The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	976485	985217	4881794	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|976485_977604_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|977600_979547_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|979676_979898_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|980221_980542_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|980572_982849_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|983040_983499_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|983961_985217_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	1020734	1133772	4881794	transposase,holin,tail,terminase,portal,lysis,protease,tRNA	Salmonella_phage(41.67%)	113	NA	NA
WP_001339197.1|1020734_1021943_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000125006.1|1022782_1023466_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140324.1|1023579_1025253_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167332.1|1025408_1025693_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000705784.1|1025922_1028187_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|1028223_1029972_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_000561681.1|1029968_1030946_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056911.1|1030989_1032222_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350061.1|1032273_1032456_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011576.1|1032452_1033199_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436889.1|1033409_1034303_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899563.1|1034282_1035059_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001154025.1|1035194_1035998_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1035990_1037313_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1037293_1037998_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1037997_1042464_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1042808_1044650_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1044909_1045458_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1045485_1046133_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1046194_1047385_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1047569_1048661_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1049267_1050668_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1050868_1051330_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1051646_1052861_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1053105_1054542_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1054619_1055822_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1056016_1057309_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1057353_1057602_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1057642_1057882_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1057924_1059082_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1059044_1061930_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1062056_1062356_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1062377_1062536_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1062528_1062789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1062838_1063249_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1063368_1063608_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1063573_1063948_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1064032_1065016_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1065018_1065768_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1065778_1066126_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1066122_1066434_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1066511_1066802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1067093_1067327_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1067438_1067660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1067742_1068345_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1068553_1069165_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1069161_1069308_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1069297_1070095_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1070161_1070479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1070652_1070778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1070913_1071363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1071723_1072410_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1072685_1073015_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1072998_1073451_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1073468_1073948_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1074155_1074689_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1074645_1076784_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1076780_1076987_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009208.1|1076983_1078531_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1078454_1080536_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1080626_1080950_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1080942_1081242_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1081222_1081789_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1081785_1082187_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132758.1|1082198_1082948_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	1.8e-89
WP_000478859.1|1082993_1083392_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1083388_1083718_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1083797_1086785_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1086781_1087114_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1087212_1087710_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1087826_1088360_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1088449_1089145_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1089154_1089892_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1089789_1090494_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|1093040_1093916_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1093954_1094197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144682.1|1094250_1096458_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	E5G6P0	Salmonella_phage	51.5	6.2e-77
WP_000143167.1|1096457_1097039_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1097514_1098483_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1099130_1099757_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1099825_1100125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1100109_1100796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1101066_1101258_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1101684_1104297_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1104504_1105515_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1105680_1106223_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1106219_1107329_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1107427_1109536_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1109548_1111456_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333148.1|1111470_1112724_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1112728_1114369_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1114365_1114929_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1115184_1115352_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1115451_1115970_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1116038_1117799_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1117984_1118437_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1118508_1119561_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1119917_1120427_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1120643_1121249_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1121235_1123389_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1123407_1123854_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1123977_1126032_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1126067_1126526_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1126620_1127283_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1127456_1127870_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1127914_1128232_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1128289_1129501_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1129715_1130264_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1130289_1131069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1131117_1131399_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1131395_1131725_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1131811_1132471_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1133091_1133772_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	1923603	1930412	4881794	tail,integrase	Salmonella_phage(33.33%)	11	1918466:1918488	1928181:1928203
1918466:1918488	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1923603_1924485_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1924957_1925146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1925210_1925378_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1925634_1926168_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1926221_1926452_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1926641_1927136_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1927195_1928050_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1928423_1928777_-	YebY family protein	NA	NA	NA	NA	NA
1928181:1928203	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1928793_1929669_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1929669_1930044_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1930181_1930412_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2005862	2085206	4881794	integrase,transposase,holin,tail,terminase,portal,capsid,head,protease,lysis,plate	Salmonella_phage(86.36%)	102	2012400:2012415	2086829:2086844
WP_000502119.1|2005862_2006321_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2006501_2007707_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2007785_2009273_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2009529_2010933_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2010947_2011355_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2011354_2011723_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2011794_2013279_+	alpha-amylase	NA	NA	NA	NA	NA
