The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	0	42490	4850975	terminase,capsid,portal,tail,lysis,protease,plate,holin,head	Escherichia_phage(58.82%)	52	NA	NA
WP_172614039.1|0_2280_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000208724.1|2583_3579_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000636521.1|3582_4224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172614040.1|4345_4507_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	92.2	4.9e-16
WP_000038193.1|4561_5596_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_052924546.1|5595_7368_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085948.1|7541_8396_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_050191165.1|8454_9528_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.5e-201
WP_001593490.1|9531_10275_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_000988633.1|10374_10884_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_053919668.1|10883_11087_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	1.2e-30
WP_042099821.1|11090_11372_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.1e-42
WP_001144101.1|11371_11869_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_087530421.1|11883_12309_+	protein lysA	NA	Q858W1	Yersinia_virus	88.7	5.5e-59
WP_167791132.1|12296_12722_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	4.2e-67
WP_001440152.1|12693_12867_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917186.1|12829_13297_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001786.1|13289_13742_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_172614041.1|13808_14444_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	2.7e-110
WP_000127164.1|14440_14788_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121476.1|14792_15701_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_001285340.1|15693_16305_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_172614042.1|16301_17639_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	67.6	1.3e-175
WP_172614043.1|17638_18241_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	88.4	4.3e-89
WP_106668518.1|18658_19150_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	8.2e-06
WP_000905100.1|19180_19774_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286709.1|19833_21024_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|21036_21555_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|21611_21887_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|21919_22039_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_172614044.1|22031_24479_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.8	0.0e+00
WP_032330351.1|24493_24973_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	99.4	3.3e-84
WP_172614045.1|24972_26136_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	98.7	3.5e-204
WP_000468308.1|26217_26436_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|26671_27574_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|27754_28717_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|29036_30026_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_063502014.1|30132_30888_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|30942_31710_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|31817_32417_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|32517_32958_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|33169_33469_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|33495_33924_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|33928_34675_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_053904550.1|34771_35782_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|35916_37425_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|37447_38293_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|38717_38963_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|39047_39533_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|39625_40552_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|40618_41950_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|41959_42490_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	59248	66495	4850975		Synechococcus_phage(33.33%)	5	NA	NA
WP_063091789.1|59248_59911_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185137.1|59922_62424_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004454.1|62732_63812_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|63826_64147_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_063091787.1|64197_66495_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 3
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	83841	85686	4850975		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|83841_85686_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 4
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	94278	97331	4850975		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|94278_95229_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|96146_97331_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 5
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	101447	109776	4850975		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|101447_105476_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|105552_109776_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 6
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	118993	120757	4850975		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|118993_119665_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|119707_120298_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|120484_120757_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 7
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	126119	127709	4850975		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|126119_127709_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 8
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	144101	147785	4850975		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|144101_147785_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 9
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	167057	168173	4850975		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|167057_168173_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 10
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	177388	177997	4850975		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|177388_177997_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 11
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	184592	187140	4850975		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|184592_186008_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_115440386.1|186060_187140_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 12
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	191327	194940	4850975		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|191327_194150_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|194403_194940_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 13
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	198757	200107	4850975		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|198757_200107_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 14
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	205270	207229	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|205270_207229_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 15
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	216964	219112	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|216964_219112_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 16
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	224357	230726	4850975		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066021.1|224357_226343_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
WP_172614050.1|226615_227545_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|227528_228224_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|228234_229215_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|229193_230726_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 17
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	236960	238510	4850975		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|236960_237641_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|237751_238510_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 18
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	244122	244911	4850975		Pithovirus(100.0%)	1	NA	NA
WP_119188327.1|244122_244911_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	4.2e-12
>prophage 19
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	250248	251751	4850975		Burkholderia_virus(100.0%)	1	NA	NA
WP_001295385.1|250248_251751_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 20
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	273805	277017	4850975	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|273805_275323_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|275559_277017_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 21
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	291294	293278	4850975		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|291294_291588_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|291631_293278_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 22
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	297791	298325	4850975		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|297791_298325_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 23
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	303245	304223	4850975		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|303245_304223_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 24
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	312206	312752	4850975		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|312206_312752_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 25
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	316788	329819	4850975	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000640382.1|316788_318126_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|318135_319983_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|319975_320926_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|321011_321320_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|321395_322676_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|322761_324021_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|324023_325028_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|325109_325307_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|325410_326709_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|326913_327339_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_001469718.1|327377_329819_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 26
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	333752	334916	4850975		Ralstonia_phage(100.0%)	1	NA	NA
WP_172614052.1|333752_334916_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
>prophage 27
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	376454	382942	4850975		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|376454_376985_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|377294_378251_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|378390_379893_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_172614053.1|379906_380929_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|380915_381911_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|381943_382942_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 28
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	387258	390020	4850975		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|387258_387723_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|387881_390020_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 29
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	393658	399755	4850975		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|393658_394606_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|394790_394844_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|394984_397681_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|397886_398273_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|398345_398807_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_172614054.1|398819_399755_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.2e-52
>prophage 30
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	408128	417308	4850975	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416392.1|408128_410984_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|410983_411427_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|411684_413196_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584112.1|413462_414563_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|414562_415645_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001424443.1|415805_417308_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 31
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	422437	425189	4850975	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	419288:419301	425860:425873
419288:419301	attL	AGTAGGCCCTGGAT	NA	NA	NA	NA
WP_000061766.1|422437_423457_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_001218930.1|423923_425189_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
425860:425873	attR	ATCCAGGGCCTACT	NA	NA	NA	NA
>prophage 32
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	446134	447810	4850975		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|446134_446737_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|447213_447810_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 33
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	458013	459474	4850975		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|458013_459474_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 34
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	466042	466597	4850975		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|466042_466597_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 35
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	477978	483343	4850975		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|477978_479643_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|479691_481053_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|481267_482182_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063107209.1|482320_483343_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 36
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	486567	487847	4850975		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|486567_487305_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|487307_487847_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 37
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	495776	498652	4850975		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|495776_497366_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|497758_498364_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|498490_498652_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 38
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	504630	505953	4850975		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477828.1|504630_505953_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.8e-79
>prophage 39
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	513728	519084	4850975		Enterococcus_phage(33.33%)	4	NA	NA
WP_000093812.1|513728_514961_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000007444.1|514994_515162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046749.1|515268_516936_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409472.1|517146_519084_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	5.2e-11
>prophage 40
