The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053746	Pseudomonas graminis strain PgKB30 chromosome, complete genome	5521192	3409876	3425007	5521192	holin,tRNA,bacteriocin	uncultured_Caudovirales_phage(53.85%)	19	NA	NA
WP_172611467.1|3409876_3411157_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	2.2e-98
WP_172611468.1|3411157_3412552_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_172611469.1|3412622_3413624_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_172611470.1|3413721_3414723_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	81.7	4.5e-160
WP_122625281.1|3414719_3415055_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	79.3	4.2e-46
WP_172611471.1|3415051_3415351_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	3.2e-29
WP_172611472.1|3415350_3415713_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.8	1.6e-38
WP_172611473.1|3415714_3416107_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	83.1	1.5e-55
WP_122536358.1|3416221_3416893_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	92.8	8.7e-107
WP_172611474.1|3417340_3418153_+	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	40.7	2.5e-39
WP_172611475.1|3418243_3418564_-	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	55.8	9.1e-22
WP_172611476.1|3419061_3419250_+	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	77.3	2.2e-12
WP_172611477.1|3419254_3420109_+|bacteriocin	putidacin L1 family lectin-like bacteriocin	bacteriocin	NA	NA	NA	NA
WP_172611478.1|3420227_3420359_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_172611479.1|3420364_3420724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065989191.1|3420958_3421276_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	41.0	6.5e-12
WP_172613063.1|3421317_3421704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172611480.1|3422078_3422504_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	74.5	5.0e-60
WP_172613064.1|3422865_3425007_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	1.2e-40
>prophage 2
NZ_CP053746	Pseudomonas graminis strain PgKB30 chromosome, complete genome	5521192	4186721	4261427	5521192	tail,terminase,lysis,transposase,capsid,integrase	Pseudomonas_phage(43.64%)	90	4186533:4186558	4243250:4243275
4186533:4186558	attL	CGGTTCGACTCCGGCTCGGGGCACCA	NA	NA	NA	NA
WP_172612001.1|4186721_4187948_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	56.5	1.8e-126
WP_172612002.1|4187944_4188160_-	AlpA family phage regulatory protein	NA	B7SYF9	Stenotrophomonas_phage	43.3	5.5e-07
WP_172612003.1|4188181_4188439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612004.1|4188720_4189110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172613103.1|4189106_4189505_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	46.9	7.6e-26
WP_172612005.1|4189758_4191948_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	55.1	6.9e-238
WP_172612006.1|4191999_4192428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612007.1|4192687_4193470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612008.1|4193655_4194429_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	48.2	3.6e-48
WP_172612009.1|4194484_4195132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612010.1|4195194_4196049_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.9	4.7e-73
WP_172612011.1|4196074_4197088_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	63.8	1.8e-124
WP_172612012.1|4197192_4197402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612013.1|4197613_4197856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612014.1|4197852_4199502_-	Heme peroxidase	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	56.5	2.4e-158
WP_172612015.1|4199498_4200386_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	59.6	2.0e-79
WP_172612016.1|4200551_4200755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612017.1|4200747_4200972_-	hypothetical protein	NA	A0A2H4J1S2	uncultured_Caudovirales_phage	61.1	2.1e-17
WP_172612018.1|4200968_4201205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612019.1|4201201_4201489_-	hypothetical protein	NA	A0A2H4J6R2	uncultured_Caudovirales_phage	52.6	2.8e-22
WP_172612020.1|4201541_4201745_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	56.5	1.3e-10
WP_172612021.1|4202505_4203291_+	SPOR domain-containing protein	NA	A0A0P0IYG9	Acinetobacter_phage	40.2	5.0e-05
WP_172612022.1|4203379_4204207_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_172612023.1|4204209_4205025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612024.1|4205064_4205937_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.2	9.7e-58
WP_172612025.1|4206044_4206251_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	53.4	6.9e-07
WP_172612026.1|4206518_4206950_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_172612027.1|4207013_4207859_+	replication protein	NA	W6MYB0	Pseudomonas_phage	42.8	7.7e-44
WP_172612028.1|4207839_4208658_+	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	38.9	9.1e-42
WP_172612029.1|4208657_4208861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612030.1|4208857_4209259_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	76.5	2.4e-56
WP_172613104.1|4209376_4209943_+	recombination protein NinG	NA	A0A059VA66	Pseudomonas_phage	69.4	1.4e-73
WP_172612031.1|4209939_4210521_+	hypothetical protein	NA	A0A059VF83	Pseudomonas_phage	87.0	1.1e-97
