.7e-97
WP_001995015.1|527813_528722_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001994985.1|528820_529639_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_001084646.1|529728_530721_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.7	3.1e-52
WP_000699580.1|530842_531514_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.2	2.2e-38
WP_000054031.1|531525_532956_+	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	26.9	4.2e-10
>prophage 50
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	538562	539243	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631600.1|538562_539243_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-34
>prophage 51
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	545077	547834	5342923		Pneumococcus_phage(100.0%)	1	NA	NA
WP_000610088.1|545077_547834_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.2	1.9e-30
>prophage 52
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	553505	570157	5342923	transposase	Bacillus_phage(28.57%)	12	NA	NA
WP_000733313.1|553505_554378_-	3D domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	74.3	1.4e-37
WP_001230128.1|555043_556561_+	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	29.6	4.2e-32
WP_000988765.1|557121_558423_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001994992.1|558419_559175_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001051021.1|559426_560638_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.4	9.4e-19
WP_000760316.1|560982_562725_-	SH3 domain-containing protein	NA	A7KUS1	Bacillus_phage	42.4	9.1e-15
WP_002003842.1|562936_563821_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_000665359.1|564332_566261_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.4	1.7e-102
WP_000435503.1|566807_567173_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	41.5	2.6e-12
WP_001139070.1|567223_567715_+	metal-binding protein	NA	NA	NA	NA	NA
WP_001014114.1|567778_568096_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_001995008.1|569026_570157_+|transposase	transposase	transposase	D2XQ03	Bacillus_virus	41.9	4.9e-70
>prophage 53
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	574128	575487	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001994989.1|574128_575487_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	29.1	3.2e-52
>prophage 54
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	595294	596821	5342923		Synechococcus_phage(50.0%)	2	NA	NA
WP_000456828.1|595294_595666_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	38.0	4.6e-17
WP_001123948.1|595693_596821_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	33.8	1.7e-09
>prophage 55
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	608761	618842	5342923		Streptococcus_phage(42.86%)	10	NA	NA
WP_000287644.1|608761_610132_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.8	3.8e-93
WP_000140128.1|610206_611322_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.9	2.7e-20
WP_000392764.1|611356_612493_-	LCP family protein	NA	NA	NA	NA	NA
WP_000926685.1|612567_613203_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	1.4e-37
WP_000844766.1|613442_614285_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.0	2.3e-16
WP_000400857.1|614458_614773_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734330.1|615026_616337_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.5	4.4e-14
WP_000225366.1|616464_617814_+	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	36.4	1.4e-60
WP_003162242.1|617813_618518_+	comF operon protein ComFC	NA	NA	NA	NA	NA
WP_001990088.1|618644_618842_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
>prophage 56
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	624781	633939	5342923		Planktothrix_phage(25.0%)	10	NA	NA
WP_000594327.1|624781_625468_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.4	3.4e-26
WP_000645021.1|625457_626351_+	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_002037436.1|626421_627906_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.2	5.5e-21
WP_000261266.1|627997_629200_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_000944622.1|629513_631229_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	5.3e-60
WP_000587632.1|631296_631608_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000186324.1|631713_632073_-	macrolide transporter	NA	NA	NA	NA	NA
WP_000497619.1|632075_632621_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_001219201.1|632625_632994_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001994981.1|633045_633939_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	2.5e-08
>prophage 57
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	640598	698679	5342923	integrase,transposase,holin	Streptococcus_phage(25.0%)	54	655268:655284	706968:706984
WP_000045556.1|640598_643475_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_000394324.1|643534_643984_+	DUF4275 family protein	NA	NA	NA	NA	NA
WP_001267308.1|644098_644479_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001127244.1|644635_645565_+	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_000924246.1|645589_646402_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000700956.1|646469_647120_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_001255052.1|647143_647656_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000517726.1|647795_649307_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001288072.1|649391_650348_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.9	1.4e-89
WP_000455203.1|650510_651317_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001190080.1|651545_652004_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000138464.1|652024_652906_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_000712177.1|652909_653863_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.5	1.3e-63
WP_000006561.1|653952_654903_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	6.6e-52
WP_000250307.1|654926_655175_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
655268:655284	attL	TTGTCGGTAAGTCGATA	NA	NA	NA	NA
WP_001049162.1|655499_656081_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000018934.1|656322_657192_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000215914.1|657212_657419_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000575924.1|657430_657781_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000938963.1|657777_658794_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000095399.1|658794_659271_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_001228547.1|659300_659786_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000216166.1|659879_660086_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000647969.1|660625_661933_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000869728.1|661942_662188_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_001258187.1|662324_663353_+	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000161236.1|663379_664384_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001036338.1|664523_665708_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_001231037.1|665740_666496_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001231156.1|666492_668022_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000103949.1|668052_669348_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	6.4e-183
WP_001125041.1|669398_670349_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000673222.1|670624_670993_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000078306.1|670989_671682_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000557262.1|671776_672010_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000761973.1|672171_672912_+	carboxylesterase	NA	NA	NA	NA	NA
WP_000391103.1|673054_675475_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	5.7e-92
WP_001123905.1|675723_676191_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	1.4e-47
WP_000753821.1|678335_678479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774089.1|678556_678736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412934.1|679835_681329_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	1.1e-82
WP_000907090.1|681549_682542_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_001996263.1|682726_683596_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000762778.1|683762_683945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003291015.1|684182_686366_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.2	4.9e-50
WP_001034071.1|686399_687146_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001113126.1|688365_688530_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	70.4	3.3e-12
WP_080335331.1|689162_689327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_042516415.1|690089_690959_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001026986.1|691465_692785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000479525.1|692807_693455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172884622.1|693423_694548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000484935.1|694706_696008_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000938795.1|696021_698679_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
706968:706984	attR	TTGTCGGTAAGTCGATA	NA	NA	NA	NA
>prophage 58
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	703920	704937	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000041820.1|703920_704937_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	3.0e-58
>prophage 59
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	709031	722699	5342923	tRNA	Bodo_saltans_virus(20.0%)	14	NA	NA
WP_001081357.1|709031_710192_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	21.2	1.3e-06
WP_000027914.1|710340_710892_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000076828.1|711042_711558_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000054850.1|711994_713554_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	4.6e-50
WP_042516414.1|713546_714740_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	31.9	1.0e-41
WP_001995599.1|714928_715135_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_000980950.1|715273_715513_+	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000568595.1|715540_715897_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000639323.1|715893_716298_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000734857.1|716618_717677_+	endonuclease	NA	NA	NA	NA	NA
WP_001995595.1|717704_719207_+	DUF4077 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.5	7.1e-08
WP_000573649.1|719373_719769_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_001057094.1|720158_721076_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001021107.1|721439_722699_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	2.0e-88
>prophage 60
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	727003	727843	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000793527.1|727003_727843_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	55.8	6.4e-83
>prophage 61
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	741137	743233	5342923		Catovirus(50.0%)	4	NA	NA
WP_172107515.1|741137_741701_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	24.4	9.7e-11
WP_000390891.1|741819_742104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656318.1|742119_742317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041892.1|742792_743233_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	65.1	3.5e-48
>prophage 62
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	751361	761444	5342923	tRNA	uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_000008429.1|751361_753053_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	1.2e-14
WP_000878461.1|753278_754973_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.4	1.4e-12
WP_001995580.1|755386_756205_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000021573.1|756640_758275_+|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	33.2	2.1e-74
WP_000410509.1|758316_759219_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000201941.1|759358_760801_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	2.6e-15
WP_000148833.1|760778_761444_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.8e-35
>prophage 63
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	768399	769293	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000530036.1|768399_769293_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.2	1.0e-25
>prophage 64
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	778646	782548	5342923		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_002003782.1|778646_780647_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.0	1.8e-11
WP_001018862.1|780724_781027_+	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_001290597.1|781075_781321_+	YusU family protein	NA	NA	NA	NA	NA
WP_000436780.1|781630_782548_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	43.9	1.3e-65
>prophage 65
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	793519	797080	5342923		Staphylococcus_phage(33.33%)	5	NA	NA
WP_000949000.1|793519_794281_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	3.7e-21
WP_162014307.1|795152_795323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242597.1|795394_796117_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.2	7.3e-11
WP_000074913.1|796120_796669_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813828.1|796852_797080_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.6	3.4e-07
>prophage 66
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	805896	809891	5342923		Streptococcus_phage(50.0%)	6	NA	NA
WP_000218967.1|805896_806262_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	6.7e-21
WP_000026899.1|806303_806687_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000640869.1|807177_807522_+	DNA primase	NA	NA	NA	NA	NA
WP_001994499.1|807525_807834_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000781219.1|807988_808333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000601755.1|808865_809891_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	3.6e-27
>prophage 67
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	814596	816238	5342923		environmental_halophage(50.0%)	2	NA	NA
WP_001020761.1|814596_815817_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.1	3.6e-119
WP_000009523.1|815806_816238_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
>prophage 68
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	834696	835485	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_001021173.1|834696_835485_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.7e-34
>prophage 69
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	839045	841484	5342923	coat	Bacillus_virus(50.0%)	4	NA	NA
WP_000665104.1|839045_839537_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.1	7.9e-41
WP_000581265.1|839657_840659_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125503.1|840720_840936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|841247_841484_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
>prophage 70
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	846284	846944	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000470281.1|846284_846944_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	2.0e-23
>prophage 71
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	850215	851150	5342923		Lake_Baikal_phage(50.0%)	2	NA	NA
WP_000573825.1|850215_850569_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000833129.1|850796_851150_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.0	6.5e-13
>prophage 72
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	865822	878648	5342923	tRNA	Streptococcus_phage(33.33%)	13	NA	NA
WP_000829779.1|865822_866812_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856618.1|867274_868483_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000415298.1|868606_869113_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027007.1|869109_869427_+	YuiB family protein	NA	NA	NA	NA	NA
WP_000920101.1|869513_870140_+	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	1.6e-14
WP_001994477.1|870285_871770_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	5.7e-58
WP_001158741.1|871852_872458_-	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_001104191.1|872601_874326_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
WP_000832654.1|874434_875322_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.1	7.7e-79
WP_001252159.1|875367_875961_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000810354.1|876011_876755_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001140609.1|876850_877234_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000287154.1|877271_878648_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
>prophage 73
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	883425	883965	5342923		Goatpox_virus(100.0%)	1	NA	NA
WP_000746504.1|883425_883965_+	superoxide dismutase [Cu-Zn]	NA	A0A075CHD1	Goatpox_virus	34.7	3.7e-07
>prophage 74
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	893712	894393	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000386685.1|893712_894393_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	1.6e-15
>prophage 75
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	903420	907644	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000728866.1|903420_907644_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	1.5e-18
>prophage 76
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	914380	919526	5342923		Iris_mild_mosaic_virus(50.0%)	4	NA	NA
WP_000494083.1|914380_916789_+	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	7.1e-10
WP_001260120.1|917215_917938_-	lipase family protein	NA	NA	NA	NA	NA
WP_001147838.1|918216_918999_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_001193054.1|919325_919526_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.9e-18
>prophage 77
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	924701	931467	5342923		Mycobacterium_phage(25.0%)	6	NA	NA
WP_001103368.1|924701_925514_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	W0LNB3	Mycobacterium_phage	32.7	6.1e-06
WP_000963876.1|925583_926402_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000449557.1|926632_928078_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.0	2.0e-68
WP_000403282.1|928078_929185_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_000822493.1|929669_930368_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.4	5.2e-38
WP_001085276.1|930360_931467_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	33.0	3.7e-22
>prophage 78
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	941358	942111	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000393254.1|941358_942111_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	3.3e-30
>prophage 79
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	949331	950102	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000859654.1|949331_950102_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	9.5e-33
>prophage 80
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	954335	963692	5342923	transposase	Bacillus_phage(40.0%)	11	NA	NA
WP_000468110.1|954335_955256_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	26.8	5.3e-14
WP_001126011.1|955402_956515_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	3.0e-80
WP_000084206.1|956922_957084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167907.1|957163_958066_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_001019306.1|958322_958850_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	31.8	1.7e-12
WP_002156638.1|959010_959226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000415588.1|959410_959743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728034.1|959920_960403_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000771601.1|960492_961113_+	class D sortase	NA	NA	NA	NA	NA
WP_001097101.1|961152_961842_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.4e-35
WP_000715412.1|961838_963692_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	31.4	1.5e-31
>prophage 81
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	968859	970002	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000720245.1|968859_970002_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	42.5	1.1e-40
>prophage 82
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	976276	977149	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000411239.1|976276_977149_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.2	1.1e-32
>prophage 83
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	983523	986402	5342923		Staphylococcus_phage(100.0%)	6	NA	NA
WP_000809330.1|983523_983760_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	72.6	5.3e-27
WP_001141369.1|983888_984362_+	S-ribosylhomocysteine lyase LuxS	NA	NA	NA	NA	NA
WP_000911964.1|984854_985085_-	YczI family protein	NA	NA	NA	NA	NA
WP_000912938.1|985287_985437_-	YtzI protein	NA	NA	NA	NA	NA
WP_000435820.1|985520_985838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276389.1|985922_986402_+	antimutator 8-oxo-(dGTP/GTP)ase	NA	A0A2H4PQM4	Staphylococcus_phage	33.3	2.8e-19
>prophage 84
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	990250	991015	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000009058.1|990250_991015_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.5	6.7e-39
>prophage 85
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	995258	996068	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000498302.1|995258_996068_-	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.6	2.4e-10
>prophage 86
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1004848	1008154	5342923		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000108802.1|1004848_1006435_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.6	2.0e-194
WP_000163126.1|1006954_1008154_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.4	9.2e-160
>prophage 87
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1019872	1035804	5342923	integrase,tRNA	Staphylococcus_phage(50.0%)	16	1024301:1024318	1029982:1029999
WP_000959735.1|1019872_1020706_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.5	3.7e-14
WP_000764481.1|1020903_1021476_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	52.9	2.0e-48
WP_000868022.1|1021472_1022432_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.0	1.7e-55
WP_000840866.1|1022543_1022807_+	YtzC family protein	NA	NA	NA	NA	NA
WP_001129338.1|1022822_1022972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527719.1|1023108_1024131_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
1024301:1024318	attL	ATATAATTTCATTTACCG	NA	NA	NA	NA