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	522367	524481	4850975		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|522367_523057_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219588.1|523056_524481_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 41
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	536267	546685	4850975	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130185.1|536267_537221_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|537335_537923_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|537957_538524_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_016244256.1|538672_539386_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843565.1|539411_539816_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|540192_542109_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118475.1|542197_543328_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_001300563.1|543590_544703_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|544780_544990_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681362.1|545518_546685_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
>prophage 42
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	550509	553326	4850975	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_032202329.1|550509_553326_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.4	9.3e-78
>prophage 43
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	557769	558918	4850975		Halovirus(100.0%)	1	NA	NA
WP_000597261.1|557769_558918_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 44
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	564421	570082	4850975		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001352635.1|564421_565975_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	5.4e-35
WP_021514475.1|566048_567266_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|567394_568537_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|568567_570082_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 45
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	577972	579372	4850975		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|577972_578452_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|578529_579372_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 46
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	588523	593946	4850975		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|588523_591430_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|591594_593946_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 47
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	600394	601093	4850975		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|600394_601093_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 48
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	613795	615520	4850975		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|613795_615520_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 49
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	641609	642653	4850975		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|641609_642653_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 50
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	646898	647450	4850975		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|646898_647450_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 51
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	656065	657490	4850975		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|656065_657490_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 52
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	665139	671762	4850975		Mamastrovirus(33.33%)	5	NA	NA
WP_001189601.1|665139_666690_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|666891_669282_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|669487_670024_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|670064_670727_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|670835_671762_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 53
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	675024	675927	4850975		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|675024_675927_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 54
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	679304	686110	4850975	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|679304_680723_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|680761_681688_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|681724_682180_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|682357_683062_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|683076_683607_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_172614060.1|683680_686110_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 55
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	691353	692151	4850975		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|691353_692151_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 56
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	698185	698530	4850975		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|698185_698530_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 57
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	702459	703884	4850975	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|702459_703884_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 58
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	716481	717240	4850975		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|716481_717240_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 59
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	726068	730184	4850975		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|726068_726665_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|726701_730184_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 60
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	743189	744221	4850975		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|743189_744221_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 61
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	750742	758374	4850975		Indivirus(25.0%)	8	NA	NA
WP_000997010.1|750742_751546_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|751542_752457_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|752697_753498_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|754172_755531_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|755602_756358_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|756391_757114_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|757110_757578_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|757642_758374_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 62
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	766634	770544	4850975		Caulobacter_phage(50.0%)	5	NA	NA
WP_000284050.1|766634_767213_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|767418_768186_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|768156_768897_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000729704.1|769324_769585_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001355630.1|769770_770544_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
>prophage 63
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	781279	786088	4850975		Streptococcus_phage(50.0%)	4	NA	NA
WP_000749863.1|781279_782335_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|782622_783726_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|783737_784991_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001310565.1|785506_786088_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.1	2.7e-96
>prophage 64
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	794878	795988	4850975		Planktothrix_phage(100.0%)	1	NA	NA
WP_016243364.1|794878_795988_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
>prophage 65
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	805161	806232	4850975		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000837747.1|805161_806232_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
>prophage 66
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	812682	822734	4850975	integrase	Yersinia_phage(20.0%)	13	816524:816536	819495:819507
WP_001241366.1|812682_813501_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.8	4.8e-43
WP_000860084.1|813582_814062_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
WP_001186773.1|814077_814554_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692307.1|814622_814844_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_016243360.1|815006_815381_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854695.1|815427_815805_+	toxin	NA	NA	NA	NA	NA
WP_000761710.1|815801_816290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839228.1|816301_816499_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
816524:816536	attL	ACTGACGCCAGCC	NA	NA	NA	NA
WP_001280536.1|816583_817432_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000144689.1|817524_818844_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
WP_001111348.1|819180_819591_-	hypothetical protein	NA	NA	NA	NA	NA
819495:819507	attR	ACTGACGCCAGCC	NA	NA	NA	NA
WP_172614063.1|819569_820526_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667036.1|820535_822734_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
>prophage 67
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	842942	844268	4850975		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|842942_844268_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 68
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	849843	855763	4850975	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|849843_851514_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_119188305.1|851527_853000_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|853013_853601_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|853729_855763_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 69
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	867150	868200	4850975		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_063501663.1|867150_868200_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.4e-71
>prophage 70
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	876972	878859	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|876972_878859_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 71
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	881963	882863	4850975		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|881963_882863_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 72
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	887403	891683	4850975		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_172614065.1|887403_890478_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
WP_000805902.1|890600_891683_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 73
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	897093	899054	4850975		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_172614066.1|897093_898044_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	34.9	4.3e-35
WP_001013494.1|898040_899054_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
>prophage 74
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	902536	903646	4850975		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|902536_903646_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 75
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	908943	909711	4850975		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|908943_909711_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 76
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	916660	917818	4850975		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|916660_917818_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 77
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	926010	927126	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|926010_927126_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 78
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	931415	941492	4850975		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|931415_932327_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|932451_933360_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|933604_934789_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698951.1|934914_938061_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|938057_939260_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|939449_940139_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|940196_941492_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 79
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	948444	957425	4850975	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|948444_949572_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|949594_949927_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|949954_951802_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|951812_952784_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|952912_953260_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|953436_954321_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|954619_955159_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|955309_955759_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|955762_956866_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|956954_957425_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 80
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	978984	984031	4850975	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|978984_979608_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|979733_981008_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|981195_983550_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|983758_984031_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 81
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	987159	987855	4850975		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|987159_987855_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 82
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	991178	994725	4850975		Bacillus_phage(100.0%)	2	NA	NA
WP_001235622.1|991178_992951_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256201.1|992943_994725_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 83
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1003561	1006711	4850975		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1003561_1006711_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 84
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1013719	1022281	4850975		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1013719_1014271_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|1014399_1016331_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1016383_1016713_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1016712_1017318_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1017427_1019302_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1019482_1020127_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|1020362_1021325_+	ferrochelatase	NA	NA	NA	NA	NA
WP_063501955.1|1021321_1022281_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	5.0e-15
>prophage 85
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1030525	1033687	4850975		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|1030525_1030867_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_172614067.1|1031182_1033687_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	6.5e-115
>prophage 86
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1038226	1038904	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_172614068.1|1038226_1038904_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 87