2012400:2012415	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2013318_2013744_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2013929_2015135_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2015131_2015365_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2015629_2016016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2016135_2016450_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2016666_2018349_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2018341_2019337_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2019329_2020037_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2020036_2021407_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2021428_2021872_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2021868_2023086_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2023190_2023658_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2023662_2024667_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2024663_2025077_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2025076_2025454_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2025453_2026191_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2026200_2026470_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2026478_2027273_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103975.1|2027554_2028178_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|2028216_2028411_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2028539_2028767_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2029076_2029892_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2029870_2031583_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|2031747_2031933_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|2032009_2032927_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2033096_2034017_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2034005_2034476_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2034456_2035887_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2035960_2036656_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2036747_2037047_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2037696_2038893_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2039153_2039342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2039352_2039565_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2040019_2041288_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2041290_2041710_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2041836_2041998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2042628_2042850_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2043062_2044070_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2044354_2044954_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554736.1|2044923_2046486_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_001207832.1|2046472_2047060_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2047062_2047584_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2047618_2048164_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2048135_2048549_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2048553_2049087_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2049086_2050145_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2050141_2051482_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2051515_2053444_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2053528_2053855_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2053851_2054208_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2054207_2055704_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2055693_2055858_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2055861_2056422_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2056418_2056931_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2056902_2057307_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2057303_2057627_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2057629_2057830_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2057880_2059086_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2059100_2059751_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2059728_2060970_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2060969_2061152_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2061163_2062897_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2062893_2063388_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2063513_2063864_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2063924_2064227_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2064446_2064866_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2065078_2065564_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2065560_2066175_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2066177_2066522_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2066683_2067118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2067047_2067305_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2067437_2068061_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2068071_2069061_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2069068_2069929_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2069945_2070335_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2070331_2071225_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2071224_2071707_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2071708_2072527_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2072523_2072748_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2072744_2073902_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2073898_2074453_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2074481_2074706_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2074803_2075499_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2076313_2076685_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2076742_2077570_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2077706_2078246_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2078316_2078547_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2078543_2079059_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2079055_2079673_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2079669_2080503_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2080506_2081076_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2081115_2081343_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2081344_2082334_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2082625_2083423_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2084732_2085206_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2086829:2086844	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2171200	2181706	4881794		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2171200_2172514_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2172540_2173620_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2173624_2174398_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174394_2175387_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175392_2175944_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2175944_2176823_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2176870_2177770_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2177769_2178855_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179231_2180125_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2180302_2181706_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2251352	2260523	4881794	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2251352_2253386_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2253626_2254085_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2254256_2254787_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2254843_2255311_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2255357_2256077_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2256073_2257759_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2257981_2258713_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2258772_2258880_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2258860_2259592_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2259575_2260523_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2279930	2346325	4881794	lysis,tail,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2279930_2280626_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2280779_2281664_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2281840_2282560_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2282556_2282802_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2283006_2284248_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2284241_2285477_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2285551_2286562_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2286577_2288098_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2288231_2289230_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2289728_2290751_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2290900_2292043_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2292057_2292726_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2293055_2293913_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2293901_2294291_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2294295_2295663_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2295879_2296767_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2296799_2298122_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2298165_2300157_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535005.1|2300501_2301971_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2302160_2303024_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2303144_2304194_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2304272_2305130_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2305194_2306883_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2306899_2307838_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2307837_2308968_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2309336_2310518_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2310582_2311248_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2311249_2311372_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2311759_2312014_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2312337_2312910_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2313122_2314109_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2314138_2314858_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2315271_2315844_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