WP_000165841.1|1024469_1025231_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	31.2	2.0e-14
WP_000897784.1|1025249_1027109_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000454221.1|1027458_1028025_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	34.6	7.7e-24
WP_001994515.1|1028058_1028556_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000380183.1|1028559_1029783_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_001137566.1|1030110_1031304_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	49.2	3.4e-98
1029982:1029999	attR	ATATAATTTCATTTACCG	NA	NA	NA	NA
WP_000009448.1|1031778_1034187_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.9	0.0e+00
WP_000395697.1|1034214_1034367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994507.1|1034443_1035337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000180547.1|1035381_1035804_-	hypothetical protein	NA	A0A0K2CNN3	Brevibacillus_phage	52.7	1.1e-30
>prophage 88
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1042231	1042537	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000141220.1|1042231_1042537_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	42.2	2.1e-12
>prophage 89
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1052300	1058795	5342923		Trichoplusia_ni_ascovirus(33.33%)	9	NA	NA
WP_000286667.1|1052300_1053086_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.8e-24
WP_001982618.1|1053158_1053653_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_000533800.1|1053908_1054145_+	DUF2553 family protein	NA	NA	NA	NA	NA
WP_000621751.1|1054146_1054329_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_000498984.1|1054363_1054591_-	DUF3973 domain-containing protein	NA	NA	NA	NA	NA
WP_001994493.1|1055015_1055447_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_000098837.1|1055447_1055771_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001228018.1|1055802_1057239_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.0	1.1e-26
WP_000558886.1|1057523_1058795_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.8	1.7e-26
>prophage 90
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1072619	1078514	5342923		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000784608.1|1072619_1073432_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	60.3	1.2e-38
WP_001006758.1|1073428_1074043_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000813281.1|1074238_1074583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994496.1|1074803_1078514_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.8	1.1e-86
>prophage 91
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1097254	1099400	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000023843.1|1097254_1098709_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	2.9e-30
WP_001982862.1|1098710_1099400_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	2.8e-36
>prophage 92
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1103558	1110982	5342923	tRNA	Staphylococcus_phage(25.0%)	10	NA	NA
WP_000862042.1|1103558_1105277_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.5	1.2e-205
WP_000066437.1|1105555_1106011_+	lipoprotein	NA	NA	NA	NA	NA
WP_042513534.1|1105991_1106537_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001293783.1|1106517_1106763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994474.1|1107139_1108396_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.2	2.0e-80
WP_002003619.1|1108473_1108761_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_000050947.1|1108926_1109055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368717.1|1109236_1109644_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000807981.1|1109646_1110537_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	74.3	4.9e-25
WP_000586758.1|1110736_1110982_+	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	82.7	1.2e-29
>prophage 93
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1119237	1123688	5342923	tRNA	Faustovirus(33.33%)	4	NA	NA
WP_000638962.1|1119237_1120380_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.0	9.8e-34
WP_000989283.1|1120386_1121601_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_000124489.1|1121681_1121879_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	67.2	5.0e-15
WP_001994543.1|1122101_1123688_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	35.7	2.6e-77
>prophage 94
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1147613	1147877	5342923		Marinitoga_camini_virus(100.0%)	1	NA	NA
WP_002003636.1|1147613_1147877_-	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	41.4	5.2e-07
>prophage 95
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1160750	1164074	5342923		Streptomyces_phage(100.0%)	1	NA	NA
WP_000673758.1|1160750_1164074_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	35.1	1.0e-179
>prophage 96
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1169233	1170991	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232664.1|1169233_1170991_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	44.4	3.3e-12
>prophage 97
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1179616	1198258	5342923	tRNA	Bacillus_phage(44.44%)	17	NA	NA
WP_001065226.1|1179616_1180336_+	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	42.1	1.6e-42
WP_001032119.1|1180328_1182092_+	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	39.3	6.1e-43
WP_000412817.1|1182376_1185010_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.9	2.8e-44
WP_001114480.1|1185022_1185853_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.2	6.6e-24
WP_000281740.1|1185925_1186558_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_000219302.1|1186609_1187212_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_001995572.1|1187321_1188350_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002003660.1|1188738_1189122_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	3.0e-19
WP_001203687.1|1189407_1189869_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_000415040.1|1189996_1191403_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_000400110.1|1191436_1192375_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	36.2	1.3e-44
WP_000569608.1|1192655_1193537_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_000786086.1|1193844_1195782_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	1.4e-112
WP_000973214.1|1196176_1196680_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.8	4.8e-17
WP_001125945.1|1196701_1196902_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138362.1|1196939_1197296_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000365050.1|1197766_1198258_+	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	37.2	6.7e-24
>prophage 98
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1209251	1221582	5342923	tRNA	Orpheovirus(25.0%)	11	NA	NA
WP_000388219.1|1209251_1210286_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.1	2.4e-31
WP_000498176.1|1210304_1212725_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000432163.1|1213264_1214656_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.4	3.4e-81
WP_000039589.1|1214748_1214883_+	YuzL family protein	NA	NA	NA	NA	NA
WP_000994759.1|1214923_1215175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925544.1|1215171_1215441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071580.1|1215557_1216493_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_000082701.1|1216617_1216887_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000565403.1|1216888_1217428_+	CvpA family protein	NA	NA	NA	NA	NA
WP_000867540.1|1217483_1219202_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.7e-13
WP_000893726.1|1219221_1221582_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	45.1	1.3e-16
>prophage 99
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1229398	1231142	5342923		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001036836.1|1229398_1230382_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	9.3e-17
WP_000403746.1|1230371_1231142_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	9.9e-14
>prophage 100
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1234517	1238972	5342923		Streptococcus_phage(25.0%)	6	NA	NA
WP_001255959.1|1234517_1235717_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	6.1e-71
WP_001014310.1|1235756_1235951_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|1235951_1236125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018063.1|1236293_1236986_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	8.0e-07
WP_012680297.1|1236987_1237923_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.5	9.5e-11
WP_000221093.1|1238048_1238972_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.1e-46
>prophage 101
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1246866	1248552	5342923		Hepacivirus(100.0%)	1	NA	NA
WP_000414737.1|1246866_1248552_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	30.2	5.4e-57
>prophage 102
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1252111	1252426	5342923		Indivirus(100.0%)	1	NA	NA
WP_001018943.1|1252111_1252426_+	thioredoxin	NA	A0A1V0SD63	Indivirus	41.0	8.7e-09
>prophage 103
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1262800	1263685	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000058139.1|1262800_1263685_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	6.0e-23
>prophage 104
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1271201	1271426	5342923		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000659484.1|1271201_1271426_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 105
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1278995	1279604	5342923		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000815943.1|1278995_1279604_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
>prophage 106
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1286260	1331418	5342923	integrase,coat,tRNA,protease,bacteriocin	Klosneuvirus(33.33%)	35	1301961:1301977	1313872:1313888
WP_000472282.1|1286260_1287520_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	1.3e-148
WP_033681245.1|1287626_1289297_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	1.6e-13
WP_001994726.1|1289480_1291811_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	5.0e-178
WP_000869113.1|1291807_1292404_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359781.1|1292436_1292853_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133920.1|1292855_1293308_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547860.1|1293719_1295054_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000008996.1|1295071_1295905_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226419.1|1295920_1296850_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992334.1|1296852_1297605_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087068.1|1297625_1298615_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712929.1|1298614_1299904_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001994715.1|1300014_1301010_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000366997.1|1301072_1302098_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
1301961:1301977	attL	TATAAGAAAAGAAGAGA	NA	NA	NA	NA
WP_000072246.1|1302493_1305139_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	8.0e-164
WP_000582048.1|1305232_1306534_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000360976.1|1306699_1307662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226277.1|1307883_1308459_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001994730.1|1308505_1309084_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001994743.1|1309207_1310326_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042516402.1|1310288_1310603_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042516400.1|1310628_1311963_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001994752.1|1312209_1312959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994717.1|1313178_1313424_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001994712.1|1313554_1314091_+	hypothetical protein	NA	NA	NA	NA	NA
1313872:1313888	attR	TATAAGAAAAGAAGAGA	NA	NA	NA	NA
WP_042516397.1|1314602_1315445_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001994733.1|1315918_1317346_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001994746.1|1318107_1319490_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001994722.1|1320328_1322848_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001994714.1|1323741_1323864_+	DNA repair protein	NA	NA	NA	NA	NA
WP_001994729.1|1324899_1326174_+	collagen-like protein	NA	NA	NA	NA	NA
WP_001212906.1|1326580_1327702_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_001089676.1|1328610_1328817_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_000849670.1|1328839_1329016_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_000051680.1|1329225_1331418_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
>prophage 107
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1353980	1354757	5342923		Pithovirus(100.0%)	1	NA	NA
WP_000114531.1|1353980_1354757_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
>prophage 108
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1360923	1362063	5342923		Faustovirus(100.0%)	1	NA	NA
WP_000973794.1|1360923_1362063_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
>prophage 109
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1373430	1377141	5342923	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000344460.1|1373430_1374432_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000138162.1|1374428_1374629_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000354029.1|1374648_1375701_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000125362.1|1375713_1376853_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000991116.1|1376880_1377141_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.3	2.5e-06
>prophage 110
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1380630	1397112	5342923	tRNA	uncultured_Mediterranean_phage(33.33%)	12	NA	NA
WP_001119073.1|1380630_1382895_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.0	3.3e-33
WP_001994720.1|1383048_1383942_+	cation transporter	NA	NA	NA	NA	NA
WP_000941260.1|1384043_1386383_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	4.5e-86
WP_000346214.1|1386430_1386943_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	6.5e-30
WP_001262809.1|1387153_1389337_+	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_001266953.1|1389354_1389795_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001242605.1|1389980_1390157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033681243.1|1390511_1391783_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000840895.1|1391795_1393571_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	7.1e-15
WP_000903175.1|1393920_1394688_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000857716.1|1395145_1395787_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000812934.1|1395831_1397112_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.8	2.2e-119
>prophage 111
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1400999	1408799	5342923	tRNA	Virus_Rctr197k(50.0%)	7	NA	NA
WP_000528066.1|1400999_1403336_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.4	1.0e-53
WP_000469281.1|1403463_1403652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053553.1|1403670_1403799_+	YrzQ family protein	NA	NA	NA	NA	NA
WP_000242546.1|1403834_1404047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793123.1|1404223_1405291_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000209457.1|1405329_1405674_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000811840.1|1406156_1408799_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.3	4.8e-68
>prophage 112
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1411989	1414874	5342923		Phage_TP(66.67%)	3	NA	NA
WP_000742779.1|1411989_1412919_+	U32 family peptidase	NA	Q6DW11	Phage_TP	33.2	9.1e-22
WP_000217969.1|1412937_1414218_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.1	9.6e-38
WP_000537085.1|1414235_1414874_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.6	2.1e-33
>prophage 113
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1420061	1422122	5342923		Streptococcus_phage(50.0%)	2	NA	NA
WP_001994741.1|1420061_1420985_+	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.3	8.1e-63
WP_001201906.1|1420988_1422122_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.4	9.4e-21
>prophage 114
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1427462	1428281	5342923		Indivirus(100.0%)	1	NA	NA
WP_000626541.1|1427462_1428281_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.8	2.2e-11
>prophage 115
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1435283	1438037	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001994728.1|1435283_1438037_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.8	2.4e-22
>prophage 116
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1450774	1451488	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000051382.1|1450774_1451488_+	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	28.5	8.3e-15
>prophage 117
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1459985	1468423	5342923		Bacillus_phage(25.0%)	8	NA	NA
WP_000439783.1|1459985_1460543_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.7	2.4e-30
WP_011733333.1|1460557_1462879_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	36.0	2.5e-36
WP_000997609.1|1462907_1463042_-	YqzM family protein	NA	NA	NA	NA	NA
WP_001279912.1|1463388_1464399_+	DNA polymerase III subunit delta	NA	D9ZNJ1	Clostridium_phage	24.2	1.7e-05
WP_001274011.1|1464481_1464739_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001994713.1|1464920_1466027_+	GPR endopeptidase	NA	NA	NA	NA	NA
WP_000438981.1|1466026_1466389_+	YqxA family protein	NA	NA	NA	NA	NA
WP_001030952.1|1466599_1468423_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	7.0e-26
>prophage 118
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1471978	1475134	5342923		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000034699.1|1471978_1473814_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	3.1e-138
WP_000043937.1|1474018_1475134_+	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.1	7.6e-23
>prophage 119
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1478875	1482060	5342923		Bacillus_virus(50.0%)	4	NA	NA
WP_000054571.1|1478875_1479319_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	44.8	5.9e-19
WP_000732266.1|1479427_1479721_+	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_000792478.1|1479897_1481097_+	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_000840510.1|1481100_1482060_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	48.8	2.0e-48
>prophage 120
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1490146	1502620	5342923	tRNA	Helicobacter_phage(16.67%)	12	NA	NA
WP_001995224.1|1490146_1491943_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	30.1	2.0e-41
WP_000764058.1|1492002_1493124_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	3.8e-38
WP_000828148.1|1493509_1493866_+	cytochrome c-550	NA	NA	NA	NA	NA
WP_001006551.1|1494031_1494739_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_000036218.1|1494735_1495857_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	52.0	6.4e-22
WP_001995209.1|1495897_1496848_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_000484150.1|1496937_1497690_-	VrrA protein	NA	NA	NA	NA	NA
WP_000194030.1|1497870_1499181_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.3	4.0e-47
WP_000912466.1|1499411_1500308_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.0	6.1e-23
WP_001048962.1|1500326_1500581_-	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_000435958.1|1500730_1501609_+	YitT family protein	NA	NA	NA	NA	NA
WP_001059649.1|1501849_1502620_+	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	2.6e-14
>prophage 121
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1506967	1507579	5342923		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_001052031.1|1506967_1507579_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	62.2	4.5e-70
>prophage 122
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1514325	1521946	5342923		Bacillus_phage(33.33%)	9	NA	NA
WP_000226683.1|1514325_1515141_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	1.3e-16
WP_000251234.1|1515296_1515953_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000679316.1|1516328_1518683_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	32.3	3.3e-20
WP_001265616.1|1518752_1518902_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001206424.1|1519006_1519585_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_000253699.1|1519689_1519890_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_000391706.1|1519909_1520893_+	glucokinase	NA	NA	NA	NA	NA
WP_000524853.1|1520972_1521146_-	DUF2759 domain-containing protein	NA	NA	NA	NA	NA
WP_000871219.1|1521316_1521946_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.7	1.8e-34
>prophage 123
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1525734	1532665	5342923		Pandoravirus(50.0%)	3	NA	NA
WP_000103899.1|1525734_1526847_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	27.8	9.9e-15
WP_001995221.1|1527434_1529267_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001995203.1|1529266_1532665_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	51.7	4.8e-12
>prophage 124
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1543049	1543700	5342923		Klosneuvirus(100.0%)	1	NA	NA
WP_000183851.1|1543049_1543700_+	2OG-Fe(II) oxygenase	NA	A0A1V0SIE1	Klosneuvirus	31.5	1.2e-17
>prophage 125
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1546970	1554411	5342923		Prochlorococcus_phage(50.0%)	6	NA	NA
WP_001995225.1|1546970_1547423_+	DUF5065 family protein	NA	A0A1U9WQL3	Geobacillus_phage	33.3	8.1e-08
WP_001995226.1|1547618_1548413_-	YqhG family protein	NA	NA	NA	NA	NA
WP_001100021.1|1548399_1550082_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.4	1.6e-56
WP_000631765.1|1550474_1551575_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_000903231.1|1551595_1552939_+	aminomethyl-transferring glycine dehydrogenase subunit 1	NA	E3SN07	Prochlorococcus_phage	41.2	1.3e-64
WP_000795698.1|1552935_1554411_+	aminomethyl-transferring glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	41.3	4.4e-87
>prophage 126
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1567748	1568411	5342923		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000643912.1|1567748_1568411_+	HAD family hydrolase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	30.0	6.1e-12
>prophage 127