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1042040	1049849	4850975		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|1042040_1042727_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1042723_1045138_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_073546674.1|1045568_1049849_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
>prophage 88
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1056231	1058004	4850975		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001384338.1|1056231_1058004_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.0e-38
>prophage 89
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1064194	1065340	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|1064194_1065340_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 90
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1076917	1080048	4850975	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|1076917_1078303_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|1078338_1078860_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1078967_1079180_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1079181_1080048_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 91
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1102944	1107704	4850975		Ralstonia_phage(50.0%)	3	NA	NA
WP_172614069.1|1102944_1104846_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	7.3e-26
WP_000253838.1|1105582_1107031_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|1107020_1107704_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 92
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1110974	1114118	4850975		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|1110974_1114118_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 93
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1126403	1132446	4850975		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|1126403_1130285_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|1130500_1131634_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|1131630_1132446_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 94
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1146993	1148816	4850975		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|1146993_1147623_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029825.1|1147595_1148816_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 95
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1151999	1154114	4850975		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1151999_1153565_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|1153685_1154114_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 96
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1169538	1170185	4850975		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1169538_1169748_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|1169801_1170185_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 97
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1174999	1177438	4850975		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1174999_1176211_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|1176349_1177438_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 98
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1184448	1187031	4850975	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|1184448_1187031_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 99
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1193970	1197503	4850975		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|1193970_1195641_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|1195724_1196660_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1196777_1197503_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 100
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1203386	1204427	4850975		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1203386_1204427_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 101
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1208561	1210226	4850975		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1208561_1210226_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 102
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1214992	1218871	4850975	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|1214992_1216939_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|1217206_1218871_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 103
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1223151	1223916	4850975		Mycobacterium_phage(100.0%)	1	NA	NA
WP_063091668.1|1223151_1223916_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	2.0e-06
>prophage 104
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1232946	1238927	4850975		Bacillus_phage(33.33%)	4	NA	NA
WP_000186076.1|1232946_1233624_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|1233620_1236305_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|1236297_1236870_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|1236878_1238927_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
>prophage 105
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1247437	1250487	4850975		Hokovirus(50.0%)	2	NA	NA
WP_063091339.1|1247437_1248856_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|1249005_1250487_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 106
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1253865	1254657	4850975		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|1253865_1254657_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 107
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1290834	1294354	4850975		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1290834_1291554_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|1291550_1292492_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|1292605_1292986_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|1293301_1294354_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 108
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1298707	1305281	4850975		Tupanvirus(33.33%)	7	NA	NA
WP_134894362.1|1298707_1299724_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.0	1.5e-81
WP_000096869.1|1299984_1301457_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|1301524_1302313_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1302441_1302591_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|1302757_1303531_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1303530_1304220_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|1304222_1305281_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 109
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1315084	1362005	4850975	terminase,integrase,capsid,protease,lysis,portal,tail,head	Enterobacteria_phage(52.38%)	68	1314997:1315011	1365149:1365163
1314997:1315011	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533642.1|1315084_1316155_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|1316132_1316351_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545735.1|1316390_1316558_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	1.3e-27
WP_000022062.1|1316646_1316928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274536.1|1317042_1317711_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.1	1.4e-51
WP_000763367.1|1318124_1318346_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_077630180.1|1318444_1318726_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_024225579.1|1318736_1318928_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682298.1|1318900_1319083_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	8.2e-28
WP_000186782.1|1319079_1319760_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.9e-130
WP_024220752.1|1319756_1320542_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995437.1|1320547_1320844_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	2.1e-49
WP_000372941.1|1320918_1321062_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1321030_1321195_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_021534983.1|1321267_1321636_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	5.9e-65
WP_033811687.1|1322607_1323057_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	2.1e-69
WP_000088203.1|1323341_1323614_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438342.1|1323591_1323774_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968517.1|1324050_1324803_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1324799_1325357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096002361.1|1325396_1326092_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_000067727.1|1326165_1326381_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_021534984.1|1326522_1326819_+	phage regulatory protein CII	NA	G9L678	Escherichia_phage	93.9	6.4e-46
WP_000185433.1|1326851_1327751_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788877.1|1327747_1328449_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145931.1|1328445_1328736_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1328809_1329250_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_097301890.1|1329246_1329774_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254223.1|1329770_1329947_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|1329949_1330291_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_032196498.1|1330283_1330478_+	protein ninF	NA	NA	NA	NA	NA
WP_097301891.1|1330497_1330860_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.0	4.7e-59
WP_032084198.1|1330856_1330997_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	4.7e-07
WP_001204791.1|1331082_1331466_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737280.1|1331655_1332753_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|1333325_1333541_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001468348.1|1333545_1333890_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000370550.1|1333855_1334128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992106.1|1334233_1334767_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_021571931.1|1334763_1335222_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	94.1	1.5e-70
WP_016245257.1|1335427_1335916_+	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
WP_000079508.1|1336594_1337005_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_032140586.1|1337062_1337296_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
WP_000453587.1|1337684_1338230_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_032200659.1|1338204_1340130_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1340126_1340333_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_172614072.1|1340329_1341931_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_061358870.1|1341911_1343243_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.3	9.4e-230
WP_172614073.1|1343252_1343585_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.0	4.8e-50
WP_172614074.1|1343640_1344666_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.9	1.1e-185
WP_061358869.1|1344707_1345094_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	4.9e-54
WP_000753007.1|1345105_1345459_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000975081.1|1345470_1346049_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683145.1|1346045_1346441_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001619477.1|1346448_1347189_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	3.0e-129
WP_000479184.1|1347204_1347627_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.5e-69
WP_000459480.1|1347608_1348043_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_172614075.1|1348035_1350615_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.6	0.0e+00
WP_000847379.1|1350611_1350941_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1350940_1351639_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_054626852.1|1351644_1352388_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090873.1|1352324_1352957_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_172614076.1|1353017_1356431_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
WP_172614077.1|1356501_1357101_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	99.5	1.2e-110
WP_172614078.1|1357159_1360648_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	66.4	2.9e-262
WP_172614199.1|1360702_1360840_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.6	8.1e-12
WP_000721870.1|1360934_1361471_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	74.6	1.1e-19
WP_032171300.1|1361486_1362005_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	74.0	6.0e-39
1365149:1365163	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 110
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1365788	1367078	4850975		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|1365788_1367078_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 111
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1373559	1374468	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1373559_1374468_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 112
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1385065	1399877	4850975		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|1385065_1386802_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|1386794_1387790_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1387792_1388464_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|1388692_1390057_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|1390288_1390771_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|1390890_1393041_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_119188173.1|1393068_1394031_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|1394171_1395257_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|1395485_1395746_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|1396010_1396277_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1396350_1397028_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_063502033.1|1397069_1399352_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1399616_1399877_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 113
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1403561	1408784	4850975		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569083.1|1403561_1404284_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|1404280_1404940_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1405078_1405825_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1406228_1406732_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_120795379.1|1408150_1408216_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1408268_1408784_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 114
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1413781	1427210	4850975		Tupanvirus(20.0%)	10	NA	NA
WP_000961458.1|1413781_1415374_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1415614_1416880_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|1417031_1417847_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|1417992_1420425_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|1420430_1421330_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|1421460_1422123_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_063091809.1|1422198_1422948_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	30.6	2.4e-12
WP_000397340.1|1422947_1424183_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|1424386_1425352_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001301279.1|1425338_1427210_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 115
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1438545	1439748	4850975		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1438545_1439748_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 116
