The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	564770	573281	3191656		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|564770_565253_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_024521791.1|565236_566367_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_021356104.1|566369_567101_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_003642588.1|567102_567357_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|567356_568037_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|568029_570249_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_027821844.1|570233_571688_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.3e-50
WP_027821845.1|571684_572710_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	9.3e-60
WP_003645867.1|572702_573281_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 2
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	767211	818460	3191656	capsid,integrase,head,terminase,tail,portal	Lactobacillus_phage(36.36%)	67	756471:756485	826540:826560
756471:756485	attL	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821884.1|767211_768369_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	5.0e-54
756471:756485	attL	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_050482352.1|768419_769070_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	46.5	3.6e-09
WP_027821885.1|769247_769430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021357488.1|769700_769931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821886.1|769944_770745_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_027821888.1|772284_772764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821889.1|772779_772971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821890.1|772957_773296_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	1.3e-07
WP_027821891.1|773288_773678_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	3.0e-19
773335:773349	attR	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821892.1|774688_775162_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
773335:773349	attR	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821893.1|775158_776862_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.1	2.2e-122
WP_027821894.1|777016_778117_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	1.4e-48
WP_027821895.1|778113_779658_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.6	8.2e-44
WP_027821896.1|779746_780016_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027821897.1|780175_780544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821898.1|780622_781096_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_027821899.1|781101_781683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642774.1|782096_782303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821349.1|782653_783775_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	33.0	2.0e-47
WP_027821900.1|784040_785660_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	47.9	3.1e-94
WP_016511204.1|785817_785994_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	3.9e-11
WP_162551031.1|786604_787231_-	Ltp family lipoprotein	NA	A0A173G9H4	Propionibacterium_phage	60.0	7.3e-07
WP_027821901.1|787512_787935_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	7.8e-13
WP_027821902.1|787949_788468_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	1.6e-15
WP_033608054.1|788609_788864_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_050482353.1|789020_789302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821903.1|789360_789543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608056.1|789539_789938_-	DUF2513 domain-containing protein	NA	A0A1P8L6H1	Staphylococcus_phage	38.4	5.1e-14
WP_003642789.1|789937_790168_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_027821904.1|790309_790516_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027821905.1|790515_790812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608057.1|790836_791007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101775.1|791018_791324_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_027821906.1|791391_791904_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.8e-27
WP_027821907.1|792153_792441_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.3e-22
WP_027821908.1|792769_793156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821909.1|793152_794052_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	1.0e-62
WP_016511194.1|794083_794836_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	1.1e-70
WP_016511193.1|794916_795705_+	replication protein DnaD	NA	NA	NA	NA	NA
WP_016511192.1|795685_796528_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	96.1	2.9e-152
WP_027821910.1|796684_797407_+	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	4.2e-51
WP_027821911.1|797411_797930_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	2.9e-54
WP_027821912.1|797926_798307_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_027821913.1|798518_798980_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	3.1e-39
WP_033608060.1|799389_800409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821914.1|800426_800930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821915.1|801008_801188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821916.1|801156_801429_+	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	50.6	4.0e-18
WP_027821917.1|801652_801973_+	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	45.6	1.8e-17
WP_033608061.1|802030_802546_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	88.8	2.8e-65
WP_033608063.1|802538_803852_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.3	8.6e-127
WP_050482354.1|803866_805603_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	34.4	7.0e-76
WP_027821919.1|805602_806514_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_027821920.1|806624_807284_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_027821921.1|807297_807669_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	33.6	1.5e-07
WP_050482355.1|807684_808794_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	40.1	1.8e-61
WP_027821922.1|808811_809180_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_033608065.1|809176_809509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821923.1|809509_810001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821924.1|810003_810399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821925.1|810447_811101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821926.1|811129_811648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821927.1|811722_811980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079111870.1|812204_815993_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	57.2	3.3e-38
WP_027821928.1|816017_816296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821929.1|816368_817280_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	30.3	1.6e-18