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1572997	1573576	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_001165006.1|1572997_1573576_-	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	27.0	6.5e-10
>prophage 128
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1583128	1585374	5342923		Enterococcus_phage(50.0%)	2	NA	NA
WP_000226720.1|1583128_1583989_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.4	1.9e-42
WP_000415260.1|1584015_1585374_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	31.2	8.6e-45
>prophage 129
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1596316	1597045	5342923		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000172561.1|1596316_1597045_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.4	2.6e-16
>prophage 130
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1602961	1604383	5342923		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001051291.1|1602961_1604383_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	1.8e-45
>prophage 131
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1609431	1613422	5342923		Paenibacillus_phage(50.0%)	6	NA	NA
WP_001995223.1|1609431_1609896_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	40.1	2.3e-26
WP_000366597.1|1610018_1610426_+	YjdF family protein	NA	NA	NA	NA	NA
WP_002003484.1|1610568_1610982_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000735480.1|1611231_1612011_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001046917.1|1612047_1612707_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000590218.1|1612699_1613422_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	9.8e-32
>prophage 132
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1617902	1619141	5342923		Caldibacillus_phage(100.0%)	1	NA	NA
WP_001208841.1|1617902_1619141_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	32.0	4.3e-19
>prophage 133
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1623076	1623916	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001995502.1|1623076_1623916_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.3	2.2e-27
>prophage 134
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1629325	1631449	5342923		Klosneuvirus(50.0%)	2	NA	NA
WP_000200535.1|1629325_1630486_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	8.1e-28
WP_000108875.1|1630498_1631449_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	29.1	5.8e-24
>prophage 135
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1639025	1642295	5342923		Klosneuvirus(50.0%)	3	NA	NA
WP_000144314.1|1639025_1640414_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.8	2.7e-17
WP_000012500.1|1640413_1641142_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001075625.1|1641107_1642295_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.3	7.0e-43
>prophage 136
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1645337	1648762	5342923		Staphylococcus_phage(100.0%)	4	NA	NA
WP_000230892.1|1645337_1645799_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.3	4.5e-46
WP_000469013.1|1645817_1647011_-	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.3	3.3e-117
WP_000493927.1|1647023_1647668_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.6	4.6e-41
WP_000131970.1|1647649_1648762_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	41.5	2.3e-64
>prophage 137
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1658437	1660209	5342923		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000547999.1|1658437_1659265_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.7	3.6e-70
WP_000747202.1|1659294_1660209_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.3	4.0e-06
>prophage 138
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1663256	1668770	5342923		Brevibacillus_phage(33.33%)	5	NA	NA
WP_000390080.1|1663256_1664147_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	6.9e-43
WP_001995504.1|1664290_1665034_+	FixH family protein	NA	NA	NA	NA	NA
WP_001046067.1|1665439_1666624_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_001078446.1|1666636_1667458_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	3.2e-71
WP_001243079.1|1667465_1668770_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.1	3.1e-137
>prophage 139
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1674326	1678683	5342923		Staphylococcus_phage(50.0%)	6	NA	NA
WP_000922158.1|1674326_1675208_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	5.2e-19
WP_000548032.1|1675173_1675593_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000831985.1|1675759_1676950_+	serine-type D-Ala-D-Ala carboxypeptidase DacF	NA	NA	NA	NA	NA
WP_000059133.1|1677120_1677471_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_001243400.1|1677471_1677912_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_000350729.1|1677924_1678683_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	58.1	8.9e-68
>prophage 140
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1687465	1692098	5342923		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_000853783.1|1687465_1687903_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.8	1.6e-16
WP_000908398.1|1688371_1688740_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_000283602.1|1688760_1689279_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000510194.1|1689377_1689473_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001199758.1|1689642_1690386_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.6	3.2e-09
WP_000376225.1|1690544_1691117_+	segregation/condensation protein ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	1.4e-17
WP_001214094.1|1691195_1692098_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	37.1	1.4e-40
>prophage 141
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1719422	1719872	5342923		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000540527.1|1719422_1719872_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	41.1	2.4e-28
>prophage 142
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1725909	1727010	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000818946.1|1725909_1727010_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.3	2.0e-20
>prophage 143
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1739969	1740404	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000811492.1|1739969_1740404_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	56.1	4.7e-37
>prophage 144
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1755618	1758878	5342923		Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_000660905.1|1755618_1756383_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	40.2	6.1e-40
WP_000564304.1|1756638_1757856_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001233810.1|1758038_1758527_+	DUF3993 domain-containing protein	NA	NA	NA	NA	NA
WP_000717880.1|1758641_1758878_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	46.1	5.3e-11
>prophage 145
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1769407	1769962	5342923		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957057.1|1769407_1769962_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.0	6.9e-17
>prophage 146
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1774273	1775686	5342923		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000260104.1|1774273_1775686_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	1.2e-46
>prophage 147
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1786727	1788056	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000358083.1|1786727_1788056_+	PhoH family protein	NA	A0A141HS37	Bacillus_phage	41.6	8.9e-79
>prophage 148
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1797734	1799570	5342923		Flavobacterium_phage(100.0%)	1	NA	NA
WP_153576971.1|1797734_1799570_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	1.3e-08
>prophage 149
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1803364	1804399	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000735392.1|1803364_1804399_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	34.5	3.4e-17
>prophage 150
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1808373	1810991	5342923		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000200598.1|1808373_1808865_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.9	8.5e-27
WP_000273099.1|1808856_1810086_-	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_000662594.1|1810199_1810991_+	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	29.0	4.0e-10
>prophage 151
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1814295	1814802	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000246476.1|1814295_1814802_+	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.0e-11
>prophage 152
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1836521	1838178	5342923		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000976948.1|1836521_1837241_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_000197753.1|1837398_1838178_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
>prophage 153
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1842724	1853073	5342923	tRNA	Moumouvirus(25.0%)	9	NA	NA
WP_000455931.1|1842724_1845490_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	27.1	2.7e-85
WP_001004661.1|1845645_1845975_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_000642181.1|1846099_1846558_+	lipoprotein signal peptidase LspA	NA	NA	NA	NA	NA
WP_000005838.1|1846562_1847471_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_001156491.1|1847673_1848216_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000435934.1|1848362_1849646_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.6	1.3e-66
WP_000018862.1|1849794_1850709_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.2	3.8e-28
WP_001108374.1|1850692_1851979_+	dihydroorotase	NA	NA	NA	NA	NA
WP_000828679.1|1851975_1853073_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.3	3.8e-59
>prophage 154
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1858675	1859308	5342923		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000711449.1|1858675_1859308_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	33.1	7.8e-09
>prophage 155
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1866622	1876726	5342923	tRNA	Paramecium_bursaria_Chlorella_virus(20.0%)	9	NA	NA
WP_001104757.1|1866622_1869343_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.6	1.5e-85
WP_000564120.1|1869443_1870319_+	YicC family protein	NA	NA	NA	NA	NA
WP_001251456.1|1870386_1870650_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_001257738.1|1870663_1871281_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	37.3	3.8e-24
WP_000933970.1|1871283_1871496_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000911731.1|1871668_1872874_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	2.4e-43
WP_000666732.1|1872870_1875276_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000279474.1|1875287_1875758_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	9.0e-18
WP_000598790.1|1875781_1876726_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	1.4e-09
>prophage 156
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1879915	1881889	5342923		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000904759.1|1879915_1881889_+	serine/threonine protein kinase PrkC	NA	A0A2H4UVE2	Bodo_saltans_virus	30.3	5.6e-21
>prophage 157
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1892282	1894122	5342923		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_000911782.1|1892282_1893023_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.6e-21
WP_000786062.1|1893092_1893326_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	43.7	7.1e-08
WP_001146873.1|1893384_1894122_+	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	34.8	3.0e-28
>prophage 158
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1904763	1905537	5342923		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001174721.1|1904763_1905537_+	ribonuclease HII	NA	V5LS77	Emiliania_huxleyi_virus	43.1	1.3e-18
>prophage 159
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1908914	1915312	5342923	protease,tRNA	Indivirus(33.33%)	5	NA	NA
WP_001286969.1|1908914_1910993_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.0	8.6e-105
WP_003295032.1|1911043_1912348_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_001995695.1|1912413_1913313_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	1.5e-34
WP_000526272.1|1913355_1913898_+|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_000550088.1|1913920_1915312_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.8	2.5e-47
>prophage 160
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1919648	1920425	5342923		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000971301.1|1919648_1920425_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.8	1.4e-23
>prophage 161
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1929247	1939838	5342923	tRNA	Pseudomonas_phage(25.0%)	11	NA	NA
WP_001994653.1|1929247_1931062_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	2.8e-35
WP_102719438.1|1931135_1932575_+	PolC-type DNA polymerase III	NA	A0A0K0NKU7	Gordonia_phage	29.9	9.2e-05
WP_000359097.1|1932907_1933378_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000102609.1|1933395_1934502_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000071128.1|1934513_1934786_+	YlxR family protein	NA	NA	NA	NA	NA
WP_001286523.1|1934786_1935098_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000036341.1|1935102_1937163_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	5.0e-20
WP_000582364.1|1937159_1937441_+	DUF503 family protein	NA	NA	NA	NA	NA
WP_000776442.1|1937456_1937813_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000399345.1|1937899_1938823_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000766711.1|1938866_1939838_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	1.9e-06
>prophage 162
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1943644	1944886	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000592994.1|1943644_1944886_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
>prophage 163
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1954081	1965296	5342923		Mycobacterium_phage(20.0%)	8	NA	NA
WP_001118785.1|1954081_1956463_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000114176.1|1957001_1957727_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000730595.1|1957816_1958884_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	35.1	1.1e-50
WP_000456939.1|1958992_1960525_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.6	3.1e-11
WP_001074497.1|1960517_1961576_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000008843.1|1961576_1962536_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001994669.1|1962734_1964009_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.6	5.0e-55
WP_001994660.1|1964009_1965296_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.3e-10
>prophage 164
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1971273	1971699	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001115374.1|1971273_1971699_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	70.5	2.7e-45
>prophage 165
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1974852	1975113	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000404341.1|1974852_1975113_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
>prophage 166
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1982175	1988006	5342923		Tetraselmis_virus(33.33%)	3	NA	NA
WP_000196011.1|1982175_1984848_+	DNA mismatch repair protein MutS	NA	A0A2P0VN50	Tetraselmis_virus	21.9	6.0e-34
WP_000516457.1|1984856_1986800_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	1.7e-62
WP_000337611.1|1987019_1988006_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	33.5	1.2e-32
>prophage 167
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	1991869	1996582	5342923		Streptococcus_phage(50.0%)	3	NA	NA
WP_001994672.1|1991869_1993789_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.6	2.6e-95
WP_000272392.1|1994184_1995522_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000771018.1|1995784_1996582_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.0	4.7e-35
>prophage 168
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2006417	2008312	5342923		Catovirus(50.0%)	2	NA	NA
WP_000932596.1|2006417_2007404_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	36.0	4.6e-48
WP_000739094.1|2007400_2008312_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	24.4	1.8e-14
>prophage 169
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2018764	2020785	5342923		Megavirus(50.0%)	3	NA	NA
WP_001089816.1|2018764_2019295_-	methylated-DNA--protein-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	48.2	2.8e-15
WP_000551313.1|2019275_2019872_-	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_000668831.1|2020026_2020785_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.7	2.3e-63
>prophage 170
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2024114	2030225	5342923		Anomala_cuprea_entomopoxvirus(33.33%)	7	NA	NA
WP_001994648.1|2024114_2024936_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	1.6e-14
WP_001098341.1|2024952_2025780_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000849103.1|2026111_2026339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349636.1|2026630_2026933_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_000436976.1|2027121_2027328_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_001994687.1|2027423_2029841_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	2.0e-121
WP_001043904.1|2029952_2030225_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	74.4	6.1e-27
>prophage 171
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2041943	2042876	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000734626.1|2041943_2042876_+	3D domain-containing protein	NA	A0A0S2MUE5	Bacillus_phage	70.5	1.6e-34
>prophage 172
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2049317	2050274	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000438185.1|2049317_2050274_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	44.0	6.0e-53
>prophage 173
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2057832	2058453	5342923		Phage_Wrath(100.0%)	1	NA	NA
WP_000413738.1|2057832_2058453_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
>prophage 174
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2062366	2063140	5342923		Pithovirus(100.0%)	1	NA	NA
WP_001994680.1|2062366_2063140_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	7.8e-11
>prophage 175
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2068057	2075227	5342923		Bacillus_phage(50.0%)	5	NA	NA
WP_000862473.1|2068057_2069809_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	1.4e-47
WP_000136735.1|2069808_2071572_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	23.4	8.3e-16
WP_001994663.1|2071691_2072711_+	NERD domain-containing protein	NA	A0A1L2JY40	Aeribacillus_phage	26.6	4.8e-24
WP_011733202.1|2072717_2073284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033681233.1|2073499_2075227_+	S-layer homology domain-containing protein	NA	Q9ZXD7	Bacillus_phage	55.0	6.2e-40
>prophage 176
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2080478	2081390	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000180642.1|2080478_2081390_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.3e-40
>prophage 177
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2100347	2101865	5342923		Catovirus(100.0%)	1	NA	NA
WP_000631842.1|2100347_2101865_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.6	3.2e-101
>prophage 178
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2117565	2118024	5342923		uncultured_marine_virus(100.0%)	1	NA	NA
WP_000402969.1|2117565_2118024_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0F7LBB1	uncultured_marine_virus	33.1	2.5e-09
>prophage 179
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2125637	2129322	5342923		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000513175.1|2125637_2127083_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.9	1.3e-27
WP_001077984.1|2127093_2128185_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_001247876.1|2128192_2128774_-	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_000432565.1|2128878_2129322_+	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	32.7	5.7e-06
>prophage 180
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2137224	2146353	5342923	integrase	Clostridium_phage(66.67%)	7	2136891:2136905	2150923:2150937
2136891:2136905	attL	CCAATTTTTCCTATT	NA	NA	NA	NA
WP_001994662.1|2137224_2139090_-	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	42.9	8.1e-86
WP_001994655.1|2139168_2139549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994650.1|2139545_2141648_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001994656.1|2141666_2142782_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	26.4	3.2e-13
WP_001083864.1|2144205_2144463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000269067.1|2144714_2145290_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_000526911.1|2145405_2146353_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	38.5	9.5e-51
2150923:2150937	attR	CCAATTTTTCCTATT	NA	NA	NA	NA
>prophage 181
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2150208	2166594	5342923	transposase	Bacillus_phage(25.0%)	13	NA	NA
WP_001994676.1|2150208_2152065_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	45.3	3.4e-161
WP_001994666.1|2152061_2152514_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	51.7	1.3e-37
WP_001044683.1|2152532_2153210_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	3.2e-40
WP_001994699.1|2153411_2154653_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_000151390.1|2154732_2155146_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001062205.1|2155521_2157486_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	44.1	1.6e-129
WP_001147472.1|2157487_2159911_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.9	2.4e-98
WP_000859077.1|2160187_2161735_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	28.1	6.0e-10
WP_000719758.1|2161980_2163012_+	oxidoreductase	NA	NA	NA	NA	NA
WP_131260337.1|2163036_2163639_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000626600.1|2163794_2164688_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	5.1e-22
WP_001041445.1|2164680_2165487_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000898009.1|2166084_2166594_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	44.1	2.1e-12
>prophage 182
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2222635	2227699	5342923		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_000966322.1|2222635_2223193_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.1	7.6e-40
