The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	975147	983879	4879234	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|975147_976266_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976262_978209_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978338_978560_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|978883_979204_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979234_981511_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981702_982161_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|982623_983879_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	1019396	1132434	4879234	protease,tail,transposase,tRNA,terminase,lysis,portal,holin	Salmonella_phage(41.67%)	113	NA	NA
WP_001339197.1|1019396_1020605_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000125006.1|1021444_1022128_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140324.1|1022241_1023915_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167332.1|1024070_1024355_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000705784.1|1024584_1026849_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|1026885_1028634_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_000561681.1|1028630_1029608_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056911.1|1029651_1030884_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350061.1|1030935_1031118_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011576.1|1031114_1031861_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436889.1|1032071_1032965_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899563.1|1032944_1033721_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001154025.1|1033856_1034660_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034652_1035975_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1035955_1036660_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036659_1041126_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1041470_1043312_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043571_1044120_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044147_1044795_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1044856_1046047_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1046231_1047323_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1047929_1049330_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049530_1049992_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1050308_1051523_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1051767_1053204_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053281_1054484_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054678_1055971_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056015_1056264_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056304_1056544_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1056586_1057744_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1057706_1060592_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1060718_1061018_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061039_1061198_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061190_1061451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061500_1061911_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062030_1062270_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062235_1062610_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1062694_1063678_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1063680_1064430_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1064440_1064788_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1064784_1065096_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065173_1065464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065755_1065989_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066100_1066322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066404_1067007_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1067215_1067827_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067823_1067970_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1067959_1068757_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068823_1069141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069314_1069440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069575_1070025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1070385_1071072_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1071347_1071677_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1071660_1072113_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1072130_1072610_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1072817_1073351_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073307_1075446_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075442_1075649_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009208.1|1075645_1077193_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1077116_1079198_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1079288_1079612_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079604_1079904_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1079884_1080451_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080447_1080849_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132758.1|1080860_1081610_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	1.8e-89
WP_000478859.1|1081655_1082054_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082050_1082380_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082459_1085447_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085443_1085776_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1085874_1086372_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086488_1087022_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087111_1087807_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087816_1088554_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088451_1089156_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|1091702_1092578_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1092616_1092859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144682.1|1092912_1095120_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	E5G6P0	Salmonella_phage	51.5	6.2e-77
WP_000143167.1|1095119_1095701_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1096176_1097145_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1097792_1098419_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098487_1098787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1098771_1099458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1099728_1099920_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100346_1102959_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103166_1104177_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104342_1104885_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1104881_1105991_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106089_1108198_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108210_1110118_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333148.1|1110132_1111386_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1111390_1113031_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113027_1113591_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1113846_1114014_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114113_1114632_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1114700_1116461_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1116646_1117099_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117170_1118223_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118579_1119089_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119305_1119911_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1119897_1122051_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122069_1122516_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1122639_1124694_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1124729_1125188_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125282_1125945_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1126118_1126532_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126576_1126894_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1126951_1128163_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128377_1128926_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1128951_1129731_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1129779_1130061_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130057_1130387_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130473_1131133_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1131753_1132434_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	1920927	1927736	4879234	integrase,tail	Salmonella_phage(33.33%)	11	1915790:1915812	1925505:1925527
1915790:1915812	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1920927_1921809_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1922281_1922470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922534_1922702_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1922958_1923492_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923545_1923776_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1923965_1924460_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1924519_1925374_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1925747_1926101_-	YebY family protein	NA	NA	NA	NA	NA
1925505:1925527	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1926117_1926993_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1926993_1927368_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1927505_1927736_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2003186	2082530	4879234	plate,protease,tail,transposase,portal,terminase,capsid,integrase,lysis,head,holin	Salmonella_phage(86.36%)	102	2009724:2009739	2084153:2084168
WP_000502119.1|2003186_2003645_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2003825_2005031_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2005109_2006597_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2006853_2008257_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2008271_2008679_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2008678_2009047_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2009118_2010603_+	alpha-amylase	NA	NA	NA	NA	NA