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1446256	1534692	4850975	terminase,integrase,capsid,portal,tail,lysis,protease,plate,tRNA,head	Salmonella_phage(58.62%)	88	1443297:1443312	1538404:1538419
1443297:1443312	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000290938.1|1446256_1447288_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
WP_001513672.1|1447476_1447668_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|1447683_1448253_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|1448378_1448600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1448632_1449142_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|1449149_1449446_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|1449563_1449905_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244230.1|1449972_1450206_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752613.1|1450205_1450433_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_038988808.1|1450429_1451287_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	94.0	3.4e-156
WP_172614081.1|1451283_1453698_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
WP_001154434.1|1453850_1454039_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001513124.1|1454049_1454283_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.4e-35
WP_089588522.1|1454563_1455667_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	26.2	5.0e-19
WP_089588521.1|1455663_1456347_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_089588520.1|1456378_1457407_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.9e-170
WP_089588519.1|1457406_1459173_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001554837.1|1459315_1460149_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	5.3e-122
WP_000742511.1|1460165_1461224_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059193.1|1461227_1461878_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000673520.1|1461973_1462438_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1462437_1462641_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1462644_1462860_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069904.1|1462840_1463356_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_172614082.1|1463352_1463781_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.2	2.3e-57
WP_001039945.1|1463876_1464308_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829157.1|1464300_1464747_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_089588518.1|1464815_1465394_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_000177590.1|1465390_1465750_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_154139542.1|1465736_1466645_+|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.0e-142
WP_001086836.1|1466637_1467243_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_172614083.1|1467239_1468742_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	4.7e-153
WP_029697337.1|1470311_1470869_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.4e-86
WP_033551098.1|1471020_1472193_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.1e-202
WP_001207660.1|1472202_1472718_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281004.1|1472772_1473075_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_000763311.1|1473089_1473209_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_172614084.1|1473201_1476279_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_000980413.1|1476275_1476761_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_033551100.1|1476757_1477858_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	1.1e-175
WP_000972391.1|1477948_1478167_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1478402_1480088_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1480357_1480735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|1480764_1481022_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1481181_1481469_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|1482235_1483138_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1483225_1483702_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|1484052_1485165_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1485259_1486393_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|1486402_1487356_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_063501849.1|1487352_1488198_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1488257_1488746_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|1488786_1489914_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|1490112_1490844_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1491134_1491803_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1491802_1492519_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1492525_1493257_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1493274_1494003_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1494220_1494736_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1494861_1495185_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|1495181_1496012_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1496008_1497022_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1497120_1498551_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1498561_1499563_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|1499599_1501318_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|1501450_1502419_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1502430_1504083_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1504226_1505126_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1505620_1506316_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1506741_1508400_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1508396_1509353_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|1509503_1510619_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|1510615_1512562_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001351689.1|1512634_1512859_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1513181_1513502_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934034.1|1513532_1515809_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_001040187.1|1516850_1517069_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241677.1|1517353_1518058_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202201.1|1518099_1519821_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.4e-15
WP_172614085.1|1519821_1521588_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|1521710_1522676_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1523220_1523715_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_172614086.1|1523849_1527878_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1528032_1528644_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1528654_1529998_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1530088_1531381_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|1531619_1534064_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1534074_1534692_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
1538404:1538419	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 117
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1539822	1545551	4850975	transposase	Tetraselmis_virus(66.67%)	5	NA	NA
WP_085959875.1|1539822_1541051_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_172614087.1|1541139_1541565_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190363.1|1541664_1542255_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000111043.1|1542336_1543077_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1543268_1545551_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 118
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1549649	1550738	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|1549649_1550738_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 119
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1555824	1560366	4850975		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1555824_1556109_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1556316_1558581_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1558617_1560366_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 120
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1575071	1586041	4850975	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1575071_1575620_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|1575646_1576294_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1576515_1577706_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|1577890_1578979_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1579581_1580982_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|1581150_1582353_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|1582618_1585231_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|1585273_1586041_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 121
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1601960	1603868	4850975		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|1601960_1603868_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 122
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1616467	1618522	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|1616467_1618522_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 123
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1622755	1623415	4850975	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1622755_1623415_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 124
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1642680	1654995	4850975		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1642680_1642893_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1642903_1643092_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1643066_1643297_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1643286_1643460_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|1643508_1644582_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|1644653_1647398_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|1647480_1648509_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|1648481_1649174_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1649303_1650476_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|1650475_1653022_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209894.1|1653018_1653618_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1653769_1654075_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|1654074_1654995_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 125
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1660077	1662351	4850975		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1660077_1660251_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|1660507_1661836_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|1661856_1662351_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 126
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1678042	1678831	4850975		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|1678042_1678831_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 127
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1686015	1688577	4850975	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409872.1|1686015_1687365_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_087121889.1|1687414_1688577_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 128
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1693809	1694643	4850975		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1693809_1694643_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 129
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1698778	1699312	4850975		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1698778_1699312_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 130
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1708620	1709541	4850975		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1708620_1709541_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 131
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1714201	1714447	4850975		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1714201_1714447_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 132
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1730330	1731272	4850975		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1730330_1731272_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 133
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1743629	1744811	4850975		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1743629_1744364_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1744574_1744811_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 134
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1748083	1749726	4850975		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1748083_1748725_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|1748721_1749726_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 135
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1762032	1762290	4850975		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1762032_1762290_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 136
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1769578	1773319	4850975		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|1769578_1770280_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|1770279_1771524_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1771552_1772464_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|1772479_1773319_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 137
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1776576	1778554	4850975		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1776576_1777434_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1777417_1778554_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 138
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1783575	1867160	4850975	terminase,integrase,capsid,portal,protease,tail,lysis,plate,holin,transposase,tRNA,head	Shigella_phage(42.67%)	95	1788765:1788779	1802472:1802486
WP_000423742.1|1783575_1784946_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1784949_1785591_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1785626_1786733_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1786786_1787248_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1787257_1787911_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032248489.1|1788082_1789333_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
1788765:1788779	attL	TGCACAAAGGCAACA	NA	NA	NA	NA
WP_032248488.1|1789497_1790580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248487.1|1790576_1791227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248486.1|1791291_1792419_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.8	2.7e-121
WP_072002377.1|1792399_1792645_-	excisionase	NA	NA	NA	NA	NA
WP_159186253.1|1792700_1793237_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	96.6	9.4e-96
WP_021518076.1|1793364_1794189_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.7e-149
WP_000135682.1|1794254_1794617_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|1795085_1795520_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549622.1|1795491_1795698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353346.1|1796045_1796738_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.9e-125
WP_001191674.1|1796835_1797096_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_032248483.1|1797088_1797640_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	9.9e-101
WP_001250269.1|1797815_1797995_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|1797984_1798926_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001393497.1|1798922_1799417_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066917.1|1799416_1800070_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210164.1|1800066_1800393_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_016240453.1|1800389_1800779_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.7e-68
