The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP023184	Buttiauxella agrestis strain DSM 9389	4566254	2621031	2634750	4566254	tRNA	Tupanvirus(33.33%)	15	NA	NA
WP_172894650.1|2621031_2622477_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	1.1e-53
WP_172894652.1|2622546_2623272_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_172894655.1|2623565_2624540_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	34.0	9.8e-35
WP_034494811.1|2624668_2625130_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	35.8	1.1e-12
WP_172896137.1|2625209_2625959_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	25.9	1.3e-07
WP_172894657.1|2625955_2626504_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_115629225.1|2626533_2627514_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2627632_2627932_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_172894659.1|2627936_2630324_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	3.1e-05
WP_034494802.1|2630338_2631322_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.2	2.4e-33
WP_001386830.1|2631451_2631496_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2631578_2631935_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005968897.1|2631980_2632178_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_074388328.1|2632274_2632817_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	3.7e-15
WP_172894661.1|2632821_2634750_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	5.7e-127
>prophage 2
NZ_AP023184	Buttiauxella agrestis strain DSM 9389	4566254	3855420	3861250	4566254	integrase	Cronobacter_phage(42.86%)	11	3851474:3851521	3863995:3864042
3851474:3851521	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
WP_172896179.1|3855420_3856218_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	58.9	9.0e-87
WP_172895589.1|3856214_3856517_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	43.0	5.2e-11
WP_172896180.1|3856507_3856735_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_172895590.1|3856804_3857206_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	58.6	7.6e-42
WP_172895591.1|3857209_3857626_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	68.5	3.8e-44
WP_172895592.1|3857615_3857819_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_172895593.1|3857828_3858332_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	62.3	1.7e-51
WP_172895594.1|3858362_3858584_-	regulator	NA	NA	NA	NA	NA
WP_172895595.1|3858615_3859287_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	39.2	2.0e-31
WP_172895596.1|3859308_3860253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172895597.1|3860230_3861250_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.7	1.7e-122
3863995:3864042	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
>prophage 3
NZ_AP023184	Buttiauxella agrestis strain DSM 9389	4566254	3974401	4025658	4566254	protease	uncultured_Caudovirales_phage(28.57%)	47	NA	NA
WP_172895670.1|3974401_3975754_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_034492900.1|3975853_3976405_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_172895671.1|3976470_3977841_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_034492895.1|3978016_3979015_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.0	1.6e-69
WP_172895672.1|3979119_3980673_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	3.9e-09
WP_034492890.1|3980752_3981754_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_156104842.1|3981740_3982772_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_034492884.1|3982782_3984285_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.6	2.2e-09
WP_034461239.1|3984407_3985364_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_034492882.1|3985657_3986185_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_115631258.1|3986287_3986632_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_172895673.1|3986634_3990411_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_172895674.1|3990407_3992141_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_115631261.1|3992367_3993006_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_172895675.1|3993221_3995189_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_172895676.1|3995185_3996169_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_172895677.1|3996161_3997214_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_172895678.1|3997210_3999109_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	28.5	1.0e-35
WP_034492865.1|3999365_4000703_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_034461209.1|4000765_4000972_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_172895679.1|4001312_4001870_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_034492859.1|4001859_4002600_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_172895680.1|4002787_4004719_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_172895681.1|4004814_4005204_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172895682.1|4005295_4006144_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172895683.1|4006207_4007032_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172895684.1|4007118_4008093_+	DMT family transporter	NA	NA	NA	NA	NA
WP_172895685.1|4008177_4008840_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_115631287.1|4008895_4010308_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_064515716.1|4010603_4011224_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_034492831.1|4011461_4012067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034461193.1|4012149_4012602_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002210155.1|4012641_4012869_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_034492830.1|4012873_4013191_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_034492828.1|4013197_4013593_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_172895686.1|4013953_4014229_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_172895687.1|4014334_4015060_-	esterase	NA	NA	NA	NA	NA
WP_172895688.1|4015254_4015584_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_034461185.1|4015734_4016010_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_172895689.1|4016060_4017695_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_034492799.1|4017797_4018529_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_172895690.1|4018629_4021098_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.8	1.7e-67
WP_034492795.1|4021137_4021563_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_034492792.1|4021723_4023022_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
WP_034492791.1|4023124_4023322_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_172895691.1|4023388_4024393_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_034492789.1|4024395_4025658_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