2009724:2009739	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2010642_2011068_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2011253_2012459_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2012455_2012689_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2012953_2013340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2013459_2013774_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2013990_2015673_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2015665_2016661_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2016653_2017361_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2017360_2018731_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2018752_2019196_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2019192_2020410_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2020514_2020982_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2020986_2021991_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2021987_2022401_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2022400_2022778_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2022777_2023515_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2023524_2023794_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2023802_2024597_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103975.1|2024878_2025502_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|2025540_2025735_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2025863_2026091_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2026400_2027216_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2027194_2028907_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|2029071_2029257_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|2029333_2030251_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2030420_2031341_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2031329_2031800_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2031780_2033211_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2033284_2033980_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2034071_2034371_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2035020_2036217_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2036477_2036666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036676_2036889_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2037343_2038612_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038614_2039034_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2039160_2039322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2039952_2040174_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2040386_2041394_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2041678_2042278_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554736.1|2042247_2043810_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_001207832.1|2043796_2044384_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2044386_2044908_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2044942_2045488_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2045459_2045873_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045877_2046411_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2046410_2047469_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2047465_2048806_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048839_2050768_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050852_2051179_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2051175_2051532_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051531_2053028_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2053017_2053182_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2053185_2053746_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053742_2054255_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2054226_2054631_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054627_2054951_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2054953_2055154_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2055204_2056410_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2056424_2057075_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2057052_2058294_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2058293_2058476_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2058487_2060221_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2060217_2060712_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060837_2061188_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2061248_2061551_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061770_2062190_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2062402_2062888_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2062884_2063499_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2063501_2063846_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2064007_2064442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2064371_2064629_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064761_2065385_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2065395_2066385_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2066392_2067253_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2067269_2067659_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067655_2068549_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068548_2069031_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2069032_2069851_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2069847_2070072_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2070068_2071226_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2071222_2071777_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071805_2072030_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2072127_2072823_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073637_2074009_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2074066_2074894_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2075030_2075570_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075640_2075871_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075867_2076383_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2076379_2076997_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2076993_2077827_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077830_2078400_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2078439_2078667_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2078668_2079658_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2079949_2080747_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2082056_2082530_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2084153:2084168	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2168524	2179030	4879234		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168524_2169838_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169864_2170944_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2170948_2171722_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171718_2172711_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172716_2173268_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2173268_2174147_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2174194_2175094_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2175093_2176179_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176555_2177449_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177626_2179030_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2247338	2256509	4879234	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2247338_2249372_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249612_2250071_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2250242_2250773_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250829_2251297_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2251343_2252063_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2252059_2253745_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2253967_2254699_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254758_2254866_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254846_2255578_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255561_2256509_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2275916	2342311	4879234	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2275916_2276612_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276765_2277650_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277826_2278546_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278542_2278788_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2278992_2280234_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2280227_2281463_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281537_2282548_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2282563_2284084_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2284217_2285216_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285714_2286737_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2286886_2288029_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2288043_2288712_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2289041_2289899_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289887_2290277_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2290281_2291649_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291865_2292753_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292785_2294108_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2294151_2296143_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535005.1|2296487_2297957_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2298146_2299010_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2299130_2300180_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2300258_2301116_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2301180_2302869_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302885_2303824_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303823_2304954_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2305322_2306504_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306568_2307234_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2307235_2307358_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307745_2308000_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2308323_2308896_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2309108_2310095_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2310124_2310844_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2311257_2311830_