WP_159186251.1|1800798_1801608_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.5e-150
WP_172614094.1|1801615_1802605_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.2	9.9e-192
1802472:1802486	attR	TGTTGCCTTTGTGCA	NA	NA	NA	NA
WP_001204747.1|1802622_1802985_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	95.0	2.5e-60
WP_085959875.1|1803794_1805022_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_001120502.1|1805384_1805720_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_172614095.1|1805723_1806200_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	4.6e-86
WP_172614096.1|1806183_1806576_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.0	4.2e-53
WP_000613841.1|1806739_1807309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172614097.1|1807896_1808247_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	1.7e-61
WP_000929175.1|1808372_1808867_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_072011717.1|1809100_1810597_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|1810608_1810791_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_016236636.1|1810790_1812032_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	3.4e-242
WP_001603264.1|1812009_1812660_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	2.1e-118
WP_001603263.1|1812674_1813880_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_001603262.1|1813928_1814129_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_021519686.1|1814131_1814455_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	2.8e-55
WP_000702388.1|1814451_1814862_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|1814836_1815343_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779277.1|1815339_1815900_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	6.8e-105
WP_000497757.1|1815908_1816079_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_172614098.1|1816062_1817559_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	8.5e-272
WP_172614099.1|1817558_1817915_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	2.0e-62
WP_000661047.1|1817914_1818184_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_021519690.1|1818325_1820161_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	2.0e-307
WP_021552267.1|1820221_1821550_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.2	6.7e-244
WP_000999518.1|1821546_1822626_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_021552268.1|1822625_1823174_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.1e-94
WP_000424723.1|1823173_1823599_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_042024505.1|1823585_1824644_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	6.8e-199
WP_021552270.1|1824634_1825219_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.2e-113
WP_172614100.1|1825222_1826149_+	carbohydrate kinase	NA	U5P0I1	Shigella_phage	96.1	4.6e-50
WP_172614101.1|1826148_1826565_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	70.3	2.9e-20
WP_172614102.1|1826825_1827893_-	acyltransferase	NA	NA	NA	NA	NA
WP_000544528.1|1829459_1829765_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_032217964.1|1829751_1830228_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
WP_001228696.1|1830444_1830630_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1830826_1832284_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|1832421_1833213_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204028.1|1833205_1834138_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|1834073_1834325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016242650.1|1834328_1835423_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_000625348.1|1835403_1836705_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001551056.1|1836707_1838114_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_001363932.1|1838097_1839210_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551057.1|1839314_1840079_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
WP_000918487.1|1840177_1841317_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|1841359_1841536_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1841539_1841935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016231725.1|1841934_1842318_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_172614103.1|1842318_1842699_+	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|1842695_1843088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172614104.1|1843114_1844077_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	1.0e-55
WP_122452218.1|1844227_1844587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|1844694_1844895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053290123.1|1845058_1848292_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	1.4e-106
WP_000024051.1|1848284_1848623_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152433.1|1848622_1849321_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	2.1e-127
WP_064221486.1|1849326_1850070_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.8e-150
WP_072664338.1|1849967_1850615_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	3.1e-109
WP_072664238.1|1854139_1854739_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	3.5e-107
WP_172614105.1|1854803_1858109_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	68.1	6.3e-275
WP_077250182.1|1858163_1858280_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_172614106.1|1858584_1859673_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.1	6.1e-17
WP_072643358.1|1860736_1862692_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_000207931.1|1862688_1863810_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_000539894.1|1864521_1864674_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001295666.1|1864776_1865100_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1865640_1865751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1865803_1866208_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1866428_1867160_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 139
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1884644	1886332	4850975		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1884644_1885064_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1885063_1886332_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 140
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1913001	1915753	4850975		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1913001_1914681_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1914805_1915753_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 141
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1918889	1922897	4850975		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1918889_1919972_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456454.1|1919971_1920805_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200373.1|1920801_1921194_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1921197_1922007_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1922042_1922897_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 142
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1925995	1926226	4850975		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|1925995_1926226_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 143
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1937481	1947843	4850975		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1937481_1939020_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1939016_1939727_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1939726_1940404_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1941481_1942324_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362540.1|1942373_1942832_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1942944_1943850_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_172614108.1|1943941_1944955_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1945156_1946065_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1946208_1946622_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068089.1|1947225_1947843_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
>prophage 144
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1956253	1958268	4850975		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1956253_1957267_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1957263_1958268_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 145
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1963681	1964260	4850975		Aeromonas_phage(100.0%)	1	NA	NA
WP_032233336.1|1963681_1964260_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	8.2e-21
>prophage 146
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1974370	1977328	4850975		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983912.1|1974370_1975732_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1975732_1977328_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 147
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1984297	1989589	4850975	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|1984297_1985056_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1985275_1986325_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1986360_1986612_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1986991_1989589_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 148
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	1994513	1995104	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1994513_1995104_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 149
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2002921	2008578	4850975		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|2002921_2004856_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|2004923_2006051_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2006194_2006983_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|2007350_2007704_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|2007771_2008578_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 150
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2021493	2022759	4850975		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|2021493_2022759_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 151
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2036763	2037846	4850975		Indivirus(100.0%)	1	NA	NA
WP_000057985.1|2036763_2037846_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 152
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2054465	2054981	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|2054465_2054981_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 153
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2061307	2068578	4850975	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|2061307_2062540_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2062794_2063778_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2064255_2065629_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|2065757_2066693_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|2066869_2067304_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_172614109.1|2067444_2068578_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.6e-116
>prophage 154
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2073537	2074527	4850975		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|2073537_2074527_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 155
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2078212	2079193	4850975	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_172614110.1|2078212_2079193_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 156
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2115980	2119883	4850975		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|2115980_2119883_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 157
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2123822	2124771	4850975		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|2123822_2124353_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|2124597_2124771_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 158
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2136577	2146751	4850975	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_001468680.1|2136577_2137786_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
WP_071597387.1|2137825_2139040_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429133.1|2139092_2139629_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001301045.1|2139701_2141663_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|2141754_2141985_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2142206_2142383_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2142428_2142845_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760585.1|2142923_2144330_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|2144574_2145720_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220399.1|2145737_2146751_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
>prophage 159
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2153882	2155985	4850975		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|2153882_2155985_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 160
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2160891	2163000	4850975		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103220.1|2160891_2163000_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 161
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2174658	2176203	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|2174658_2176203_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 162
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2183087	2183378	4850975		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2183087_2183378_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 163
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2189747	2191188	4850975		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2189747_2190032_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_071447882.1|2190177_2191188_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	1.1e-23
>prophage 164
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2194461	2196367	4850975		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|2194461_2195388_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|2195380_2196367_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 165
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2200683	2204490	4850975		Klosneuvirus(50.0%)	2	NA	NA
WP_001360132.1|2200683_2203083_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426299.1|2203107_2204490_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 166
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2209764	2212548	4850975		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_001244987.1|2209764_2212548_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 167
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2230021	2231422	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_001472911.1|2230021_2231422_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	1.4e-106
>prophage 168
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2238845	2240381	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194916.1|2238845_2240381_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
>prophage 169
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2257156	2258535	4850975		Klebsiella_phage(50.0%)	3	NA	NA
WP_000273128.1|2257156_2257477_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|2257696_2258131_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2258151_2258535_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 170