WP_027821930.1|817272_818460_+|tail	phage tail protein	tail	NA	NA	NA	NA
826540:826560	attR	CCGTGCGGGTGATAAGTTGAC	NA	NA	NA	NA
>prophage 3
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	1121592	1206817	3191656	capsid,integrase,protease,head,terminase,tail,portal,tRNA	Lactobacillus_phage(78.26%)	88	1114642:1114659	1181218:1181235
1114642:1114659	attL	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_053338955.1|1121592_1122756_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
WP_064972032.1|1122972_1123611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079111812.1|1124795_1125671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057138663.1|1125800_1126475_-	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	44.6	8.0e-52
WP_057138664.1|1126643_1126892_+	transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	61.4	4.0e-17
WP_063722542.1|1126907_1127615_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	59.9	5.1e-65
WP_079111810.1|1127626_1127836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|1127951_1128278_-	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_079111809.1|1128335_1128596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063722546.1|1128738_1128993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641371.1|1128995_1129196_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_162920430.1|1129479_1129650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098960.1|1129649_1129907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137016.1|1130009_1130753_+	replisome organizer	NA	E9LUM6	Lactobacillus_phage	57.3	2.7e-40
WP_072534795.1|1130752_1131538_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.2	4.1e-132
WP_079111808.1|1131673_1131976_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.0	1.0e-46
WP_079111807.1|1131978_1132290_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	87.4	1.1e-45
WP_024971545.1|1132293_1132488_+	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	71.4	4.5e-16
WP_022638754.1|1132480_1132639_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_079111806.1|1132643_1133714_+	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	61.3	5.6e-124
WP_079111805.1|1134155_1134581_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.2	7.2e-67
WP_063485444.1|1135632_1136556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063485443.1|1136638_1136818_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	66.1	3.6e-12
WP_172598422.1|1136828_1137299_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.7	2.2e-80
WP_063487070.1|1137518_1137980_+|terminase	phage terminase small subunit P27 family	terminase	A0A286QRF4	Streptococcus_phage	57.5	3.2e-44
WP_063487149.1|1137966_1139874_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	49.8	2.6e-180
WP_063487071.1|1139863_1140058_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	89.1	3.8e-23
WP_063487072.1|1140060_1141257_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	90.2	2.2e-206
WP_063487073.1|1141234_1141993_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.0	5.5e-126
WP_072534789.1|1141992_1143225_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.9	5.0e-209
WP_016058329.1|1143297_1143636_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_016058330.1|1143619_1143982_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	100.0	5.2e-66
WP_063722567.1|1143971_1144412_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	99.3	5.0e-79
WP_063722568.1|1144408_1144792_+	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	98.4	9.4e-66
WP_063722569.1|1144792_1145431_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	99.5	1.1e-116
WP_063722570.1|1145632_1146016_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	97.6	7.4e-63
WP_016058335.1|1146012_1146204_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_079111804.1|1146216_1151385_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	98.0	0.0e+00
WP_079111803.1|1151456_1153229_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	97.3	0.0e+00
WP_079111802.1|1153292_1155662_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	96.1	0.0e+00
WP_079111801.1|1155678_1158444_+	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	50.4	1.8e-195
WP_016058340.1|1158436_1158691_+	hypothetical protein	NA	E9LUR5	Lactobacillus_phage	100.0	1.4e-30
WP_016058341.1|1158694_1158856_+	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	100.0	1.2e-19
WP_063487082.1|1158839_1159724_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	99.7	1.7e-139
WP_016058343.1|1159739_1160912_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	100.0	3.1e-216
WP_003644510.1|1160911_1161175_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_016058344.1|1161187_1161718_+	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
WP_003644508.1|1162958_1164170_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_079111800.1|1164648_1166391_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645638.1|1166409_1167201_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|1167181_1168366_+	LCP family protein	NA	NA	NA	NA	NA
WP_003645636.1|1168517_1169090_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003640752.1|1169841_1170783_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003644503.1|1171228_1171621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640750.1|1171784_1172177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355614.1|1172212_1173382_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645631.1|1173431_1174061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079111799.1|1174455_1174596_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|1174685_1175318_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|1175469_1175709_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|1175806_1176043_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|1176099_1176735_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003644499.1|1176846_1177605_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003640742.1|1177588_1177894_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|1177978_1178977_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640740.1|1179265_1179988_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|1180212_1181016_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003644498.1|1181118_1181997_+	elongation factor Ts	NA	NA	NA	NA	NA