WP_002003247.1|2223382_2223646_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000070938.1|2224124_2224745_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001062763.1|2224887_2225331_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.1	3.8e-10
WP_000449516.1|2225347_2226247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001179150.1|2226463_2226664_+	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	64.6	5.0e-18
WP_000426506.1|2226853_2227699_+	exonuclease	NA	G3MBN3	Bacillus_virus	27.6	1.4e-13
>prophage 183
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2233735	2234413	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_001994022.1|2233735_2234413_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.8	1.2e-20
>prophage 184
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2238814	2244863	5342923		Catovirus(50.0%)	4	NA	NA
WP_000064847.1|2238814_2241370_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.2e-10
WP_001084738.1|2241389_2242520_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001084197.1|2242512_2243079_+	acyltransferase	NA	NA	NA	NA	NA
WP_001994062.1|2243522_2244863_+	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	25.8	2.3e-05
>prophage 185
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2249575	2253865	5342923	protease	Erysipelothrix_phage(33.33%)	5	NA	NA
WP_001994226.1|2249575_2250103_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	33.9	2.0e-18
WP_000275811.1|2250237_2250837_+|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_000719639.1|2250911_2251049_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_042516386.1|2251048_2252143_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	50.9	4.4e-100
WP_000164935.1|2252398_2253865_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	30.6	6.0e-44
>prophage 186
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2260193	2261138	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001226311.1|2260193_2261138_+	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	34.3	4.1e-38
>prophage 187
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2265234	2266368	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000915188.1|2265234_2266368_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.5	7.4e-18
>prophage 188
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2273324	2275757	5342923		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_001095161.1|2273324_2275226_+	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	24.6	2.9e-14
WP_000628699.1|2275232_2275757_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	65.3	1.7e-54
>prophage 189
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2283632	2284667	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001994070.1|2283632_2284667_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.5	1.1e-15
>prophage 190
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2290611	2295165	5342923		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_000768006.1|2290611_2291355_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	8.3e-18
WP_000865007.1|2292169_2292448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390460.1|2292766_2292991_+	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	83.8	2.3e-24
WP_000570014.1|2293035_2293602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757987.1|2293965_2295165_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	3.7e-23
>prophage 191
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2302030	2306873	5342923		Lactococcus_phage(33.33%)	8	NA	NA
WP_000653878.1|2302030_2303074_+	NAD(P)-binding domain-containing protein	NA	A0A1W6JL96	Lactococcus_phage	29.8	1.0e-05
WP_000666946.1|2303340_2303589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769751.1|2303625_2304663_-	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	23.5	1.6e-06
WP_000819652.1|2304773_2304968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000397700.1|2305100_2305382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171762.1|2305412_2305703_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_001028120.1|2305819_2306101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727678.1|2306135_2306873_+	glycoside hydrolase family 25 protein	NA	A0A141HSE6	Bacillus_phage	30.9	7.7e-16
>prophage 192
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2312123	2314791	5342923		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_000093042.1|2312123_2312885_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.3	3.5e-27
WP_000837830.1|2312885_2313635_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000503882.1|2313987_2314791_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	33.3	4.6e-06
>prophage 193
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2331833	2333336	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001994098.1|2331833_2333336_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	5.6e-37
>prophage 194
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2339867	2340434	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001994230.1|2339867_2340434_+	SGNH/GDSL hydrolase family protein	NA	A0A0N9RRL9	Staphylococcus_phage	29.6	1.2e-05
>prophage 195
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2350541	2355778	5342923		Synechococcus_phage(66.67%)	4	NA	NA
WP_001994216.1|2350541_2352026_+	glucose-6-phosphate dehydrogenase	NA	M4QQY0	Cyanophage	36.6	4.6e-76
WP_001994241.1|2352065_2354060_+	transketolase	NA	NA	NA	NA	NA
WP_001994033.1|2354164_2355058_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	37.5	5.8e-58
WP_000667676.1|2355109_2355778_+	fructose-6-phosphate aldolase	NA	A0A0E3HNZ3	Synechococcus_phage	47.5	3.7e-49
>prophage 196
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2376059	2376818	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_001994122.1|2376059_2376818_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.8e-31
>prophage 197
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2387948	2389106	5342923	transposase	Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_000817284.1|2387948_2389106_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	58.8	7.1e-125
>prophage 198
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2392133	2392859	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000570195.1|2392133_2392859_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.9	2.1e-13
>prophage 199
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2400122	2406379	5342923	tRNA	Bacillus_phage(33.33%)	4	NA	NA
WP_001100383.1|2400122_2400434_-	hypothetical protein	NA	A0A0M4R382	Bacillus_phage	34.8	5.6e-08
WP_000425309.1|2400595_2401873_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	27.6	6.0e-40
WP_000490862.1|2402154_2403948_-	response regulator	NA	NA	NA	NA	NA
WP_000834549.1|2404216_2406379_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	29.4	3.7e-26
>prophage 200
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2413716	2414841	5342923		Burkholderia_virus(100.0%)	1	NA	NA
WP_001206776.1|2413716_2414841_+	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	43.5	1.1e-05
>prophage 201
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2425121	2426783	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_042516378.1|2425121_2426783_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.6	5.2e-20
>prophage 202
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2437900	2438806	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000763106.1|2437900_2438806_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.9e-32
>prophage 203
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2443178	2444096	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002003134.1|2443178_2444096_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.3	9.0e-06
>prophage 204
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2450700	2457165	5342923		Bacillus_phage(33.33%)	4	NA	NA
WP_001022204.1|2450700_2452476_+	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	40.5	1.0e-42
WP_001994167.1|2452765_2453467_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	41.9	5.2e-46
WP_000454337.1|2453553_2455944_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_000494199.1|2456088_2457165_+	HNH endonuclease	NA	A0A2H4J389	uncultured_Caudovirales_phage	51.2	4.3e-39
>prophage 205
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2461440	2463708	5342923		Streptococcus_phage(100.0%)	2	NA	NA
WP_001994087.1|2461440_2462523_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	53.3	1.0e-104
WP_000490247.1|2462535_2463708_+	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	50.9	1.9e-109
>prophage 206
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2480092	2484212	5342923	integrase	uncultured_Caudovirales_phage(33.33%)	4	2477096:2477114	2493448:2493466
2477096:2477114	attL	ATTAAAAATAAAATATTTG	NA	NA	NA	NA
WP_000472734.1|2480092_2482075_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.0	2.7e-15
WP_001994162.1|2482170_2482545_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	49.6	9.9e-28
WP_001994187.1|2482588_2482870_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_001265872.1|2483093_2484212_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	24.9	2.1e-12
2493448:2493466	attR	CAAATATTTTATTTTTAAT	NA	NA	NA	NA
>prophage 207
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2489265	2490531	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000272541.1|2489265_2490531_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	47.2	3.4e-104
>prophage 208
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2494219	2495335	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000116971.1|2494219_2495335_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.2	1.4e-106
>prophage 209
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2504672	2505368	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001281104.1|2504672_2505368_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	2.6e-37
>prophage 210
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2519886	2525482	5342923	protease	Bacillus_phage(66.67%)	7	NA	NA
WP_000747495.1|2519886_2520726_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.8	1.4e-42
WP_000275822.1|2520922_2521546_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_000207055.1|2521569_2522088_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000658988.1|2522113_2522566_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000878269.1|2522680_2523346_+	YitT family protein	NA	NA	NA	NA	NA
WP_000781961.1|2523426_2524104_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	53.0	1.0e-62
WP_000839503.1|2524105_2525482_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	40.3	2.9e-56
>prophage 211
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2528869	2529541	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000202584.1|2528869_2529541_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.6e-36
>prophage 212
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2544085	2545627	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000797429.1|2544085_2545627_+	serine hydrolase	NA	G8IDB2	Mycobacterium_phage	32.5	8.9e-14
>prophage 213
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2552600	2554645	5342923		Bacillus_phage(50.0%)	2	NA	NA
WP_000826694.1|2552600_2553974_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	5.8e-25
WP_001264531.1|2553970_2554645_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	33.3	1.1e-08
>prophage 214
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2559857	2563055	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001994168.1|2559857_2563055_+	bifunctional P-450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	38.0	9.6e-79
>prophage 215
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2571002	2572703	5342923		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000974589.1|2571002_2572703_+	molecular chaperone HscC	NA	F2Y2E1	Organic_Lake_phycodnavirus	36.6	2.0e-91
>prophage 216
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2577008	2577413	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000428360.1|2577008_2577413_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	73.0	8.4e-49
>prophage 217
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2580715	2581465	5342923		Pithovirus(100.0%)	1	NA	NA
WP_000513554.1|2580715_2581465_+	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	3.9e-15
>prophage 218
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2587615	2588371	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000993159.1|2587615_2588371_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	5.3e-28
>prophage 219
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2607042	2612939	5342923		Bacillus_phage(66.67%)	6	NA	NA
WP_000614967.1|2607042_2607732_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	8.5e-41
WP_000567230.1|2607728_2609189_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	7.3e-26
WP_000517933.1|2609305_2609875_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_001061042.1|2610185_2610611_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000604778.1|2610616_2611438_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001179951.1|2611508_2612939_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.9	2.2e-59
>prophage 220
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2616062	2617088	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000839429.1|2616062_2617088_+	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	41.7	8.1e-72
>prophage 221
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2627505	2628663	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_042516368.1|2627505_2628663_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.9	8.7e-22
>prophage 222
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2639949	2643125	5342923		Streptococcus_phage(50.0%)	3	NA	NA
WP_001041303.1|2639949_2640768_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.2	5.3e-34
WP_001994221.1|2640901_2642317_+	amino acid permease	NA	NA	NA	NA	NA
WP_001292178.1|2642483_2643125_+	nucleotide excision repair endonuclease	NA	D2XPX7	Bacillus_virus	49.0	3.2e-58
>prophage 223
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2661098	2661476	5342923		Listeria_phage(100.0%)	1	NA	NA
WP_000893556.1|2661098_2661476_-	HTH-type transcriptional regulator AnsR	NA	A8ATJ9	Listeria_phage	36.7	5.0e-11
>prophage 224
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2665473	2668876	5342923		Bacillus_phage(66.67%)	5	NA	NA
WP_000649079.1|2665473_2666607_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.8	2.5e-13
WP_001284598.1|2666854_2667067_+	small acid-soluble spore protein, SasP family	NA	A0A217EQS5	Bacillus_phage	63.1	9.3e-15
WP_000512132.1|2667361_2667877_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_001994093.1|2667912_2668389_-	YndM family protein	NA	NA	NA	NA	NA
WP_000069660.1|2668663_2668876_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	1.6e-14
>prophage 225
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2676512	2679119	5342923		Hokovirus(100.0%)	1	NA	NA
WP_000094191.1|2676512_2679119_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.8	1.8e-43
>prophage 226
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2714602	2714917	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000368861.1|2714602_2714917_+	DUF3892 domain-containing protein	NA	G3MB34	Bacillus_virus	38.3	4.4e-05
>prophage 227
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2724387	2732865	5342923		Planktothrix_phage(33.33%)	10	NA	NA
WP_000522862.1|2724387_2725053_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	1.7e-33
WP_000697747.1|2725240_2726266_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000265434.1|2726320_2726752_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_001167463.1|2727202_2727592_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000432457.1|2727579_2728452_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	4.7e-12
WP_000933348.1|2728439_2729057_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000202088.1|2729086_2729386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366243.1|2729740_2730208_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000679114.1|2730229_2730874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042516359.1|2730921_2732865_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1B0RXH7	Streptococcus_phage	37.0	6.2e-113
>prophage 228
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2736874	2743798	5342923		Mycobacterium_phage(33.33%)	5	NA	NA
WP_000747159.1|2736874_2738041_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	29.1	2.5e-24
WP_000531407.1|2738410_2740165_+	adenine deaminase	NA	NA	NA	NA	NA
WP_000723233.1|2740278_2740806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504376.1|2740929_2742309_-	catalase	NA	A0A2K9L572	Tupanvirus	39.8	4.4e-73
WP_001286463.1|2742580_2743798_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	28.5	1.9e-27
>prophage 229
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2752507	2753965	5342923		Burkholderia_virus(100.0%)	1	NA	NA
WP_001186941.1|2752507_2753965_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.2	2.8e-62
>prophage 230
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2767329	2769824	5342923		Catovirus(50.0%)	2	NA	NA
WP_000171466.1|2767329_2768361_+	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	29.2	7.0e-31
WP_000916212.1|2768636_2769824_+	RtcB family protein	NA	A0A222Z820	Bacillus_phage	78.7	1.0e-182
>prophage 231
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2774178	2778078	5342923		Streptococcus_phage(100.0%)	3	NA	NA
WP_000360704.1|2774178_2774997_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.3	3.5e-33
WP_000744729.1|2775695_2776799_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.0	6.2e-70
WP_001994205.1|2776830_2778078_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	50.9	1.3e-103
>prophage 232
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2790044	2791526	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000426481.1|2790044_2791526_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	1.0e-22
>prophage 233
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2799817	2801422	5342923		Hepacivirus(100.0%)	1	NA	NA
WP_000892289.1|2799817_2801422_+	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	23.8	4.0e-33
>prophage 234
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2804803	2808704	5342923		Bacillus_phage(50.0%)	5	NA	NA
WP_000755667.1|2804803_2806306_+	SH3 domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	72.0	2.6e-34
WP_000208614.1|2806535_2807210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000070087.1|2807228_2807750_-	kinase	NA	NA	NA	NA	NA
WP_000387608.1|2807851_2808157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994175.1|2808170_2808704_+	acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	43.1	2.3e-41
>prophage 235
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2814352	2818003	5342923		Cafeteria_roenbergensis_virus(33.33%)	3	NA	NA
WP_001273580.1|2814352_2815429_+	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	E3T537	Cafeteria_roenbergensis_virus	29.6	8.1e-14
WP_001269398.1|2815711_2816884_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	2.2e-41
WP_001197284.1|2816902_2818003_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.1	1.2e-23
>prophage 236
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2827666	2832513	5342923		Tupanvirus(33.33%)	3	NA	NA
WP_000633862.1|2827666_2829292_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.9	3.0e-52
WP_000808753.1|2829808_2831782_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.3	8.7e-139
WP_000346934.1|2831841_2832513_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	40.2	1.8e-27
>prophage 237
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2842274	2843072	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_131260294.1|2842274_2843072_+	BA2930 family N-acetyltransferase	NA	O64018	Bacillus_phage	54.2	8.8e-82
>prophage 238
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2846916	2847672	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000218628.1|2846916_2847672_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	7.1e-33
>prophage 239
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2856512	2857385	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001994432.1|2856512_2857385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	2.8e-12
>prophage 240
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2890797	2892814	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000865972.1|2890797_2891445_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	8.5e-35
WP_001037276.1|2891437_2892814_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	7.2e-15
>prophage 241
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2900647	2901649	5342923		Clostridium_phage(100.0%)	1	NA	NA
WP_000755451.1|2900647_2901649_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	46.0	1.9e-25
>prophage 242
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2921292	2921958	5342923		Apis_mellifera_filamentous_virus(100.0%)	1	NA	NA
WP_000850061.1|2921292_2921958_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	42.4	2.1e-28
>prophage 243
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2930126	2936901	5342923	protease	Acanthamoeba_polyphaga_lentillevirus(50.0%)	5	NA	NA
WP_000494284.1|2930126_2932244_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	37.4	1.5e-80
WP_000546562.1|2932269_2932653_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001994411.1|2932837_2933581_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000741636.1|2933600_2934467_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001994280.1|2934831_2936901_+	UvrD-helicase domain-containing protein	NA	A0A2H4UW05	Bodo_saltans_virus	25.3	2.4e-14
>prophage 244
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2941301	2953880	5342923		Geobacillus_phage(25.0%)	16	NA	NA
WP_000540634.1|2941301_2942108_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
WP_000820167.1|2942173_2942386_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000714659.1|2942388_2943774_-	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.9	7.8e-78