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2312155_2313712_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313818_2315624_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315633_2316728_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316727_2317753_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317754_2319344_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2319347_2319692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2320082_2321273_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2321300_2321996_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2322147_2323908_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2324032_2324317_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2324425_2325046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2325073_2326081_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2326260_2326488_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2326519_2328280_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328560_2329064_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2329091_2329382_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329729_2331559_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331612_2332056_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2332433_2332961_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2332963_2334205_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334797_2335127_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2335423_2336755_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336783_2337152_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2337166_2338156_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2338484_2340851_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2341019_2341223_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2341519_2342311_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2682523	2790085	4879234	protease,tail,transposase,portal,tRNA,terminase,capsid,integrase,lysis,head,holin	Salmonella_phage(30.3%)	112	2707068:2707084	2797989:2798005
WP_000940032.1|2682523_2683255_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2683373_2684177_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2684321_2685200_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2685381_2686425_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2686428_2687247_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2687257_2688271_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2688271_2689258_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2689248_2689887_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2690012_2691290_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2691284_2692424_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2692619_2693873_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2694197_2695388_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2695569_2697114_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2697474_2698806_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2698888_2701033_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2701088_2702549_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2702597_2702936_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2703012_2704350_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2704346_2705111_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2705112_2706543_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2707068:2707084	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2707192_2711080_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2711101_2711335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2711335_2712880_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2712930_2713482_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2713506_2714142_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2714145_2715507_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2715517_2716411_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2716526_2717375_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2717413_2718331_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2718352_2719549_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2719664_2720591_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2720628_2720889_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2721000_2721381_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2721380_2722112_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2722123_2722852_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2722863_2723769_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2723765_2724446_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2724719_2725694_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2725710_2727510_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2727914_2729408_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2729880_2730018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2730730_2730895_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2731602_2731815_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2731921_2732149_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2732245_2732824_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2732813_2733638_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_014344380.1|2733634_2736007_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.1e-90
WP_000178853.1|2736060_2736303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2736341_2739704_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2739765_2740413_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2740310_2741048_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2741054_2741753_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2741762_2742092_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2742094_2745190_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2745161_2745500_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2745496_2745892_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2745942_2746689_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2746696_2747098_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2747206_2748337_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2748385_2748964_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2748991_2749375_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2749385_2749745_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2749802_2750831_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2750885_2751233_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2751245_2752742_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2752731_2754312_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2754308_2754512_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2754495_2756427_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2756398_2756944_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2757230_2757632_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2757867_2758320_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2758337_2758790_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2758773_2759103_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2759378_2760065_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2760279_2760468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2760974_2761538_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2761810_2762488_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2762484_2762625_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096546.1|2762621_2763233_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_000929790.1|2763441_2764044_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2764078_2764327_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2764443_2764677_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000002116.1|2765238_2765520_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_000208067.1|2765512_2766166_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000852188.1|2766168_2766639_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000065092.1|2766640_2767306_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000788827.1|2767320_2768013_-	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000024048.1|2768009_2768915_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_072143007.1|2769006_2769381_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000145711.1|2769346_2769574_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000169863.1|2769587_2770055_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000368620.1|2770206_2771292_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000373340.1|2771399_2771606_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000551857.1|2772005_2772176_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_000394219.1|2772316_2775517_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	74.1	0.0e+00
WP_014344386.1|2775479_2776637_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2776679_2776919_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2776959_2777244_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2777221_2778451_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2778948_2779428_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2779424_2780381_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2780380_2781031_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2781062_2781638_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2781634_2781799_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2782062_2783685_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2783669_2784407_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2784537_2785872_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2785889_2786789_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2786891_2787479_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2787540_2787924_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2788242_2788932_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2789047_2790085_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2797989:2798005	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2813109	2892491	4879234	plate,tail,portal,tRNA,terminase,capsid,integrase,lysis,head	Salmonella_phage(69.49%)	83	2880154:2880175	2895478:2895499