2316169_2317726_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2317832_2319638_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2319647_2320742_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2320741_2321767_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2321768_2323358_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2323361_2323706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2324096_2325287_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2325314_2326010_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2326161_2327922_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2328046_2328331_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2328439_2329060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2329087_2330095_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2330274_2330502_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2330533_2332294_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2332574_2333078_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2333105_2333396_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2333743_2335573_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2335626_2336070_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2336447_2336975_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2336977_2338219_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2338811_2339141_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2339437_2340769_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2340797_2341166_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2341180_2342170_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2342498_2344865_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2345033_2345237_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2345533_2346325_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2683745	2791307	4881794	integrase,transposase,holin,tail,terminase,portal,capsid,head,lysis,protease,tRNA	Salmonella_phage(30.3%)	112	2708290:2708306	2799211:2799227
WP_000940032.1|2683745_2684477_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2684595_2685399_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2685543_2686422_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2686603_2687647_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2687650_2688469_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2688479_2689493_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2689493_2690480_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2690470_2691109_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2691234_2692512_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2692506_2693646_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2693841_2695095_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2695419_2696610_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2696791_2698336_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2698696_2700028_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2700110_2702255_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2702310_2703771_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2703819_2704158_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2704234_2705572_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2705568_2706333_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2706334_2707765_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2708290:2708306	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2708414_2712302_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2712323_2712557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2712557_2714102_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2714152_2714704_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2714728_2715364_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2715367_2716729_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2716739_2717633_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2717748_2718597_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2718635_2719553_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2719574_2720771_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2720886_2721813_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2721850_2722111_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2722222_2722603_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2722602_2723334_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2723345_2724074_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2724085_2724991_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2724987_2725668_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2725941_2726916_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2726932_2728732_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2729136_2730630_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2731102_2731240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2731952_2732117_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2732824_2733037_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2733143_2733371_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2733467_2734046_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2734035_2734860_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_014344380.1|2734856_2737229_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.1e-90
WP_000178853.1|2737282_2737525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2737563_2740926_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2740987_2741635_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2741532_2742270_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2742276_2742975_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2742984_2743314_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2743316_2746412_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2746383_2746722_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2746718_2747114_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2747164_2747911_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2747918_2748320_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2748428_2749559_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2749607_2750186_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2750213_2750597_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2750607_2750967_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2751024_2752053_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2752107_2752455_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2752467_2753964_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2753953_2755534_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2755530_2755734_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2755717_2757649_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2757620_2758166_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2758452_2758854_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2759089_2759542_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2759559_2760012_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2759995_2760325_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2760600_2761287_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2761501_2761690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2762196_2762760_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2763032_2763710_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2763706_2763847_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096546.1|2763843_2764455_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_000929790.1|2764663_2765266_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2765300_2765549_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2765665_2765899_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000002116.1|2766460_2766742_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_000208067.1|2766734_2767388_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000852188.1|2767390_2767861_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000065092.1|2767862_2768528_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000788827.1|2768542_2769235_-	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000024048.1|2769231_2770137_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_072143007.1|2770228_2770603_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000145711.1|2770568_2770796_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000169863.1|2770809_2771277_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000368620.1|2771428_2772514_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000373340.1|2772621_2772828_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000551857.1|2773227_2773398_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_000394219.1|2773538_2776739_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	74.1	0.0e+00
WP_014344386.1|2776701_2777859_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2777901_2778141_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2778181_2778466_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2778443_2779673_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2780170_2780650_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2780646_2781603_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2781602_2782253_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2782284_2782860_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2782856_2783021_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2783284_2784907_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2784891_2785629_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2785759_2787094_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2787111_2788011_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2788113_2788701_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2788762_2789146_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2789464_2790154_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2790269_2791307_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2799211:2799227	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2814331	2893713	4881794	integrase,tail,terminase,portal,capsid,lysis,head,tRNA,plate	Salmonella_phage(69.49%)	83	2881376:2881397	2896700:2896721
WP_001168062.1|2814331_2815402_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2815841_2816360_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2816352_2817573_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000218691.1|2817825_2818875_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