WP_000288934.1|2944021_2944426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000994639.1|2944439_2944793_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000655496.1|2944814_2945522_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_001093444.1|2945587_2945974_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000720567.1|2946183_2946702_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001065246.1|2947139_2948507_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000555725.1|2948637_2949072_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000364536.1|2949179_2949842_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_001125378.1|2949846_2950167_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_000337493.1|2950310_2950997_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_001100890.1|2951018_2951600_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	49.7	3.0e-47
WP_001227634.1|2951645_2952503_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000370609.1|2952674_2953880_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.7	1.5e-29
>prophage 245
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2964074	2965454	5342923		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000041221.1|2964074_2965454_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.5	6.2e-51
>prophage 246
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2981121	2981883	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001249048.1|2981121_2981883_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	38.2	2.4e-20
>prophage 247
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	2990178	2991612	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001994438.1|2990178_2991612_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.8	2.6e-23
>prophage 248
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3008236	3008740	5342923		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001994369.1|3008236_3008740_+	mep operon protein MepB	NA	A0A2H4UW84	Bodo_saltans_virus	38.9	5.1e-19
>prophage 249
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3021388	3021766	5342923		Microbacterium_phage(100.0%)	1	NA	NA
WP_000522464.1|3021388_3021766_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	35.1	1.6e-09
>prophage 250
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3029383	3030361	5342923		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001994406.1|3029383_3030361_-	endonuclease	NA	A0A0K2CNR4	Brevibacillus_phage	31.1	7.8e-16
>prophage 251
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3038606	3038945	5342923		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_001160780.1|3038606_3038945_-	divalent cation tolerance protein CutA	NA	A0A1S5V250	Saudi_moumouvirus	35.0	1.5e-14
>prophage 252
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3043774	3044638	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000725557.1|3043774_3044638_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	38.9	7.4e-34
>prophage 253
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3051687	3052650	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001124120.1|3051687_3052650_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.2	4.7e-13
>prophage 254
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3056852	3057875	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000849942.1|3056852_3057875_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	26.3	2.3e-10
>prophage 255
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3067370	3074344	5342923		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_001012256.1|3067370_3068639_+	HAMP domain-containing histidine kinase	NA	A0A1B1IUJ1	uncultured_Mediterranean_phage	32.4	3.0e-07
WP_000120182.1|3068731_3068839_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000282913.1|3068974_3069775_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001994374.1|3069767_3071468_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	4.9e-13
WP_001038202.1|3071478_3072027_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000864378.1|3072435_3073116_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001994391.1|3073165_3074344_-	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.0	6.8e-06
>prophage 256
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3083194	3083827	5342923		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001994266.1|3083194_3083827_-	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	6.6e-24
>prophage 257
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3097365	3097530	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001994263.1|3097365_3097530_-	hypothetical protein	NA	A0A1B1P7C5	Bacillus_phage	87.0	2.0e-17
>prophage 258
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3107898	3112134	5342923		Planktothrix_phage(50.0%)	4	NA	NA
WP_000404286.1|3107898_3108669_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	4.3e-33
WP_000469926.1|3108982_3109519_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_042516473.1|3109903_3110497_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042516472.1|3110505_3112134_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	29.8	4.2e-54
>prophage 259
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3125299	3126676	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000280106.1|3125299_3126676_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	42.9	1.7e-72
>prophage 260
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3135699	3139399	5342923		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_001994300.1|3135699_3136926_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	22.6	3.6e-10
WP_000472604.1|3137022_3137832_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042516348.1|3137953_3139399_-	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	24.0	3.9e-11
>prophage 261
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3153184	3156225	5342923		Bacillus_phage(66.67%)	3	NA	NA
WP_001038813.1|3153184_3153880_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.5	7.0e-43
WP_001243298.1|3153869_3155027_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	7.1e-32
WP_001994397.1|3155208_3156225_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.6	2.5e-17
>prophage 262
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3159227	3164466	5342923		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001994299.1|3159227_3161168_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.6	1.3e-65
WP_001994323.1|3161217_3162759_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_001994350.1|3162761_3163550_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001994423.1|3163554_3164466_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	8.9e-38
>prophage 263
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3173625	3187319	5342923		Bacillus_virus(20.0%)	8	NA	NA
WP_142337151.1|3173625_3173901_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	50.0	2.6e-17
WP_000481852.1|3173996_3175979_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	5.5e-16
WP_000469442.1|3177245_3177752_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001225569.1|3178195_3180925_-	phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	27.3	1.5e-11
WP_000061788.1|3181930_3183409_+	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.4	1.6e-28
WP_000520490.1|3183531_3184137_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000710124.1|3184544_3185783_-	beta-channel forming cytolysin	NA	NA	NA	NA	NA
WP_000791596.1|3186083_3187319_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0U4JE28	Exiguobacterium_phage	36.3	1.9e-19
>prophage 264
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3191840	3192941	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000217983.1|3191840_3192941_+	RapH N-terminal domain-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.3	1.3e-83
>prophage 265
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3207930	3210710	5342923		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805151.1|3207930_3208932_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.5	2.0e-22
WP_002002806.1|3209771_3210710_-	class A beta-lactamase Bla1	NA	A0A1B0VBP7	Salmonella_phage	43.6	9.7e-56
>prophage 266
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3221789	3222449	5342923		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001216343.1|3221789_3222449_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.2	4.2e-21
>prophage 267
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3234189	3235713	5342923	terminase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002157221.1|3234189_3234894_-|terminase	terminase	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	90.6	1.0e-121
WP_001061236.1|3235581_3235713_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	86.0	4.5e-12
>prophage 268
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3241546	3242233	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000885281.1|3241546_3241966_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	41.9	1.3e-12
WP_000811869.1|3241978_3242233_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	86.9	2.0e-35
>prophage 269
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3246012	3246774	5342923		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000721684.1|3246012_3246774_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.1	3.6e-08
>prophage 270
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3253675	3255028	5342923		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001983287.1|3253675_3255028_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	6.7e-58
>prophage 271
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3271064	3271649	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000380328.1|3271064_3271649_-	class I SAM-dependent methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	32.5	2.3e-10
>prophage 272
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3274921	3276310	5342923		Salmonella_phage(100.0%)	1	NA	NA
WP_001994417.1|3274921_3276310_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	34.7	2.0e-12
>prophage 273
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3283110	3287995	5342923		Bacillus_phage(100.0%)	4	NA	NA
WP_001994386.1|3283110_3283848_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	74.2	1.4e-102
WP_000774126.1|3284083_3284344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243527.1|3284451_3286248_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	6.4e-56
WP_000834771.1|3286240_3287995_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	5.9e-46
>prophage 274
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3299097	3303197	5342923		Lactococcus_phage(33.33%)	6	NA	NA
WP_000176368.1|3299097_3299301_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	1.5e-17
WP_042516344.1|3299387_3299573_+	cold-shock protein	NA	NA	NA	NA	NA
WP_000885377.1|3299612_3300164_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000946615.1|3300367_3300994_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	31.5	2.3e-08
WP_000275230.1|3301199_3301748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860382.1|3301796_3303197_-	protoporphyrinogen oxidase	NA	R4THQ7	Phaeocystis_globosa_virus	34.0	4.0e-05
>prophage 275
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3309421	3310072	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001994308.1|3309421_3310072_-	type A chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	52.6	9.4e-66
>prophage 276
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3328889	3333021	5342923	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_000106420.1|3328889_3329657_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.1e-32
WP_001994356.1|3330071_3330734_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_001994358.1|3331101_3333021_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	41.3	5.1e-144
>prophage 277
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3338499	3341565	5342923		Bacillus_phage(100.0%)	4	NA	NA
WP_001994399.1|3338499_3339693_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	75.3	7.8e-167
WP_001994402.1|3339781_3340306_-	DinB family protein	NA	NA	NA	NA	NA
WP_001994404.1|3340320_3341088_-	DUF3891 family protein	NA	NA	NA	NA	NA
WP_001043907.1|3341292_3341565_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	2.7e-27
>prophage 278
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3344626	3351784	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_001994413.1|3344626_3351784_-	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	28.9	3.8e-184
>prophage 279
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3381625	3384571	5342923		Enterococcus_phage(33.33%)	6	NA	NA
WP_000423633.1|3381625_3381832_+	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	45.0	2.2e-05
WP_000990235.1|3381901_3382114_-	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	49.3	2.1e-11
WP_001994418.1|3382349_3382661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000810931.1|3382728_3383436_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001066869.1|3383810_3384146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141565.1|3384355_3384571_+	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	79.4	1.7e-24
>prophage 280
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3390438	3391570	5342923		Tupanvirus(50.0%)	3	NA	NA
WP_000464539.1|3390438_3390837_-	CHRD domain-containing protein	NA	A0A2K9L200	Tupanvirus	37.5	2.5e-13
WP_000443219.1|3391040_3391178_+	DUF3956 family protein	NA	NA	NA	NA	NA
WP_000520720.1|3391297_3391570_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	67.8	2.5e-28
>prophage 281
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3399365	3401643	5342923		Orpheovirus(50.0%)	5	NA	NA
WP_000872039.1|3399365_3400187_-	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	32.9	7.8e-09
WP_000473370.1|3400186_3400369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658451.1|3400479_3400659_-	YozD family protein	NA	NA	NA	NA	NA
WP_000456537.1|3400808_3400976_+	DUF3930 family protein	NA	NA	NA	NA	NA
WP_000101489.1|3400980_3401643_-	hypothetical protein	NA	A0A0E3X9J2	Bacillus_phage	58.1	9.4e-05
>prophage 282
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3411881	3413000	5342923		Hokovirus(100.0%)	1	NA	NA
WP_041184360.1|3411881_3413000_-	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	24.6	1.9e-10
>prophage 283
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3425781	3439232	5342923		Bacillus_virus(20.0%)	12	NA	NA
WP_000614096.1|3425781_3426729_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	31.8	2.8e-26
WP_001045791.1|3426831_3427389_-	YdcF family protein	NA	NA	NA	NA	NA
WP_001275519.1|3427452_3428682_-	MFS transporter	NA	NA	NA	NA	NA
WP_000780361.1|3428683_3429220_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000767363.1|3429365_3430520_-	hypothetical protein	NA	Q6XM29	Feldmannia_irregularis_virus	37.0	3.9e-14
WP_000526213.1|3430554_3431775_-	glycosyltransferase	NA	A0A1V0SAJ8	Catovirus	31.8	1.4e-41
WP_001995367.1|3431863_3432376_-	gluconate kinase	NA	NA	NA	NA	NA
WP_000728404.1|3432842_3434174_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_000845168.1|3434319_3435477_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.5	3.5e-23
WP_000902498.1|3436125_3437028_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000836596.1|3437024_3438044_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000649134.1|3438194_3439232_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	1.5e-28
>prophage 284
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3443795	3445751	5342923		Ralstonia_phage(33.33%)	4	NA	NA
WP_000540513.1|3443795_3444245_+	NUDIX hydrolase	NA	A0A1L7N1W6	Ralstonia_phage	32.6	1.1e-09
WP_000816785.1|3444280_3444829_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.4	2.9e-36
WP_001983332.1|3444940_3445135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713488.1|3445262_3445751_-	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	47.6	9.3e-34
>prophage 285
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3450933	3456494	5342923		Acanthamoeba_polyphaga_moumouvirus(50.0%)	5	NA	NA
WP_001995393.1|3450933_3452835_-	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	30.3	3.0e-35
WP_001288087.1|3453052_3453514_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_000833353.1|3453555_3454143_-	SCO family protein	NA	NA	NA	NA	NA
WP_001129607.1|3454478_3455453_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003266758.1|3455651_3456494_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	44.5	4.7e-25
>prophage 286
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3463124	3464589	5342923		Bacillus_virus(50.0%)	2	NA	NA
WP_000637211.1|3463124_3463613_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	47.2	1.5e-39
WP_000679592.1|3463632_3464589_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	1.5e-123
>prophage 287
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3474513	3475224	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001995380.1|3474513_3475224_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	3.7e-15
>prophage 288
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3487732	3492518	5342923		Bacillus_phage(66.67%)	4	NA	NA
WP_000694900.1|3487732_3489091_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	3.3e-28
WP_000504574.1|3489094_3489778_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	6.4e-33
WP_001995366.1|3489906_3491337_-	anion permease	NA	NA	NA	NA	NA
WP_001221979.1|3491333_3492518_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	33.5	3.6e-31
>prophage 289
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3502150	3507644	5342923	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_000551901.1|3502150_3503386_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	24.4	1.3e-15
WP_000516940.1|3503544_3504327_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	28.8	7.7e-14
WP_000428104.1|3505056_3505512_-	DUF4274 domain-containing protein	NA	NA	NA	NA	NA
WP_001041138.1|3506025_3506376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404146.1|3506381_3507644_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	31.5	8.6e-07
>prophage 290
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3514131	3521610	5342923	tRNA	Mycobacterium_phage(50.0%)	5	NA	NA
WP_001995142.1|3514131_3518139_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.3	1.5e-36
WP_000391132.1|3518170_3518533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241763.1|3518561_3519335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966845.1|3519346_3520111_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000529813.1|3520311_3521610_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.2	3.6e-77
>prophage 291
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3525066	3528168	5342923	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_001995101.1|3525066_3528168_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.7	8.8e-154
>prophage 292
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3534967	3536656	5342923	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001995154.1|3534967_3536656_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.3	4.7e-77
>prophage 293
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3541924	3546128	5342923		Brochothrix_phage(33.33%)	5	NA	NA
WP_000982029.1|3541924_3542263_-	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	60.7	5.8e-35
WP_000975124.1|3542421_3542676_-	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_001260645.1|3542781_3543513_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000783196.1|3543588_3545484_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	1.4e-56
WP_000165945.1|3545480_3546128_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	31.4	2.0e-12
>prophage 294
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3552354	3553501	5342923		Bacillus_phage(50.0%)	3	NA	NA
WP_000512844.1|3552354_3552546_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	1.4e-14
WP_000069077.1|3552630_3553131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427804.1|3553225_3553501_-	stage V sporulation protein SpoVS	NA	A0A1J0GVV0	Streptomyces_phage	44.6	3.8e-08
>prophage 295
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3575123	3576599	5342923		Escherichia_phage(100.0%)	1	NA	NA
WP_000692686.1|3575123_3576599_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	4.2e-21
>prophage 296
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3586583	3587066	5342923		Fowlpox_virus(100.0%)	1	NA	NA
WP_000219438.1|3586583_3587066_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.0	2.0e-25
>prophage 297
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3593337	3594507	5342923		Catovirus(100.0%)	1	NA	NA
WP_000588613.1|3593337_3594507_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.6	2.2e-41
>prophage 298
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3608446	3613943	5342923		Bacillus_phage(33.33%)	5	NA	NA
WP_000411318.1|3608446_3609574_-	metallophosphoesterase	NA	A0A127AVW0	Bacillus_phage	27.3	6.1e-12
WP_001021914.1|3609721_3610144_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000348015.1|3610274_3611675_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.0	1.9e-26
WP_000755134.1|3611721_3612567_-	YitT family protein	NA	NA	NA	NA	NA
WP_000024455.1|3612734_3613943_-	glycosyl transferase	NA	A0A2H4UZV8	Operophtera_brumata_nucleopolyhedrovirus	34.5	8.0e-10
>prophage 299
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3621164	3625949	5342923		Micromonas_sp._RCC1109_virus(66.67%)	5	NA	NA
WP_001254086.1|3621164_3622190_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	32.5	2.0e-46
WP_001174433.1|3622176_3623076_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	37.3	9.0e-43
WP_001995099.1|3623106_3623880_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001031171.1|3624008_3625478_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001190046.1|3625490_3625949_-	RidA family protein	NA	M1IDR7	Acanthocystis_turfacea_Chlorella_virus	39.0	1.5e-22
>prophage 300
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3658440	3662127	5342923		Bacillus_phage(50.0%)	4	NA	NA
WP_000911694.1|3658440_3658857_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.0	2.1e-39
WP_000824543.1|3658915_3660577_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002002597.1|3660653_3661667_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000283897.1|3661674_3662127_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.9	4.9e-29
>prophage 301
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3665775	3667317	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001995145.1|3665775_3667317_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	51.4	1.8e-51
>prophage 302
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3671953	3673417	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_001168143.1|3671953_3673417_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.4	1.8e-16
>prophage 303
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3676669	3681539	5342923		Clostridium_phage(50.0%)	5	NA	NA