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2261537	2262428	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_000592802.1|2261537_2262428_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 171
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2267794	2267998	4850975		Salmonella_phage(100.0%)	1	NA	NA
WP_000214712.1|2267794_2267998_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 172
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2272244	2338644	4850975	terminase,integrase,protease,tail,portal,lysis	Enterobacteria_phage(44.9%)	76	2286813:2286828	2334110:2334125
WP_120795384.1|2272244_2272358_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2272426_2272660_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_172614116.1|2272976_2273567_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.1e-24
WP_072144121.1|2273664_2273784_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_172614202.1|2273838_2277144_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	68.9	4.8e-283
WP_047085523.1|2277208_2277808_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.8e-108
WP_172614117.1|2277874_2281273_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.0	0.0e+00
WP_001399694.1|2281333_2281981_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_088568461.1|2281878_2282622_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.9e-147
WP_119188382.1|2282627_2283326_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.1e-133
WP_000447253.1|2283335_2283665_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001774463.1|2283664_2286730_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_001161009.1|2286701_2287031_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2286813:2286828	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001370402.1|2287039_2287426_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_000211132.1|2287486_2288230_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2288240_2288642_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677127.1|2288638_2289217_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001283153.1|2289228_2289504_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097041.1|2289496_2289820_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|2289906_2291934_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_172614118.1|2291878_2293222_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	4.5e-256
WP_001072975.1|2293385_2293598_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_089607031.1|2293594_2295694_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_000421825.1|2295702_2296242_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|2297571_2297778_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|2298078_2298489_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|2298640_2298814_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2298985_2299141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2299220_2299286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2299288_2299477_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2299487_2299700_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2300062_2300560_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000189915.1|2301862_2302174_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2302178_2302394_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2303148_2303364_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2303664_2303877_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2303931_2304021_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2304298_2305051_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_021542125.1|2305064_2306114_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.0	3.7e-112
WP_032150113.1|2306115_2306394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021542126.1|2306460_2306712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119188399.1|2306928_2307141_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.0e-29
WP_172614203.1|2307547_2308747_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_172614119.1|2309469_2310615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089557800.1|2310908_2311310_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.2	7.8e-63
WP_000054487.1|2311350_2312316_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705387.1|2312296_2312818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921592.1|2312801_2313029_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381213.1|2313109_2313517_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000379589.1|2313684_2313840_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344950.1|2313841_2314417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2314903_2315092_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2315088_2315280_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_172614120.1|2315373_2317845_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2317917_2318169_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876982.1|2318203_2319484_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_001389342.1|2319485_2319614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2319671_2320691_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2320702_2321917_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2322122_2322449_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2322583_2322925_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2322959_2323520_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2323522_2324233_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2324340_2324646_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_172614121.1|2324844_2326302_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	6.7e-120
WP_172614122.1|2327107_2328097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172614123.1|2328180_2328672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044068512.1|2328989_2329487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089569706.1|2329476_2329992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018629.1|2330437_2330905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172614124.1|2331340_2332927_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_172614125.1|2332909_2334019_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.1	1.4e-85
WP_001340362.1|2334079_2336503_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
2334110:2334125	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_000213028.1|2336513_2337131_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|2337132_2337987_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2338029_2338644_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 173
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2356405	2357707	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|2356405_2357707_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 174
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2367783	2369595	4850975		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2367783_2369595_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 175
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2389471	2390746	4850975	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2389471_2390746_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 176
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2397657	2399156	4850975		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2397657_2398179_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2398259_2399156_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 177
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2407958	2416839	4850975		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2407958_2408774_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2408901_2409483_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701044.1|2409717_2410887_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2411052_2411142_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2411440_2412466_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2412462_2413395_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|2413507_2414719_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2415009_2416158_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2416197_2416839_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 178
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2422343	2424610	4850975		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|2422343_2423156_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|2423159_2423945_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|2423941_2424610_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 179
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2432899	2437983	4850975		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|2432899_2434120_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|2434116_2435388_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|2435362_2436109_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000089364.1|2436118_2437606_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2437614_2437983_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 180
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2456627	2476167	4850975	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001336282.1|2456627_2458274_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.9e-31
WP_000069375.1|2458330_2460709_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2461041_2461875_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2462031_2463078_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2463209_2463401_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|2463404_2464841_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|2464903_2465617_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2465863_2466328_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|2466405_2467155_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|2467154_2467706_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_094318934.1|2467768_2468749_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2468849_2469149_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2469153_2471541_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2471555_2472539_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2472822_2472867_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2472989_2473346_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2473398_2473596_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2473692_2474235_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2474238_2476167_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 181
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2487463	2489725	4850975		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|2487463_2489725_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 182
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2496054	2496882	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|2496054_2496882_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 183
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2504358	2505579	4850975		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|2504358_2505579_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 184
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2512343	2512997	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|2512343_2512997_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 185
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2518595	2520557	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2518595_2520557_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 186
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2525483	2529569	4850975		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|2525483_2526125_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_001300835.1|2526217_2527576_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2527693_2528452_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_172614135.1|2528588_2529569_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 187
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2539156	2540011	4850975		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|2539156_2540011_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 188
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2543329	2547906	4850975		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|2543329_2544613_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616431.1|2544759_2546235_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766131.1|2546415_2547906_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
>prophage 189
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2563212	2571318	4850975	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2563212_2564898_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2565102_2565684_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|2565723_2566419_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2566476_2568387_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2568518_2568863_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2569224_2569584_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2569703_2569883_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|2569956_2571318_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 190
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2575180	2576737	4850975		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2575180_2576737_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 191
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2582377	2582587	4850975		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2582377_2582587_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 192
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2587917	2589966	4850975		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|2587917_2589966_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 193
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2597462	2601932	4850975		Escherichia_phage(33.33%)	7	NA	NA
WP_000812732.1|2597462_2598119_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|2598514_2598856_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|2598868_2599741_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2599744_2600119_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2600257_2600488_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_097721639.1|2600589_2601246_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|2601269_2601932_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 194
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2609988	2611464	4850975		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|2609988_2611464_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 195
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2615462	2622526	4850975		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2615462_2616785_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2616800_2617733_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2617811_2618567_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2618563_2619349_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2619495_2620506_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580327.1|2620514_2621126_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|2621264_2621330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024904.1|2621400_2622003_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2622004_2622526_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 196