1181218:1181235	attR	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_079111798.1|1182197_1182920_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|1182921_1183485_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640735.1|1183604_1184384_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640734.1|1184399_1185185_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640733.1|1185222_1186500_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640732.1|1186539_1188249_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640729.1|1188742_1193056_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|1193351_1193828_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_079111797.1|1193848_1195066_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|1195110_1195410_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|1195399_1195705_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003645962.1|1195719_1198296_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640723.1|1198318_1198672_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003645963.1|1199320_1200775_+	MFS transporter	NA	NA	NA	NA	NA
WP_013355607.1|1200767_1201937_+	chorismate synthase	NA	NA	NA	NA	NA
WP_027821258.1|1201945_1202473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825651.1|1202486_1203785_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015825650.1|1203787_1204885_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_027821257.1|1204887_1205409_+	shikimate kinase	NA	NA	NA	NA	NA
WP_027821256.1|1205893_1206817_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	1699358	1712136	3191656		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355474.1|1699358_1700303_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
WP_079111784.1|1700327_1700993_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|1701702_1702395_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_022638019.1|1702387_1703755_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_013355470.1|1704145_1704586_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_013355469.1|1704656_1705217_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_022638021.1|1705304_1707743_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|1707745_1708360_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|1708702_1709650_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_013355468.1|1709835_1710807_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_013355467.1|1710897_1712136_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 5
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	2357946	2366570	3191656		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|2357946_2358942_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|2359080_2359866_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|2359869_2360766_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|2360864_2361212_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|2361236_2362256_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|2362272_2362602_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003643941.1|2362598_2363264_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|2363661_2363913_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2363927_2364527_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2364542_2364851_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|2364872_2366570_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 6
NZ_CP053912	Lactobacillus plantarum subsp. plantarum strain G1 chromosome, complete genome	3191656	2499829	2553607	3191656	bacteriocin,tRNA,protease	uncultured_Mediterranean_phage(22.22%)	50	NA	NA
WP_003646511.1|2499829_2501101_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|2501567_2503181_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|2503353_2503962_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|2504006_2504447_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_027821488.1|2504809_2505742_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|2505750_2507109_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|2507128_2507938_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_015825144.1|2508107_2509094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|2509176_2510199_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|2510487_2511468_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_011101017.1|2511833_2512658_-	serine hydrolase	NA	NA	NA	NA	NA
WP_027821489.1|2512893_2514276_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	7.4e-28
WP_003642030.1|2514344_2515181_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003646500.1|2515536_2516334_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|2516326_2517025_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|2517293_2518238_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|2518547_2519414_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|2519546_2519798_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|2519902_2520793_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|2520789_2521353_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|2521339_2522116_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_079111768.1|2522238_2523171_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|2523403_2525455_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_024971611.1|2525776_2526166_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027821490.1|2526760_2527603_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_027821491.1|2527602_2528307_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_027821492.1|2528328_2529288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|2529280_2530555_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|2530600_2531518_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_027821493.1|2531959_2532973_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|2533085_2533832_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|2533981_2534878_-	ROK family protein	NA	NA	NA	NA	NA
WP_027821494.1|2534958_2536395_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	1.3e-30
WP_003643816.1|2536412_2537768_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|2537990_2538413_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|2538402_2538591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|2538597_2539959_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|2540031_2540742_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825134.1|2541147_2542164_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027821495.1|2542602_2543379_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003646480.1|2543637_2545947_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027821496.1|2546041_2546245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821497.1|2546382_2547069_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821498.1|2547162_2547843_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821499.1|2547929_2548598_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821500.1|2548665_2549355_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821501.1|2549444_2550821_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027821502.1|2550837_2552988_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_003641985.1|2553253_2553424_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|2553448_2553607_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