WP_000105198.1|3676669_3677113_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	3.6e-45
WP_001990330.1|3677354_3678395_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_000965074.1|3678429_3678798_-	DUF3979 family protein	NA	NA	NA	NA	NA
WP_001995522.1|3679049_3679355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533104.1|3679556_3681539_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	9.0e-27
>prophage 304
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3687157	3696075	5342923	protease	Bacillus_phage(20.0%)	9	NA	NA
WP_001089035.1|3687157_3688108_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	58.1	1.5e-96
WP_000648331.1|3688382_3688670_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	54.1	2.2e-11
WP_001995526.1|3688786_3690667_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000174879.1|3690938_3691757_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.1e-94
WP_000024996.1|3691803_3692265_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	6.5e-05
WP_000520828.1|3692598_3693759_-	peptidase	NA	NA	NA	NA	NA
WP_001995528.1|3693905_3694658_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000540419.1|3694881_3695022_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000686814.1|3695109_3696075_+	patatin-like phospholipase family protein	NA	A0A0H3TN97	Faustovirus	28.3	3.6e-21
>prophage 305
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3700064	3700271	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000113545.1|3700064_3700271_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
>prophage 306
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3708402	3712883	5342923		Bacillus_phage(66.67%)	5	NA	NA
WP_000119508.1|3708402_3709083_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.7	1.7e-17
WP_000873555.1|3709242_3709899_-	lipoprotein	NA	NA	NA	NA	NA
WP_000409386.1|3709913_3710735_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000824517.1|3710835_3712197_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.9	9.8e-41
WP_001142156.1|3712193_3712883_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	4.5e-34
>prophage 307
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3725285	3743104	5342923		Bacillus_phage(50.0%)	17	NA	NA
WP_001258513.1|3725285_3726158_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
WP_000103838.1|3726292_3726964_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_000818985.1|3727113_3727833_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823554.1|3728029_3728617_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001231497.1|3728641_3729715_-	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_171856546.1|3729711_3730416_-	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_000453763.1|3730477_3732238_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_001194301.1|3732478_3733243_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755546.1|3733341_3734604_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_000789349.1|3735303_3735474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001991648.1|3735521_3736124_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000825876.1|3736368_3737322_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	4.6e-21
WP_001995457.1|3737524_3738526_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_000695192.1|3738614_3739061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459100.1|3739151_3739373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995435.1|3739661_3741386_-	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	32.4	3.4e-22
WP_000824074.1|3741388_3743104_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	24.6	6.4e-21
>prophage 308
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3752073	3757921	5342923		Organic_Lake_phycodnavirus(33.33%)	6	NA	NA
WP_001196686.1|3752073_3752775_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.4	1.8e-14
WP_000149313.1|3752752_3753526_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.2	4.9e-13
WP_000062015.1|3753615_3754833_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001995459.1|3755014_3756010_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_001995456.1|3756009_3756426_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001995451.1|3756430_3757921_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	8.5e-46
>prophage 309
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3780031	3784930	5342923		Streptococcus_phage(50.0%)	3	NA	NA
WP_000766776.1|3780031_3782176_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	35.9	5.8e-72
WP_000495736.1|3782509_3783055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000721647.1|3783235_3784930_-	SH3 domain-containing protein	NA	D6QWN5	uncultured_phage	43.8	6.8e-15
>prophage 310
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3791798	3793100	5342923		Geobacillus_virus(100.0%)	1	NA	NA
WP_001995447.1|3791798_3793100_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.2	2.5e-134
>prophage 311
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3796705	3801969	5342923		Hokovirus(33.33%)	6	NA	NA
WP_000398538.1|3796705_3798142_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.4	2.8e-14
WP_001994798.1|3798142_3798856_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	6.3e-39
WP_000722584.1|3799185_3799536_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000830531.1|3799558_3800290_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593662.1|3800302_3801055_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000539072.1|3801051_3801969_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	2.6e-45
>prophage 312
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3817475	3819231	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000695323.1|3817475_3818543_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	2.4e-26
WP_000414551.1|3818532_3819231_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	6.0e-34
>prophage 313
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3834341	3835322	5342923		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000935229.1|3834341_3835322_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	30.7	6.9e-20
>prophage 314
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3846885	3848598	5342923		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000816361.1|3846885_3848598_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.8	9.7e-70
>prophage 315
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3856984	3857689	5342923		Orpheovirus(100.0%)	1	NA	NA
WP_000726880.1|3856984_3857689_+	polysaccharide deacetylase family protein	NA	A0A2I2L4G0	Orpheovirus	26.2	1.6e-10
>prophage 316
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3862979	3863897	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001994813.1|3862979_3863897_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	55.2	1.6e-90
>prophage 317
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3875784	3878762	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000755994.1|3875784_3877197_-	S-layer homology domain-containing protein	NA	A0A172JHT5	Bacillus_phage	28.9	1.6e-06
WP_000797222.1|3877517_3878762_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	34.9	1.2e-16
>prophage 318
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3884594	3890324	5342923		Marinitoga_camini_virus(33.33%)	5	NA	NA
WP_000051972.1|3884594_3885044_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	50.8	9.5e-09
WP_000284908.1|3885185_3886169_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.7	2.1e-61
WP_001983127.1|3886629_3886803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047591.1|3886903_3887038_+	DUF3934 domain-containing protein	NA	NA	NA	NA	NA
WP_000011034.1|3887129_3890324_-	DEAD/DEAH box helicase	NA	M1HVH7	Acanthocystis_turfacea_Chlorella_virus	30.6	2.6e-36
>prophage 319
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3902055	3904861	5342923		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001093833.1|3902055_3902994_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	8.9e-25
WP_000397667.1|3903111_3904218_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_000694111.1|3904222_3904861_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.1	6.9e-05
>prophage 320
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3924299	3924959	5342923		Synechococcus_phage(100.0%)	1	NA	NA
WP_001104665.1|3924299_3924959_-	class I SAM-dependent methyltransferase	NA	A0A0E3HGK7	Synechococcus_phage	29.9	6.9e-08
>prophage 321
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3934701	3936525	5342923		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001994760.1|3934701_3936525_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	29.2	2.0e-33
>prophage 322
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3948687	3949680	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000354396.1|3948687_3949680_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	2.0e-22
>prophage 323
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3952793	3954005	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000212379.1|3952793_3954005_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	36.6	2.0e-05
>prophage 324
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3967824	3968610	5342923		Geobacillus_virus(100.0%)	1	NA	NA
WP_001994763.1|3967824_3968610_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	50.0	1.2e-30
>prophage 325
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	3973105	3974014	5342923		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000075958.1|3973105_3974014_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	6.8e-46
>prophage 326
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4007835	4008153	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000678048.1|4007835_4008153_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	44.4	1.4e-11
>prophage 327
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4015583	4021141	5342923	integrase	Clostridium_phage(50.0%)	4	4015341:4015363	4021289:4021311
4015341:4015363	attL	AAAAAGGAGATTACTATCTTATA	NA	NA	NA	NA
WP_001994656.1|4015583_4016699_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	26.4	3.2e-13
WP_001994650.1|4016717_4018820_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001994655.1|4018816_4019197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994662.1|4019275_4021141_+	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	42.9	8.1e-86
4021289:4021311	attR	TATAAGATAGTAATCTCCTTTTT	NA	NA	NA	NA
>prophage 328
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4028135	4028333	5342923		Lactococcus_phage(100.0%)	1	NA	NA
WP_001161732.1|4028135_4028333_+	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	61.3	4.6e-16
>prophage 329
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4050111	4056631	5342923	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_000757056.1|4050111_4050978_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	33.6	4.2e-21
WP_000964957.1|4051108_4051834_-	magnesium transporter	NA	NA	NA	NA	NA
WP_000606864.1|4052526_4052913_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000084951.1|4052909_4054145_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	23.3	5.3e-09
WP_000169023.1|4054148_4054460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235536.1|4054543_4055011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239364.1|4055275_4056631_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	32.5	8.5e-45
>prophage 330
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4076211	4076766	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000862921.1|4076211_4076766_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	27.0	1.3e-10
>prophage 331
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4080540	4081143	5342923		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000155594.1|4080540_4081143_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	33.9	5.3e-23
>prophage 332
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4085110	4096146	5342923	tRNA	Bacillus_phage(50.0%)	11	NA	NA
WP_000728549.1|4085110_4085818_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	50.4	3.9e-25
WP_000761551.1|4085939_4087127_-	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_000758754.1|4087145_4087649_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_000358352.1|4087656_4087827_-	YpmA family protein	NA	NA	NA	NA	NA
WP_000044923.1|4088077_4090882_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	30.0	6.0e-69
WP_001995286.1|4091010_4091394_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_001995293.1|4091406_4092255_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000851103.1|4092251_4093091_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	38.0	1.0e-48
WP_000026410.1|4093497_4093887_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001995279.1|4093987_4094968_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000402223.1|4094952_4096146_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.0	3.4e-37
>prophage 333
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4099810	4100692	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000203308.1|4099810_4100692_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.2	7.7e-71
>prophage 334
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4107317	4117514	5342923		Bacillus_virus(14.29%)	11	NA	NA
WP_001095923.1|4107317_4107854_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	52.0	1.3e-44
WP_001168686.1|4107927_4109190_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001264014.1|4109502_4110615_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.7	3.3e-18
WP_000526833.1|4110746_4111838_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269368.1|4111837_4113010_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.6	3.9e-46
WP_000415887.1|4113280_4113727_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.0e-27
WP_000776082.1|4113851_4114814_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.8	3.8e-07
WP_001995289.1|4114845_4115559_-	2-heptaprenyl-1,4-naphthoquinone methyltransferase	NA	NA	NA	NA	NA
WP_002157308.1|4115588_4116338_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001151482.1|4116551_4117121_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.3	2.4e-49
WP_001043860.1|4117241_4117514_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	1.0e-29
>prophage 335
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4131678	4132209	5342923		uncultured_phage(100.0%)	1	NA	NA
WP_001240643.1|4131678_4132209_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWN1	uncultured_phage	63.2	5.3e-59
>prophage 336
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4137919	4146892	5342923		Bacillus_phage(60.0%)	9	NA	NA
WP_000763001.1|4137919_4139449_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	1.2e-55
WP_001176991.1|4139438_4140500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001151996.1|4140767_4141016_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.5e-16
WP_000810850.1|4141139_4141718_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000711804.1|4142265_4142952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645704.1|4142982_4143597_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	41.7	2.0e-17
WP_000781291.1|4143681_4144263_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000964667.1|4144400_4146176_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	36.0	1.6e-35
WP_001995633.1|4146175_4146892_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	41.7	2.1e-42
>prophage 337
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4152863	4155014	5342923		Erythrobacter_phage(50.0%)	2	NA	NA
WP_001252616.1|4152863_4153988_-	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	24.3	9.1e-08
WP_000082669.1|4154099_4155014_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	9.9e-37
>prophage 338
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4160627	4165952	5342923	integrase	Bacillus_phage(66.67%)	5	4160516:4160530	4172121:4172135
4160516:4160530	attL	GACTTTTTATTAAAA	NA	NA	NA	NA
WP_000797496.1|4160627_4162439_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.3	5.0e-32
WP_000806236.1|4162546_4163077_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
WP_001094858.1|4163196_4163391_+	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000897348.1|4163683_4164529_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_000937256.1|4164689_4165952_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.5	5.9e-16
4172121:4172135	attR	TTTTAATAAAAAGTC	NA	NA	NA	NA
>prophage 339
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4189994	4191266	5342923		Rhodococcus_phage(100.0%)	1	NA	NA
WP_000726096.1|4189994_4191266_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	37.2	2.6e-11
>prophage 340
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4197968	4199105	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_000107517.1|4197968_4199105_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.6	4.6e-44
>prophage 341
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4202793	4206615	5342923		Streptococcus_phage(50.0%)	3	NA	NA
WP_000941735.1|4202793_4204680_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.0	1.6e-86
WP_000285422.1|4204861_4205563_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001995541.1|4205595_4206615_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.8	1.9e-33
>prophage 342
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4217850	4222616	5342923		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000721814.1|4217850_4219371_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.5	5.5e-08
WP_001151734.1|4219372_4220383_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000822948.1|4220409_4220919_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000095860.1|4220915_4222616_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	33.8	1.2e-64
>prophage 343
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4237787	4242973	5342923		Bacillus_phage(33.33%)	6	NA	NA
WP_000041153.1|4237787_4238234_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.7	7.0e-12
WP_000929023.1|4238226_4238403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995542.1|4238629_4239799_-	N-acyl-aliphatic-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
WP_000440293.1|4240136_4240283_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_000770518.1|4240295_4241810_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.7	6.8e-51
WP_000127947.1|4241806_4242973_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.2	3.1e-19
>prophage 344
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4250974	4258580	5342923		Bacillus_virus(50.0%)	8	NA	NA
WP_000528800.1|4250974_4251877_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.2	2.2e-36
WP_000838771.1|4251891_4252674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137730.1|4252670_4253369_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.9	1.2e-13
WP_000687513.1|4253365_4253746_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001203038.1|4253962_4254931_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	74.1	1.2e-138
WP_000651631.1|4255477_4256281_-	HNH endonuclease	NA	H9YQ79	environmental_Halophage	41.9	3.8e-16
WP_001995263.1|4256506_4258198_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	71.6	1.5e-235
WP_000959450.1|4258220_4258580_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.5	7.3e-36
>prophage 345
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4261802	4264181	5342923		Pneumococcus_phage(25.0%)	4	NA	NA
WP_000918895.1|4261802_4262300_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.6	2.4e-53
WP_000036288.1|4262318_4263035_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.9	5.7e-56
WP_000368412.1|4263027_4263519_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	71.7	4.0e-61
WP_000711596.1|4263518_4264181_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	3.3e-66
>prophage 346
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4269128	4270625	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000669136.1|4269128_4270625_+	DUF3149 domain-containing protein	NA	W8CYF6	Bacillus_phage	30.7	5.6e-21
>prophage 347
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4282290	4283292	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_000006179.1|4282290_4283292_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	4.9e-29
>prophage 348
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4289122	4296512	5342923		Bacillus_phage(75.0%)	10	NA	NA
WP_000250412.1|4289122_4289866_-	acetoacetyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	1.9e-17
WP_000566952.1|4290017_4290500_-	polyhydroxyalkanoic acid synthase subunit PhaR	NA	NA	NA	NA	NA
WP_000903020.1|4290698_4291151_+	poly-beta-hydroxybutyrate-responsive repressor	NA	NA	NA	NA	NA
WP_000448586.1|4291193_4291718_+	polyhydroxyalkanoic acid inclusion protein PhaP	NA	NA	NA	NA	NA
WP_001067916.1|4291819_4292263_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001140707.1|4292410_4292596_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	69.0	4.0e-14
WP_000822328.1|4292710_4294030_+	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_000383325.1|4294324_4295119_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	39.5	1.6e-27
WP_000893036.1|4295322_4296174_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_001103777.1|4296200_4296512_-	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	33.0	3.3e-08
>prophage 349
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4301314	4303390	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000494829.1|4301314_4302715_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.1	2.9e-40
WP_000049878.1|4302718_4303390_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.3	2.1e-52
>prophage 350
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4308929	4309757	5342923	protease	Bacillus_phage(100.0%)	1	NA	NA
WP_000747596.1|4308929_4309757_+|protease	serine protease	protease	U5Q0C0	Bacillus_phage	67.7	3.7e-43
>prophage 351
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4316938	4318767	5342923		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000715491.1|4316938_4317787_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.4	1.0e-11
WP_000720319.1|4317783_4318767_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	31.2	9.3e-25
>prophage 352
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4332344	4333244	5342923		Cedratvirus(100.0%)	1	NA	NA
WP_000054722.1|4332344_4333244_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.0	4.7e-15
>prophage 353