WP_001168062.1|2813109_2814180_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2814619_2815138_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2815130_2816351_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000218691.1|2816603_2817653_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
WP_000823622.1|2817677_2818016_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
WP_001096998.1|2818024_2818870_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
WP_001278192.1|2818983_2819337_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_000883911.1|2819387_2819897_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	3.6e-89
WP_000920166.1|2819904_2820105_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	9.6e-30
WP_000963466.1|2820068_2820407_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	2.3e-52
WP_001246236.1|2820474_2820702_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752587.1|2820701_2820926_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	1.1e-34
WP_157868817.1|2820947_2821541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978866.1|2824309_2824795_+|tail	phage tail protein	tail	O80317	Escherichia_phage	91.9	1.1e-79
WP_000988226.1|2824791_2825958_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.8	3.2e-205
WP_000416621.1|2826152_2826842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972009.1|2826918_2827137_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	97.2	6.1e-38
WP_000065257.1|2827282_2827630_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2827670_2828438_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2828482_2829031_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2829049_2829298_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2829611_2830973_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2831138_2831930_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2831949_2833236_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2833356_2833962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2833996_2834587_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2834709_2835588_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2835673_2837335_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2837483_2837822_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2837987_2838278_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2838267_2838744_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2838893_2839376_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2839989_2851464_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533859.1|2851528_2852938_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2852934_2855115_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2855122_2856286_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2856837_2857056_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010544.1|2857124_2858225_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.8	1.3e-192
WP_000980418.1|2858221_2858707_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282764.1|2858703_2861511_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.5	0.0e+00
WP_000763316.1|2861503_2861623_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280960.1|2861637_2861940_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	5.5e-45
WP_001207652.1|2861994_2862510_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046099.1|2862519_2863692_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.2	2.9e-222
WP_000161707.1|2864225_2864948_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001287102.1|2865144_2865552_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.0	1.1e-59
WP_001274643.1|2865558_2867178_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.1e-154
WP_001086808.1|2867174_2867780_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.4e-116
WP_000268332.1|2867772_2868681_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000177406.1|2868667_2869027_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	6.8e-58
WP_000993750.1|2869023_2869602_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_000343940.1|2869670_2870117_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.3e-63
WP_001039965.1|2870109_2870541_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	6.2e-74
WP_001648763.1|2870636_2871065_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871618.1|2871061_2871436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|2871440_2871950_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|2871930_2872146_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868182.1|2872149_2872353_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	5.5e-33
WP_000673534.1|2872352_2872817_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2872910_2873564_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730752.1|2873567_2874650_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	96.9	6.5e-189
WP_000216273.1|2874666_2875500_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.7	2.7e-126
WP_001098460.1|2875642_2877409_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001292072.1|2877408_2878440_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.0	1.3e-191
WP_014344392.1|2878466_2879444_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
WP_014344393.1|2879433_2879916_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
2880154:2880175	attL	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
WP_000698372.1|2880291_2880669_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-28
WP_014344394.1|2880646_2881756_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_001217569.1|2881861_2882095_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	3.7e-33
WP_001154443.1|2882106_2882295_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_000301157.1|2882618_2884862_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_000104129.1|2884852_2885710_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	93.3	4.6e-153
WP_000785514.1|2885706_2885934_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_001178763.1|2885933_2886161_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000963476.1|2886228_2886570_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001528723.1|2886533_2886728_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000794278.1|2886812_2887088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460863.1|2887174_2887684_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
WP_000102529.1|2887716_2887965_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
WP_000616881.1|2888084_2888717_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
WP_000155500.1|2888718_2889744_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	3.5e-192
WP_000834152.1|2889740_2890952_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
WP_000124715.1|2891294_2892491_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
2895478:2895499	attR	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
>prophage 10
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	2895663	2901464	4879234		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210082.1|2895663_2896230_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2896246_2896489_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2896485_2897223_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000556594.1|2897760_2898027_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|2898023_2898575_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2898571_2898799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2898795_2899116_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2899130_2901464_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
>prophage 11
NZ_CP053865	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 chromosome, complete genome	4879234	4440428	4460848	4879234	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4440428_4441157_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4441353_4441644_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4441892_4442348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4442344_4442950_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4442954_4444700_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4444702_4445335_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4445327_4446443_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4446433_4446793_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4446956_4448504_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4448503_4449433_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4449429_4449792_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4450119_4450842_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4450851_4451895_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4451882_4452092_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4452091_4453045_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4453044_4455399_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4455495_4455624_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4455583_4455901_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4455952_4456477_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4456476_4457904_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4457893_4458091_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4458087_4458543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4458702_4459017_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4459029_4459635_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4459637_4459925_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4460500_4460848_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP053866	Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence	93842	43673	52969	93842	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|43673_44354_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|44735_45092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|45084_45555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|46065_46488_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|46487_47762_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064272.1|47843_48818_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	3.9e-84
WP_000427676.1|48817_50023_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|50437_51379_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|51410_51977_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|52033_52369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|52552_52969_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