WP_000823622.1|2818899_2819238_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
WP_001096998.1|2819246_2820092_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
WP_001278192.1|2820205_2820559_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_000883911.1|2820609_2821119_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	3.6e-89
WP_000920166.1|2821126_2821327_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	9.6e-30
WP_000963466.1|2821290_2821629_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	2.3e-52
WP_001246236.1|2821696_2821924_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752587.1|2821923_2822148_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	1.1e-34
WP_157868817.1|2822169_2822763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978866.1|2825531_2826017_+|tail	phage tail protein	tail	O80317	Escherichia_phage	91.9	1.1e-79
WP_000988226.1|2826013_2827180_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.8	3.2e-205
WP_000416621.1|2827374_2828064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972009.1|2828140_2828359_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	97.2	6.1e-38
WP_000065257.1|2828504_2828852_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2828892_2829660_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2829704_2830253_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2830271_2830520_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2830833_2832195_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2832360_2833152_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2833171_2834458_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2834578_2835184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2835218_2835809_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2835931_2836810_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2836895_2838557_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2838705_2839044_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2839209_2839500_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2839489_2839966_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2840115_2840598_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2841211_2852686_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533859.1|2852750_2854160_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2854156_2856337_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2856344_2857508_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2858059_2858278_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010544.1|2858346_2859447_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.8	1.3e-192
WP_000980418.1|2859443_2859929_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282764.1|2859925_2862733_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.5	0.0e+00
WP_000763316.1|2862725_2862845_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280960.1|2862859_2863162_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	5.5e-45
WP_001207652.1|2863216_2863732_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046099.1|2863741_2864914_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.2	2.9e-222
WP_000161707.1|2865447_2866170_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001287102.1|2866366_2866774_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.0	1.1e-59
WP_001274643.1|2866780_2868400_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.1e-154
WP_001086808.1|2868396_2869002_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.4e-116
WP_000268332.1|2868994_2869903_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000177406.1|2869889_2870249_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	6.8e-58
WP_000993750.1|2870245_2870824_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_000343940.1|2870892_2871339_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.3e-63
WP_001039965.1|2871331_2871763_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	6.2e-74
WP_001648763.1|2871858_2872287_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871618.1|2872283_2872658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|2872662_2873172_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|2873152_2873368_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868182.1|2873371_2873575_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	5.5e-33
WP_000673534.1|2873574_2874039_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2874132_2874786_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730752.1|2874789_2875872_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	96.9	6.5e-189
WP_000216273.1|2875888_2876722_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.7	2.7e-126
WP_001098460.1|2876864_2878631_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001292072.1|2878630_2879662_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.0	1.3e-191
WP_014344392.1|2879688_2880666_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
WP_014344393.1|2880655_2881138_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
2881376:2881397	attL	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
WP_000698372.1|2881513_2881891_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-28
WP_014344394.1|2881868_2882978_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_001217569.1|2883083_2883317_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	3.7e-33
WP_001154443.1|2883328_2883517_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_000301157.1|2883840_2886084_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_000104129.1|2886074_2886932_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	93.3	4.6e-153
WP_000785514.1|2886928_2887156_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_001178763.1|2887155_2887383_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000963476.1|2887450_2887792_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001528723.1|2887755_2887950_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000794278.1|2888034_2888310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460863.1|2888396_2888906_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
WP_000102529.1|2888938_2889187_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
WP_000616881.1|2889306_2889939_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
WP_000155500.1|2889940_2890966_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	3.5e-192
WP_000834152.1|2890962_2892174_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
WP_000124715.1|2892516_2893713_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
2896700:2896721	attR	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
>prophage 10
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	2896885	2902686	4881794		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210082.1|2896885_2897452_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2897468_2897711_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2897707_2898445_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000556594.1|2898982_2899249_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|2899245_2899797_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2899793_2900021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2900017_2900338_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2900352_2902686_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
>prophage 11
NZ_CP053870	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 chromosome, complete genome	4881794	4441650	4463408	4881794	tail,plate,transposase	Burkholderia_phage(45.0%)	27	NA	NA
WP_000587738.1|4441650_4442379_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4442575_4442866_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4443114_4443570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4443566_4444172_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4444176_4445922_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4445924_4446557_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4446549_4447665_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4447655_4448015_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4448178_4449726_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4449725_4450655_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4450651_4451014_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4451341_4452064_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4452073_4453117_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4453104_4453314_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4453313_4454267_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001339197.1|4456537_4457746_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_172665334.1|4457815_4457959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185654.1|4458055_4458184_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4458143_4458461_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4458512_4459037_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4459036_4460464_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4460453_4460651_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4460647_4461103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4461262_4461577_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4461589_4462195_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4462197_4462485_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4463060_4463408_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP053871	Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence	95180	45011	54307	95180	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|45011_45692_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|46073_46430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|46422_46893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|47403_47826_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|47825_49100_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064272.1|49181_50156_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	3.9e-84
WP_000427676.1|50155_51361_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|51775_52717_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|52748_53315_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|53371_53707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|53890_54307_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