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4344440	4344650	5342923		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000428510.1|4344440_4344650_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	41.1	1.3e-05
>prophage 354
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4365574	4371724	5342923		Acinetobacter_phage(75.0%)	5	NA	NA
WP_001995645.1|4365574_4366336_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.4	6.3e-37
WP_001995649.1|4366337_4367363_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	2.3e-50
WP_000636334.1|4367359_4367947_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	49.5	4.2e-49
WP_001995646.1|4367943_4369362_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000107220.1|4370245_4371724_+	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	25.2	3.3e-10
>prophage 355
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4377307	4379146	5342923		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001995648.1|4377307_4379146_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	8.4e-27
>prophage 356
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4385598	4387875	5342923		Acanthocystis_turfacea_Chlorella_virus(33.33%)	3	NA	NA
WP_001994635.1|4385598_4386567_-	dTDP-glucose 4,6-dehydratase	NA	M1HHF3	Acanthocystis_turfacea_Chlorella_virus	44.1	6.5e-71
WP_000864162.1|4386583_4387129_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.1	6.7e-33
WP_000676166.1|4387137_4387875_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	44.9	5.1e-52
>prophage 357
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4392459	4397306	5342923		Cedratvirus(33.33%)	5	NA	NA
WP_000444380.1|4392459_4393305_+	class I SAM-dependent methyltransferase	NA	A0A2R8FFV8	Cedratvirus	54.3	1.7e-59
WP_001292832.1|4393519_4394272_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001994556.1|4394285_4395212_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.1	1.4e-06
WP_000654717.1|4395330_4396491_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_000872717.1|4396565_4397306_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TNS0	Salmonella_phage	27.0	2.0e-11
>prophage 358
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4404369	4406196	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_000003393.1|4404369_4406196_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.7	4.7e-62
>prophage 359
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4410199	4410874	5342923		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001994610.1|4410199_4410874_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	44.6	1.4e-27
>prophage 360
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4415699	4417671	5342923		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_000166346.1|4415699_4416635_-	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	23.7	1.1e-06
WP_000854348.1|4416627_4417671_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.1e-18
>prophage 361
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4423685	4424432	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000966134.1|4423685_4424432_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	41.2	1.0e-44
>prophage 362
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4430301	4432902	5342923		Cronobacter_phage(100.0%)	1	NA	NA
WP_000365382.1|4430301_4432902_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.6	2.0e-119
>prophage 363
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4444210	4451290	5342923		Tupanvirus(33.33%)	6	NA	NA
WP_001069157.1|4444210_4445677_-	catalase	NA	A0A2K9L572	Tupanvirus	51.6	1.4e-125
WP_001994593.1|4445757_4446696_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000333969.1|4446884_4448732_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	26.8	6.2e-22
WP_000616043.1|4448970_4449525_+	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_000233490.1|4449583_4449949_-	YisL family protein	NA	NA	NA	NA	NA
WP_000616652.1|4450099_4451290_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.4	3.7e-28
>prophage 364
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4454908	4459187	5342923		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_001141566.1|4454908_4455124_+	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.9	3.4e-25
WP_000718623.1|4455161_4455449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994578.1|4455461_4459187_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	24.7	3.8e-18
>prophage 365
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4466036	4466240	5342923		Lactococcus_phage(100.0%)	1	NA	NA
WP_000301519.1|4466036_4466240_-	RNA chaperone/antiterminator CspA	NA	Q9AZD3	Lactococcus_phage	64.5	2.1e-16
>prophage 366
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4471765	4472422	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000739945.1|4471765_4472422_-	S-layer homology domain-containing protein	NA	A0A218KDG5	Bacillus_phage	32.3	2.5e-05
>prophage 367
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4477513	4479970	5342923		Bacillus_phage(50.0%)	2	NA	NA
WP_000272692.1|4477513_4478218_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.6e-34
WP_001010464.1|4478227_4479970_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.9	8.5e-13
>prophage 368
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4494772	4496305	5342923		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001055162.1|4494772_4496305_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.2	1.3e-44
>prophage 369
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4537520	4539258	5342923		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001292612.1|4537520_4538264_-	ABC transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	4.1e-25
WP_001016833.1|4538823_4539258_+	HIT family protein	NA	S5VWB9	Mycobacterium_phage	34.4	1.6e-05
>prophage 370
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4557837	4564192	5342923		Acanthocystis_turfacea_Chlorella_virus(25.0%)	8	NA	NA
WP_001272193.1|4557837_4558659_-	glycerol uptake facilitator protein GlpF	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	36.7	2.3e-29
WP_000394287.1|4558887_4559448_-	glycerol uptake operon antiterminator GlpP	NA	NA	NA	NA	NA
WP_000577668.1|4559544_4559994_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.2	9.8e-06
WP_000554487.1|4560353_4561205_-	DUF2935 domain-containing protein	NA	G5CQX5	Megavirus	26.2	3.1e-08
WP_000449227.1|4561377_4561578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144402858.1|4561658_4562531_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000710219.1|4562767_4563097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000500585.1|4563097_4564192_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
>prophage 371
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4568554	4569481	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000249937.1|4568554_4569481_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	39.7	7.2e-19
>prophage 372
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4576084	4577500	5342923		Bacillus_virus(50.0%)	3	NA	NA
WP_000273536.1|4576084_4576225_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	63.4	6.1e-07
WP_001036902.1|4576291_4576876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000515996.1|4576963_4577500_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	91.3	1.3e-57
>prophage 373
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4581487	4587686	5342923		Bacillus_phage(66.67%)	5	NA	NA
WP_000834156.1|4581487_4584178_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.1	4.3e-40
WP_000429052.1|4584194_4585052_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000025545.1|4585090_4586233_-	fused response regulator/phosphatase	NA	W8CYM9	Bacillus_phage	30.4	1.2e-10
WP_000017766.1|4586400_4586841_-	bacterioferritin	NA	NA	NA	NA	NA
WP_002157437.1|4586909_4587686_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	29.5	2.6e-22
>prophage 374
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4599718	4600828	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000110734.1|4599718_4600828_-	RapH N-terminal domain-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.4	3.8e-83
>prophage 375
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4629752	4631902	5342923		Bacillus_phage(50.0%)	2	NA	NA
WP_001994591.1|4629752_4631039_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	58.2	1.4e-137
WP_001994576.1|4631035_4631902_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.2	9.6e-50
>prophage 376
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4644642	4647843	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001994590.1|4644642_4647843_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	26.4	2.2e-43
>prophage 377
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4669847	4671170	5342923		Burkholderia_virus(100.0%)	1	NA	NA
WP_001994629.1|4669847_4671170_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	7.5e-46
>prophage 378
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4684680	4685673	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_001994641.1|4684680_4685673_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	5.7e-14
>prophage 379
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4692081	4696057	5342923	integrase	Klosneuvirus(33.33%)	4	4682909:4682923	4702941:4702955
4682909:4682923	attL	TGTTTCTTTTTTATA	NA	NA	NA	NA
WP_001994615.1|4692081_4693059_-	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	30.5	9.9e-19
WP_001994563.1|4693078_4694074_-	proline racemase family protein	NA	NA	NA	NA	NA
WP_000501040.1|4694212_4694455_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	57.8	8.1e-07
WP_001265869.1|4694902_4696057_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	30.4	2.6e-10
4702941:4702955	attR	TATAAAAAAGAAACA	NA	NA	NA	NA
>prophage 380
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4704520	4709848	5342923	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001995407.1|4704520_4706110_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.8	7.7e-13
WP_000930036.1|4706350_4707400_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_001995412.1|4707526_4707706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001277353.1|4707727_4708054_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001995425.1|4708300_4709848_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	26.2	3.2e-11
>prophage 381
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4713123	4714539	5342923		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000232127.1|4713123_4714539_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.9	1.0e-64
>prophage 382
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4732100	4737459	5342923		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001995419.1|4732100_4733657_-	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.0	7.3e-40
WP_002002173.1|4733971_4735462_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_001995404.1|4735719_4737459_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	58.6	9.6e-41
>prophage 383
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4750964	4760687	5342923		Bacillus_phage(60.0%)	8	NA	NA
WP_000013338.1|4750964_4751168_+	small acid-soluble spore protein, SasP family	NA	Q77YX0	Bacillus_phage	65.2	2.1e-16
WP_000623609.1|4751219_4751954_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	3.4e-40
WP_000281491.1|4751982_4752681_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000732848.1|4752667_4753465_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000116618.1|4753736_4755737_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	1.4e-38
WP_000493191.1|4755733_4757494_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	7.7e-46
WP_000213637.1|4758084_4759524_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000423698.1|4759601_4760687_-	DUF3626 domain-containing protein	NA	A0A2H4UV60	Bodo_saltans_virus	23.8	1.9e-07
>prophage 384
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4764352	4766350	5342923		Tupanvirus(100.0%)	1	NA	NA
WP_001035753.1|4764352_4766350_+	catalase	NA	A0A2K9L572	Tupanvirus	51.3	1.3e-150
>prophage 385
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4776527	4780743	5342923	transposase	Bacillus_virus(100.0%)	5	NA	NA
WP_011198571.1|4776527_4777013_-	PRK06770 family protein	NA	G3MB13	Bacillus_virus	28.5	3.9e-08
WP_001995333.1|4777012_4777414_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_001071546.1|4777569_4777974_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000901938.1|4778134_4779199_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_001995334.1|4779273_4780743_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	40.7	1.1e-66
>prophage 386
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4793354	4794964	5342923		Mycobacterium_phage(50.0%)	2	NA	NA
WP_000557751.1|4793354_4794167_+	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	31.1	3.9e-29
WP_000440970.1|4794184_4794964_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	35.6	6.9e-39
>prophage 387
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4804153	4807871	5342923		Planktothrix_phage(50.0%)	3	NA	NA
WP_000609105.1|4804153_4804828_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.2e-36
WP_001097698.1|4804830_4806006_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042516438.1|4806521_4807871_+	3D domain-containing protein	NA	J9PQW7	Bacillus_phage	70.5	2.5e-36
>prophage 388
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4839566	4846542	5342923		Bacillus_phage(25.0%)	8	NA	NA
WP_000049738.1|4839566_4841042_+	beta-fructofuranosidase	NA	S6ATV4	Bacillus_phage	26.6	6.1e-20
WP_001995331.1|4841038_4841980_+	fructokinase	NA	NA	NA	NA	NA
WP_000834195.1|4841991_4842243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000732008.1|4842347_4843109_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001136280.1|4843174_4844041_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	3.3e-58
WP_000482728.1|4844242_4845544_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.5	2.8e-53
WP_000432827.1|4845641_4845845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000615282.1|4845891_4846542_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	5.2e-32
>prophage 389
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4854139	4856215	5342923		Streptococcus_phage(100.0%)	1	NA	NA
WP_001247981.1|4854139_4856215_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.6	4.7e-42
>prophage 390
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4865876	4871512	5342923		Bacillus_virus(33.33%)	6	NA	NA
WP_001256815.1|4865876_4866626_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.2e-32
WP_000666826.1|4866594_4867290_-	thiaminase II	NA	NA	NA	NA	NA
WP_001056067.1|4867920_4869081_+	SH3 domain-containing protein	NA	A0A0D4DC81	Staphylococcus_phage	34.6	1.2e-10
WP_001137828.1|4869086_4869419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000648923.1|4869646_4870798_-	DUF3965 domain-containing protein	NA	NA	NA	NA	NA
WP_000199023.1|4871092_4871512_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	34.1	1.8e-09
>prophage 391
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4879000	4882045	5342923		Leptospira_phage(100.0%)	1	NA	NA
WP_000375580.1|4879000_4882045_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.0e-66
>prophage 392
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4903786	4905569	5342923		Clostridioides_phage(50.0%)	2	NA	NA
WP_000301182.1|4903786_4903987_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	52.6	3.6e-08
WP_000487176.1|4904276_4905569_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	3.4e-43
>prophage 393
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4912416	4917805	5342923		Acinetobacter_phage(33.33%)	6	NA	NA
WP_000443151.1|4912416_4913802_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	6.4e-64
WP_001041717.1|4913831_4914464_-	class A sortase	NA	NA	NA	NA	NA
WP_001080034.1|4914580_4915054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154008.1|4915046_4915265_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001105815.1|4915377_4916640_-	cell wall-binding protein	NA	A0A0S2SXZ8	Bacillus_phage	69.9	7.7e-32
WP_000495008.1|4916860_4917805_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	9.6e-11
>prophage 394
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4922923	4926619	5342923		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000676767.1|4922923_4923925_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	58.3	1.9e-89
WP_000730993.1|4923998_4924850_-	phospholipase C	NA	NA	NA	NA	NA
WP_000948234.1|4925103_4925448_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000645822.1|4925566_4926619_-	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
>prophage 395
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4931022	4935069	5342923		Synechococcus_phage(50.0%)	4	NA	NA
WP_000667661.1|4931022_4931670_-	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.8	8.8e-48
WP_000759002.1|4931705_4932632_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_001074633.1|4932646_4933582_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001995472.1|4933584_4935069_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	3.7e-17
>prophage 396
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4941496	4943429	5342923		Planktothrix_phage(50.0%)	2	NA	NA
WP_000795371.1|4941496_4942516_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.2e-20
WP_001196379.1|4942502_4943429_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	5.1e-17
>prophage 397
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4948058	4954752	5342923		Bacillus_phage(50.0%)	6	NA	NA
WP_001995486.1|4948058_4949510_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.6	1.5e-140
WP_001995494.1|4949665_4950913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227649.1|4951087_4951765_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	6.4e-33
WP_000822545.1|4951776_4953165_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.5e-31
WP_000085786.1|4953181_4953703_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002002119.1|4953768_4954752_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.9	6.0e-16
>prophage 398
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4960751	4962323	5342923		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000916480.1|4960751_4961582_-	glutamine ABC transporter substrate-binding protein GlnH	NA	A0A1B1IT51	uncultured_Mediterranean_phage	25.4	1.9e-10
WP_165497232.1|4961594_4962323_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.5	9.9e-40
>prophage 399
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4966821	4971063	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001995482.1|4966821_4971063_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.9	6.2e-17
>prophage 400
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4988224	4995043	5342923		Halovirus(25.0%)	6	NA	NA
WP_000892978.1|4988224_4989118_+	MoxR family ATPase	NA	R4TG24	Halovirus	29.1	5.7e-13
WP_001995495.1|4989121_4991002_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001995489.1|4991041_4991464_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000723139.1|4991518_4992484_-	L-threonine 3-dehydrogenase	NA	D6PH86	uncultured_phage	27.3	3.6e-05
WP_000095906.1|4992528_4993719_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.1	3.4e-45
WP_001167959.1|4994221_4995043_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	5.8e-12
>prophage 401
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	4998634	4999984	5342923		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000338309.1|4998634_4999984_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.6	4.5e-62
>prophage 402
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5015935	5020523	5342923		Streptococcus_phage(66.67%)	3	NA	NA
WP_000222894.1|5015935_5017399_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.2	1.0e-112
WP_001995357.1|5017754_5020121_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.9	3.4e-121
WP_000918377.1|5020145_5020523_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	38.3	8.2e-14
>prophage 403
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5031927	5034128	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_000238949.1|5031927_5032599_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	3.2e-37
WP_000041006.1|5032664_5034128_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	35.7	6.8e-40
>prophage 404
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5039609	5045448	5342923		Dickeya_phage(33.33%)	4	NA	NA
WP_000512725.1|5039609_5040956_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	42.3	3.1e-15
WP_000598671.1|5041078_5041786_-	response regulator	NA	W8CYM9	Bacillus_phage	27.6	2.0e-08
WP_000746408.1|5041782_5043387_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_001169192.1|5043465_5045448_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.9	6.9e-11
>prophage 405
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5048721	5050247	5342923		Bacillus_phage(100.0%)	2	NA	NA
WP_001238615.1|5048721_5049393_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	7.0e-32
WP_000821989.1|5049542_5050247_-	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	37.9	2.5e-32
>prophage 406
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5056985	5058962	5342923		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000939015.1|5056985_5058962_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.9	3.8e-17
>prophage 407
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5064709	5066260	5342923		Vibrio_phage(100.0%)	1	NA	NA
WP_000591594.1|5064709_5066260_+	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	25.8	8.1e-23
>prophage 408
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5070791	5074308	5342923		Bacillus_phage(50.0%)	2	NA	NA
WP_000503512.1|5070791_5071967_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.6	5.0e-25
WP_000353280.1|5072412_5074308_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.2	9.0e-101
>prophage 409
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5079768	5081316	5342923	transposase	Campylobacter_virus(100.0%)	1	NA	NA
WP_000859070.1|5079768_5081316_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	27.2	1.6e-10
>prophage 410
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5104232	5105246	5342923		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001994869.1|5104232_5105246_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.6	2.6e-22
>prophage 411
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5112669	5114430	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_001161616.1|5112669_5114430_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	4.1e-55
>prophage 412