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2626544	2631737	4850975		Escherichia_coli_phage(33.33%)	4	NA	NA
WP_000639268.1|2626544_2627039_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	3.0e-72
WP_172614137.1|2627091_2628615_+	recombinase family protein	NA	NA	NA	NA	NA
WP_172614138.1|2628611_2629400_-	hypothetical protein	NA	A0A0A0RK63	Escherichia_phage	77.6	4.9e-77
WP_172614139.1|2629556_2631737_-	tape measure protein	NA	A0A2I6PGW5	Salmonella_phage	31.7	4.0e-60
>prophage 197
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2638815	2639559	4850975		Synechococcus_phage(100.0%)	1	NA	NA
WP_000019588.1|2638815_2639559_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 198
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2646175	2647909	4850975	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2646175_2647909_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 199
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2653161	2658799	4850975		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2653161_2653551_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2653565_2654615_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204342.1|2654617_2655478_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_172614143.1|2655496_2657092_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.9e-14
WP_001297437.1|2657137_2658799_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 200
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2669662	2671177	4850975		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|2669662_2671177_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 201
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2683168	2683921	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|2683168_2683921_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 202
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2695721	2696390	4850975		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|2695721_2696390_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 203
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2710408	2720608	4850975		Bacillus_phage(40.0%)	8	NA	NA
WP_113415300.1|2710408_2712103_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2712340_2712523_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2712601_2713519_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212236.1|2713691_2714612_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|2714600_2715071_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157257.1|2715051_2716470_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.5	1.1e-100
WP_000826783.1|2718578_2719937_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001340597.1|2719936_2720608_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
>prophage 204
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2725797	2750351	4850975	integrase	Bacillus_phage(40.0%)	8	2718245:2718259	2740326:2740340
2718245:2718259	attL	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_000480163.1|2725797_2727060_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_000703041.1|2727253_2728558_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_172614146.1|2728585_2729866_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654453.1|2729858_2731661_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_001317926.1|2731647_2733360_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.3	1.0e-31
WP_000140405.1|2733616_2734576_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_172614147.1|2734766_2740772_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.9e-33
2740326:2740340	attR	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_113415167.1|2740859_2750351_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 205
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2777968	2779196	4850975	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085959875.1|2777968_2779196_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
>prophage 206
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2788561	2790940	4850975	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001775131.1|2788561_2790163_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.6	2.8e-260
WP_000609174.1|2790212_2790560_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|2790556_2790940_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 207
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2800663	2802822	4850975		Yersinia_phage(33.33%)	4	NA	NA
WP_016230726.1|2800663_2801485_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	2.7e-46
WP_000860081.1|2801566_2802046_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
WP_001186773.1|2802061_2802538_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2802600_2802822_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 208
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2807164	2808331	4850975		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|2807164_2808331_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 209
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2814086	2814986	4850975		Cellulophaga_phage(100.0%)	1	NA	NA
WP_097768782.1|2814086_2814986_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 210
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2823489	2838330	4850975		uncultured_virus(16.67%)	10	NA	NA
WP_172614150.1|2823489_2827131_-	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	29.6	1.5e-22
WP_113415278.1|2827133_2828411_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000120467.1|2828410_2829625_-	O8 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	4.1e-14
WP_001308747.1|2829624_2830419_-	O8 family O-antigen ABC transporter permease subunit Wzm	NA	NA	NA	NA	NA
WP_000192839.1|2830420_2831797_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	26.4	1.1e-31
WP_000926402.1|2831820_2833236_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.3e-55
WP_000088884.1|2833517_2833802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119188285.1|2834385_2835363_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_113415280.1|2835508_2836675_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	2.2e-113
WP_000043458.1|2836923_2838330_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 211
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2844823	2847286	4850975		Bacillus_phage(50.0%)	2	NA	NA
WP_113415284.1|2844823_2845717_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	3.9e-46
WP_113415285.1|2845891_2847286_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
>prophage 212
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2853082	2859964	4850975		Bacillus_phage(25.0%)	6	NA	NA
WP_001314854.1|2853082_2854453_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000083412.1|2854733_2856170_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.4	2.5e-47
WP_119188281.1|2856172_2857396_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|2857392_2857872_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043615.1|2857874_2858840_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	3.8e-87
WP_000048190.1|2858842_2859964_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 213
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2864327	2874754	4850975		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654513.1|2864327_2865167_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
WP_119188276.1|2865295_2867458_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2867460_2867904_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2867909_2869049_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000454701.1|2869707_2871291_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_119188275.1|2871564_2873418_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2873439_2874021_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001369718.1|2874112_2874754_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 214
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2879479	2880832	4850975		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|2879479_2880832_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 215
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2894680	2900787	4850975	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675150.1|2894680_2896084_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2896080_2896803_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2896993_2897326_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2897472_2898834_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|2899164_2899482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2899887_2900787_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 216
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2910007	2913564	4850975		Serratia_phage(50.0%)	4	NA	NA
WP_000846222.1|2910007_2911012_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000011997.1|2911008_2911974_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2911947_2912694_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2912745_2913564_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 217
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2924212	2926246	4850975	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|2924212_2926246_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 218
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2937878	2947318	4850975		Enterobacteria_phage(83.33%)	9	NA	NA
WP_172614153.1|2937878_2939015_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	6.5e-163
WP_001295429.1|2941135_2941597_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2941636_2942107_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2942153_2942873_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2942869_2944555_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2944776_2945508_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2945567_2945675_+	protein YohO	NA	NA	NA	NA	NA
WP_119188370.1|2945655_2946387_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_061350461.1|2946391_2947318_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 219
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2968499	2970020	4850975		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2968499_2970020_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 220
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2973714	2977500	4850975		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2973714_2974383_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2974640_2975477_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|2975508_2977500_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 221
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2981570	2982428	4850975		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|2981570_2982428_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 222
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	2996975	3001276	4850975		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091940.1|2996975_2998442_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198828.1|2998559_2999546_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|2999584_3000298_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_119188232.1|3000709_3001276_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 223
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3007030	3014678	4850975		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|3007030_3008620_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|3008623_3008968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|3009300_3010491_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_172614156.1|3010518_3011214_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|3011362_3013123_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|3013247_3013532_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|3013670_3014678_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 224
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3026552	3027170	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|3026552_3027170_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 225
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3036503	3042281	4850975		Bacillus_phage(25.0%)	5	NA	NA
WP_000422182.1|3036503_3038147_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884971.1|3038222_3038873_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000710375.1|3038872_3039937_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406064.1|3040010_3041066_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865568.1|3041177_3042281_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 226
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3046558	3051401	4850975		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|3046558_3049408_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|3049574_3051401_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 227
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3066324	3068952	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|3066324_3068952_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 228
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3074396	3080543	4850975		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|3074396_3076682_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|3076915_3078046_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|3078045_3078300_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|3078353_3079004_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_172614159.1|3079466_3080543_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 229
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3086435	3090946	4850975	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|3086435_3087335_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|3087347_3087533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119188229.1|3087573_3088377_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|3088394_3089684_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|3089740_3090946_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 230
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3094549	3099553	4850975		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|3094549_3095152_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|3095459_3096599_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|3096602_3097571_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|3097570_3099553_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 231
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3138393	3141621	4850975		Salmonella_phage(50.0%)	3	NA	NA
WP_172614160.1|3138393_3138993_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	2.0e-06
WP_001012899.1|3139051_3140884_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|3140970_3141621_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 232
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3152180	3154041	4850975		Sodalis_phage(50.0%)	2	NA	NA
WP_088213364.1|3152180_3153071_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	52.7	8.9e-67
WP_001293613.1|3153267_3154041_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 233
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3158252	3159770	4850975		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3158252_3159770_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 234
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3166246	3167383	4850975		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|3166246_3167383_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 235
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3175919	3177005	4850975		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|3175919_3177005_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 236