WP_172612032.1|4210746_4211244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612033.1|4212136_4212466_+	MFS transporter	NA	A0A088FVG2	Escherichia_phage	48.6	1.0e-20
WP_172612034.1|4212462_4212825_+	hypothetical protein	NA	A0A193GYR7	Enterobacter_phage	37.8	2.1e-06
WP_172612035.1|4212888_4213434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612036.1|4213514_4214129_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	84.1	1.1e-97
WP_172612037.1|4214160_4214637_+	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	75.0	4.5e-49
WP_172612038.1|4214608_4215910_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.7e-147
WP_172612039.1|4215909_4217376_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	63.2	4.3e-167
WP_172612040.1|4217350_4218439_+|capsid	minor capsid protein	capsid	A0A1B0VMF3	Pseudomonas_phage	68.7	6.2e-139
WP_172612041.1|4218526_4218934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612042.1|4219051_4219768_+	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	57.9	7.0e-38
WP_172612043.1|4219778_4220744_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	70.3	9.8e-128
WP_172612044.1|4220786_4221137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612045.1|4221140_4221641_+	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	70.3	2.2e-59
WP_172612046.1|4221675_4221858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612047.1|4221879_4222251_+	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	69.9	9.8e-44
WP_172612048.1|4222247_4222904_+	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	71.1	1.3e-83
WP_172612049.1|4222900_4223311_+	DUF4128 domain-containing protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	56.0	8.3e-36
WP_172612050.1|4223380_4224031_+|tail	phage tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	61.3	3.8e-67
WP_172612051.1|4224034_4224427_+	hypothetical protein	NA	A0A1B0VMH4	Pseudomonas_phage	63.0	1.7e-38
WP_172612052.1|4224444_4224738_+	DUF1799 domain-containing protein	NA	A0A1B0VMG9	Pseudomonas_phage	64.2	4.1e-29
WP_172612053.1|4224748_4227901_+|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	45.1	3.9e-218
WP_172612054.1|4227902_4228241_+|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	67.9	1.9e-41
WP_172612055.1|4228250_4229000_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	75.5	4.2e-118
WP_172612056.1|4229001_4229799_+	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	78.0	2.1e-123
WP_172612057.1|4229769_4230357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612058.1|4230845_4231352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612059.1|4232072_4232669_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	69.8	2.0e-70
WP_172612060.1|4232730_4232973_+	DUF4177 domain-containing protein	NA	A0A0A7NPW2	Enterobacteria_phage	60.3	5.8e-21
WP_172612061.1|4232972_4233176_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_172612062.1|4233218_4236782_+|tail	phage tail protein	tail	A0A2H4J8Z6	uncultured_Caudovirales_phage	61.4	0.0e+00
WP_172613105.1|4236797_4237106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172612063.1|4237102_4237783_+	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	33.5	2.4e-32
WP_172612064.1|4238760_4239090_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	58.0	9.6e-27
WP_172612065.1|4239086_4239455_+|tail	phage tail protein	tail	A0A059VFX9	Pseudomonas_phage	62.0	1.1e-23
WP_172612066.1|4239541_4240561_+	acyltransferase	NA	A0A2H4IYS5	uncultured_Caudovirales_phage	39.3	1.1e-55
WP_172612067.1|4240619_4241045_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	74.5	1.9e-59
WP_172612068.1|4241041_4241554_+|lysis	lysis protein	lysis	A0A1B0VMJ3	Pseudomonas_phage	50.0	5.2e-27
WP_172612069.1|4242234_4242531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172613106.1|4242625_4242874_+	S24 family peptidase	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	39.2	7.1e-06
WP_172612070.1|4243322_4245989_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	1.6e-156
4243250:4243275	attR	CGGTTCGACTCCGGCTCGGGGCACCA	NA	NA	NA	NA
WP_172612071.1|4246026_4246200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172612072.1|4246196_4247267_-	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	33.8	9.1e-42
WP_172612073.1|4247379_4248468_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.4e-21
WP_172612074.1|4248464_4249151_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_172612075.1|4249151_4249919_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172612076.1|4250057_4251134_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_172612077.1|4251226_4251865_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172612078.1|4251914_4252898_+	oxidoreductase	NA	NA	NA	NA	NA
WP_172612079.1|4252898_4253342_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_172612080.1|4253341_4253797_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_172612081.1|4253918_4255040_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	54.3	4.0e-16
WP_172612082.1|4255136_4256000_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_172612083.1|4256004_4256391_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_172612084.1|4256614_4258252_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_172612085.1|4258889_4260212_+	OprD family porin	NA	NA	NA	NA	NA
WP_172610027.1|4260431_4261427_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.9	3.1e-20