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5123217	5136720	5342923		Bacillus_virus(20.0%)	12	NA	NA
WP_000914736.1|5123217_5123775_+	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	32.4	6.4e-15
WP_000358485.1|5123885_5124005_+	YfhE family protein	NA	NA	NA	NA	NA
WP_001994859.1|5124368_5125535_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000238481.1|5125947_5126679_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_000195490.1|5126748_5128998_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.2	1.6e-184
WP_001994865.1|5129337_5130882_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000037029.1|5130874_5131840_-	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	34.0	8.8e-36
WP_001098128.1|5131836_5133081_-	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	24.2	1.5e-16
WP_000458438.1|5133070_5134651_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000899474.1|5134631_5134826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335516.1|5134842_5135244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371830.1|5135481_5136720_-	serine hydrolase	NA	R4JG75	Mycobacterium_phage	25.0	3.9e-12
>prophage 413
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5147991	5149371	5342923		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000615223.1|5147991_5149371_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.5	3.5e-86
>prophage 414
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5164550	5177429	5342923		Caulobacter_phage(50.0%)	12	NA	NA
WP_001083777.1|5164550_5166476_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.7	1.1e-122
WP_001226526.1|5166661_5167531_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001085393.1|5167537_5168053_-	DUF4075 domain-containing protein	NA	NA	NA	NA	NA
WP_000250910.1|5168106_5168571_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_000366197.1|5168744_5168969_+	DUF1128 domain-containing protein	NA	NA	NA	NA	NA
WP_000073715.1|5169157_5171824_+	cation-translocating P-type ATPase	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	29.0	2.4e-83
WP_001064413.1|5171859_5172942_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_000492869.1|5172960_5174592_-	YceG family protein	NA	NA	NA	NA	NA
WP_000025689.1|5174700_5175492_-	TerC family protein	NA	S5MAL1	Bacillus_phage	63.8	1.2e-78
WP_000236653.1|5175565_5176144_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.7	1.1e-28
WP_000146731.1|5176224_5176809_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.7	3.7e-29
WP_001121592.1|5176832_5177429_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	33.3	8.1e-24
>prophage 415
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5181923	5183237	5342923		Turkeypox_virus(100.0%)	1	NA	NA
WP_001994886.1|5181923_5183237_+	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	23.5	2.8e-08
>prophage 416
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5188921	5194085	5342923		Mimivirus(33.33%)	3	NA	NA
WP_000837159.1|5188921_5190946_+	cellulose binding domain-containing protein	NA	A0A1X9VNM7	Mimivirus	33.0	9.1e-59
WP_000025960.1|5191409_5192948_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.7	2.2e-49
WP_000016062.1|5193335_5194085_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.5e-30
>prophage 417
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5201974	5204164	5342923		Indivirus(100.0%)	1	NA	NA
WP_001140206.1|5201974_5204164_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	25.4	5.3e-28
>prophage 418
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5211912	5216030	5342923		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_000410215.1|5211912_5213205_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.3	2.2e-10
WP_001994878.1|5213412_5215137_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.5	2.4e-12
WP_000616918.1|5215307_5216030_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	3.1e-33
>prophage 419
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5222488	5223271	5342923		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001208286.1|5222488_5223271_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.0	9.3e-44
>prophage 420
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5231313	5232363	5342923		Bacillus_virus(100.0%)	1	NA	NA
WP_001078275.1|5231313_5232363_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.2	2.9e-16
>prophage 421
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5239896	5241423	5342923		Lactococcus_phage(100.0%)	1	NA	NA
WP_000599517.1|5239896_5241423_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	9.1e-19
>prophage 422
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5248324	5251786	5342923		Oenococcus_phage(50.0%)	4	NA	NA
WP_000704440.1|5248324_5249434_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.1	1.2e-17
WP_001994853.1|5249448_5250144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233741.1|5250465_5251173_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001251706.1|5251267_5251786_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.1	3.0e-22
>prophage 423
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5255284	5256661	5342923		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000105058.1|5255284_5256661_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	2.9e-117
>prophage 424
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5267981	5268887	5342923		Catovirus(100.0%)	1	NA	NA
WP_000977674.1|5267981_5268887_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	31.1	4.9e-28
>prophage 425
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5277340	5278360	5342923		Planktothrix_phage(100.0%)	1	NA	NA
WP_000622992.1|5277340_5278360_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-32
>prophage 426
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5283733	5288008	5342923		Ralstonia_phage(50.0%)	2	NA	NA
WP_001994846.1|5283733_5285743_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.1	1.5e-125
WP_014481546.1|5285758_5288008_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-136
>prophage 427
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5292088	5303655	5342923		Synechococcus_phage(37.5%)	11	NA	NA
WP_000745419.1|5292088_5293624_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.9	1.1e-77
WP_000088582.1|5293648_5294236_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	5.9e-27
WP_001994851.1|5294232_5295273_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	7.2e-68
WP_000879029.1|5295379_5296795_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_000055577.1|5296779_5298999_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000666792.1|5298982_5299666_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5299662_5299917_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170540.1|5299909_5300629_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|5300717_5302025_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_000196803.1|5302021_5303173_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000839367.1|5303169_5303655_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.6	2.3e-24
>prophage 428
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5309451	5310243	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000483025.1|5309451_5310243_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	59.3	3.2e-84
>prophage 429
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5316789	5319504	5342923		Bacillus_phage(33.33%)	3	NA	NA
WP_000651982.1|5316789_5317503_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	7.7e-37
WP_000686994.1|5317492_5318506_+	HAMP domain-containing histidine kinase	NA	A0A2K9L114	Tupanvirus	25.4	4.3e-09
WP_000074566.1|5318574_5319504_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	1.9e-40
>prophage 430
NZ_CP053965	Bacillus cereus strain FDAARGOS_802 chromosome, complete genome	5342923	5341169	5342675	5342923		Bacillus_phage(100.0%)	1	NA	NA
WP_000719197.1|5341169_5342675_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	29.6	3.2e-32
>prophage 1
NZ_CP053963	Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence	282009	181317	223859	282009	integrase	Clostridium_phage(20.0%)	41	202684:202701	224715:224732
WP_000824133.1|181317_183423_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	27.0	8.4e-07
WP_001265872.1|183434_184553_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	26.8	2.3e-11
WP_001995786.1|184776_185067_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_001995913.1|185087_185276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995772.1|185635_186772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995744.1|187016_188009_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001996049.1|188012_189407_+	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.2	2.0e-09
WP_001995958.1|189378_189957_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001995811.1|190183_190384_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	44.3	4.8e-05
WP_001996018.1|190532_191711_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001995865.1|191707_191857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995846.1|192103_192802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995906.1|192814_193354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995976.1|193372_193945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995857.1|194197_195829_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	34.6	2.5e-51
WP_001995947.1|195863_196121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996031.1|196179_196347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995793.1|196458_196833_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_144405581.1|197302_197614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995942.1|197641_197812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001994662.1|199106_200972_-	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	42.9	8.1e-86
WP_001994655.1|201050_201431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994650.1|201427_203530_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	28.1	8.4e-07
202684:202701	attL	TTCTTTTTAAGCTTTTTA	NA	NA	NA	NA
WP_001994656.1|203548_204664_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	26.4	3.2e-13
WP_001996020.1|204936_205791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995959.1|205990_206149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996001.1|206222_207392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996038.1|207441_207969_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001996044.1|208279_208768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995840.1|208914_209946_+	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	28.5	7.3e-12
WP_001996059.1|210037_210430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995834.1|210508_212464_+	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	25.9	4.0e-19
WP_001995889.1|212493_213153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995992.1|213170_214412_+	glutathionylspermidine synthase family protein	NA	A0A219Y9C1	Aeromonas_phage	27.5	5.8e-24
WP_001996055.1|214607_215315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001995760.1|215915_216683_-	polysaccharide deacetylase family protein	NA	A0A2K9L357	Tupanvirus	25.9	3.3e-09
WP_000383890.1|217130_217976_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	45.1	1.8e-24
WP_000778908.1|219156_219570_-	YjdF family protein	NA	NA	NA	NA	NA
WP_000526290.1|220106_220502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739305.1|220494_222621_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGC4	Ralstonia_phage	26.0	8.0e-05
WP_001265869.1|222704_223859_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	30.4	2.6e-10
224715:224732	attR	TAAAAAGCTTAAAAAGAA	NA	NA	NA	NA
>prophage 1
NZ_CP053964	Bacillus cereus strain FDAARGOS_802 plasmid unnamed4, complete sequence	42470	290	40397	42470	terminase,portal,tail,holin,head,capsid	Bacillus_phage(57.78%)	58	NA	NA
WP_001996383.1|290_3023_+|tail	phage tail tape measure protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	51.1	1.5e-85
WP_001996399.1|3028_3847_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	53.1	2.5e-71
WP_001996409.1|3855_5475_+|tail	phage tail protein	tail	A0A0K1LLF9	Bacillus_phage	35.5	1.4e-89
WP_001996384.1|5534_7229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996410.1|7250_7541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996431.1|7651_8896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996432.1|8967_9393_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	87.2	5.7e-64
WP_042516207.1|9392_10142_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	9.0e-121
WP_000539769.1|10182_10416_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_001996393.1|10502_11033_-	hypothetical protein	NA	A0A1B1P8A3	Bacillus_phage	96.6	1.1e-93
WP_001996381.1|11044_11425_-	hypothetical protein	NA	A0A1B1P8B2	Bacillus_phage	94.4	2.2e-59
WP_042516206.1|11553_11880_-	hypothetical protein	NA	D2XQ05	Bacillus_virus	93.5	1.6e-50
WP_001996415.1|11839_12871_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	98.8	5.8e-195
WP_001996403.1|13183_14242_-	hypothetical protein	NA	A0A1B1P784	Bacillus_phage	50.3	2.5e-28
WP_001996411.1|14565_15096_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001996421.1|15097_15571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996414.1|15762_16107_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	99.1	1.2e-56
WP_001996391.1|16573_17701_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.3	4.6e-84
WP_001996407.1|17735_17888_+	hypothetical protein	NA	B5LPU5	Bacillus_virus	86.0	1.3e-15
WP_001996397.1|18033_18183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996400.1|18188_18539_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P8C2	Bacillus_phage	65.5	9.3e-36
WP_001996424.1|18750_18951_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7V5	Bacillus_phage	97.0	3.1e-28
WP_144405577.1|19045_19747_+	antA/AntB antirepressor family protein	NA	A8ASM6	Listeria_phage	52.5	2.8e-31
WP_001996406.1|19743_19923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996433.1|20035_20176_+	hypothetical protein	NA	A0A1B1P8A8	Bacillus_phage	95.7	3.5e-18
WP_001996418.1|20390_20591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996405.1|20592_20769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996413.1|20786_21401_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	48.1	4.2e-31
WP_001996417.1|21420_21654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080335328.1|21687_22410_+	hypothetical protein	NA	A0A1B1P7G4	Bacillus_phage	50.4	4.2e-59
WP_001996394.1|22420_23728_+	replicative DNA helicase	NA	A6M986	Geobacillus_virus	39.1	2.2e-82
WP_001996387.1|23732_23945_+	hypothetical protein	NA	A6M987	Geobacillus_virus	50.0	1.7e-08
WP_001996375.1|23957_24353_+	hypothetical protein	NA	E5DV95	Deep-sea_thermophilic_phage	51.6	1.9e-29
WP_080014233.1|24408_24654_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	83.3	2.0e-29
WP_000811957.1|24650_24914_+	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_001996422.1|24925_25639_+	hypothetical protein	NA	B5LPM7	Bacillus_virus	50.8	6.9e-38
WP_000434343.1|25647_25773_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	75.6	2.4e-10
WP_000712298.1|25840_26008_+	hypothetical protein	NA	A0A0U3SD36	Bacillus_phage	96.4	4.9e-19
WP_001053654.1|26021_26468_+	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	90.5	2.5e-70
WP_001996427.1|26675_26885_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	100.0	6.1e-35
WP_001996388.1|26925_27528_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	7.1e-44
WP_001996379.1|27844_28309_+	hypothetical protein	NA	A0A1S6KV15	Providencia_phage	28.8	1.6e-06
WP_001996401.1|28344_28590_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	7.2e-19
WP_001996395.1|28835_28994_+	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	58.8	8.7e-10
WP_001996385.1|29078_29702_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001114347.1|30262_30442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529719.1|30444_31074_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.5	4.5e-49
WP_000441079.1|31211_31583_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	48.8	1.8e-21
WP_001996382.1|32540_32732_+	hypothetical protein	NA	B5LPQ3	Bacillus_virus	87.7	9.8e-24
WP_042516204.1|32899_33154_+	hypothetical protein	NA	B5LPQ5	Bacillus_virus	84.4	5.5e-14
WP_001996374.1|33691_34468_+	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	55.3	8.3e-61
WP_142329062.1|34436_35720_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	86.9	1.7e-223
WP_001996425.1|35731_37225_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	32.9	1.4e-48
WP_001996386.1|37343_38159_+|capsid	minor capsid protein	capsid	A0A141E1Y0	Streptococcus_phage	39.2	2.2e-32
WP_001996398.1|38264_38903_+	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	30.1	2.1e-09
WP_001996373.1|38917_39856_+	DUF5309 family protein	NA	W0XA97	Pseudomonas_phage	28.6	4.3e-19
WP_000729227.1|39873_40053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996429.1|40055_40397_+|head,tail	phage head-tail connector protein	head,tail	A0A097PAS2	Streptococcus_pyogenes_phage	37.6	8.5e-10
>prophage 1
NZ_CP053966	Bacillus cereus strain FDAARGOS_802 plasmid unnamed5, complete sequence	61863	5375	51860	61863	tail,plate,portal,capsid,integrase,holin	Bacillus_phage(57.45%)	61	32883:32897	58230:58244
WP_000451516.1|5375_5939_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
WP_000831284.1|6073_6418_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000448836.1|6437_7142_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000859164.1|7346_7694_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_001189353.1|8190_9339_+	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000721629.1|9378_9528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578778.1|9852_10203_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_080011779.1|10334_10556_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_001006520.1|10595_11366_+	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_000655888.1|11823_11973_+	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	72.1	1.8e-09
WP_000780697.1|11985_12468_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_001043060.1|12464_13139_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000487938.1|13338_13560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073890.1|13560_14376_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_041184387.1|14326_15208_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000332351.1|15220_15484_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_011731652.1|15398_15686_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	80.0	6.4e-35
WP_000811957.1|15682_15946_+	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_001996422.1|15957_16671_+	hypothetical protein	NA	B5LPM7	Bacillus_virus	50.8	6.9e-38
WP_000434343.1|16679_16805_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	75.6	2.4e-10
WP_000712298.1|16872_17040_+	hypothetical protein	NA	A0A0U3SD36	Bacillus_phage	96.4	4.9e-19
WP_001053654.1|17053_17500_+	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	90.5	2.5e-70
WP_001996427.1|17707_17917_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	100.0	6.1e-35
WP_001996388.1|17957_18560_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	7.1e-44
WP_001996379.1|18876_19341_+	hypothetical protein	NA	A0A1S6KV15	Providencia_phage	28.8	1.6e-06
WP_001996401.1|19376_19622_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	7.2e-19
WP_001996395.1|19867_20026_+	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	58.8	8.7e-10
WP_001996385.1|20110_20734_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001114347.1|21294_21474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529719.1|21476_22106_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.5	4.5e-49
WP_000441079.1|22243_22615_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	48.8	1.8e-21
WP_042516211.1|23540_23876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995620.1|23981_24257_+	hypothetical protein	NA	A0A142F1A2	Bacillus_phage	50.6	4.0e-18
WP_001995611.1|24759_25344_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	48.6	7.7e-27
WP_001995624.1|25356_26034_+	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	37.9	2.0e-42
WP_000810415.1|26636_27431_+	hypothetical protein	NA	D2XPX8	Bacillus_virus	72.7	4.8e-72
WP_144405579.1|28100_28610_+	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	49.7	3.3e-42
WP_001995603.1|29702_31241_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	39.0	1.7e-94
WP_001995617.1|31227_32154_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.6	2.4e-46
WP_000746380.1|32200_33211_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	35.5	5.9e-51
32883:32897	attL	GCGTCATACCGTCAT	NA	NA	NA	NA
WP_001995604.1|33232_34162_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	72.0	1.5e-120
WP_001110331.1|34168_34336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995619.1|34341_34731_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_000058074.1|34730_35123_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_000168162.1|35107_35599_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.9	1.1e-39
WP_000273213.1|35601_36003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852141.1|36017_36482_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_001210040.1|36547_36964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995616.1|37041_37302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995622.1|37318_40045_+|tail	tail length tape measure protein	tail	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_001995610.1|40044_40926_+|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.2	4.8e-73
WP_001995608.1|40937_43238_+|tail	phage tail protein	tail	A0A2P1JTV8	Anoxybacillus_phage	56.4	1.2e-128
WP_001995614.1|43252_44578_+|plate	BppU family phage baseplate upper protein	plate	B5LPS6	Bacillus_virus	50.2	1.1e-105
WP_001995605.1|44591_45263_+	hypothetical protein	NA	A0A1B1P805	Bacillus_phage	62.7	3.9e-51
WP_001995618.1|45304_45730_+|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	97.9	6.3e-71
WP_001995628.1|45729_46479_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	83.4	2.4e-121
WP_001173690.1|46675_47029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995612.1|47041_47950_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001995606.1|48119_48401_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_001265872.1|48624_49743_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	26.8	2.3e-11
WP_000824133.1|49754_51860_+|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	27.0	8.4e-07
58230:58244	attR	ATGACGGTATGACGC	NA	NA	NA	NA