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3194832	3197234	4850975	integrase	Enterobacteria_phage(100.0%)	2	3192807:3192823	3204791:3204807
3192807:3192823	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3194832_3195765_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_113415172.1|3196076_3197234_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.7	3.1e-221
3204791:3204807	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 237
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3201483	3202434	4850975		Shigella_phage(100.0%)	1	NA	NA
WP_119188413.1|3201483_3202434_-	DNA transfer domain protein	NA	Q716G2	Shigella_phage	99.4	3.3e-168
>prophage 238
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3208979	3216556	4850975		Bacillus_phage(50.0%)	4	NA	NA
WP_001355656.1|3208979_3212573_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_001296867.1|3212628_3213774_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3213847_3214792_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|3214861_3216556_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 239
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3220250	3221171	4850975		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3220250_3221171_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 240
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3224989	3225724	4850975		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3224989_3225724_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 241
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3251407	3264061	4850975		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|3251407_3253423_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|3253493_3254480_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3254709_3255471_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3255655_3256627_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3257010_3257268_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|3257312_3259040_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|3259080_3259590_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|3259632_3260484_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|3260588_3260963_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|3260995_3261730_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|3261918_3262830_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|3262963_3264061_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
>prophage 242
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3267078	3267870	4850975		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|3267078_3267870_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 243
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3271348	3276468	4850975		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|3271348_3272653_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|3272892_3273792_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|3273887_3274463_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|3274523_3274973_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|3274959_3275385_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|3275598_3276468_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 244
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3295122	3296073	4850975		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3295122_3296073_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 245
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3313375	3314089	4850975		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3313375_3314089_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 246
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3335173	3339175	4850975		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3335173_3336463_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3336548_3337175_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|3337499_3338537_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|3338536_3339175_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 247
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3345421	3351906	4850975		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|3345421_3345574_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3345591_3345783_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3346095_3346614_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|3346629_3347169_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|3347261_3348839_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3348907_3350374_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|3350535_3351906_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 248
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3360736	3361168	4850975		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3360736_3361168_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 249
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3371378	3377716	4850975		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133591.1|3371378_3372662_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|3372720_3372921_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124474.1|3372932_3373268_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3373269_3375120_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3375136_3375652_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3375747_3376071_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3376087_3376474_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3376501_3377716_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 250
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3392853	3394365	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|3392853_3394365_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	2.4e-11
>prophage 251
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3400257	3411547	4850975		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3400257_3401511_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_119188196.1|3401838_3403029_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717691.1|3403073_3403412_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|3403472_3404807_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3404796_3405510_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001351828.1|3405674_3407102_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_119188197.1|3407659_3411547_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 252
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3415666	3415927	4850975		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3415666_3415927_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 253
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3419386	3423129	4850975		Tetraselmis_virus(50.0%)	3	NA	NA
WP_172614165.1|3419386_3420067_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	38.9	1.6e-20
WP_000002542.1|3420339_3421314_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3421329_3423129_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 254
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3428900	3435159	4850975	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3428900_3430235_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001351830.1|3430443_3431325_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3431427_3432015_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3432070_3432454_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3432758_3433448_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3433495_3434533_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3434739_3435159_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 255
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3440452	3441751	4850975		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3440452_3441751_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 256
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3447612	3450186	4850975		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3447612_3450186_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 257
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3456092	3457163	4850975		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|3456092_3457163_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 258
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3471572	3472055	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3471572_3472055_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 259
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3477705	3477924	4850975		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|3477705_3477924_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 260
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3487375	3491427	4850975		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|3487375_3488656_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|3488893_3490294_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3490314_3490977_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3490977_3491427_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 261
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3495363	3500658	4850975		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3495363_3495609_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3495605_3496016_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|3495988_3498133_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|3498142_3499102_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|3499455_3500658_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 262
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3513842	3519228	4850975	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3513842_3514028_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|3514262_3516893_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|3517020_3517521_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3517589_3518651_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3518730_3519228_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 263
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3524694	3525660	4850975		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3524694_3525660_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 264
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3533135	3534146	4850975		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|3533135_3534146_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 265
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3551974	3565157	4850975		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|3551974_3554536_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|3554641_3555298_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3555348_3556116_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3556311_3557220_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3557216_3558479_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3558475_3559114_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3559118_3559895_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3559983_3561348_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3561441_3562434_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3562496_3563636_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3563775_3564402_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3564395_3565157_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 266
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3568269	3570302	4850975		Tupanvirus(50.0%)	2	NA	NA
WP_001173676.1|3568269_3568875_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090386.1|3568874_3570302_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
>prophage 267
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3594990	3595776	4850975		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|3594990_3595776_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 268
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3600435	3605356	4850975		Vibrio_phage(33.33%)	4	NA	NA
WP_096282548.1|3600435_3601107_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	1.9e-13
WP_001268460.1|3601400_3602273_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3602332_3603631_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3603718_3605356_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 269
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3609388	3613503	4850975		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|3609388_3610690_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|3610746_3613503_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 270
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3621037	3621886	4850975		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|3621037_3621886_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 271
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3626744	3627500	4850975		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3626744_3627500_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 272
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3639026	3654574	4850975	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|3639026_3640232_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|3640231_3640675_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_096215860.1|3640725_3641532_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000678646.1|3641770_3642868_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3643446_3644700_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3644931_3646263_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|3646324_3648151_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001285993.1|3648150_3651693_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_172614168.1|3651685_3654574_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	1.4e-68
>prophage 273
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3660050	3666823	4850975		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3660050_3660845_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3660851_3661727_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|3661877_3664124_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3664136_3664667_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|3665351_3666041_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3666109_3666823_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 274
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3676453	3678948	4850975		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3676453_3677872_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|3678186_3678948_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 275
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3703248	3704004	4850975		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|3703248_3704004_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 276
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3728463	3743856	4850975	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3728463_3729864_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|3729881_3731198_+	guanine deaminase	NA	NA	NA	NA	NA
WP_172614170.1|3731233_3732601_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	72.8	4.7e-160
WP_000838428.1|3732636_3733125_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|3733124_3735044_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3735479_3736928_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3736929_3737055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3737051_3737123_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192820.1|3737177_3737726_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3737769_3739287_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3739296_3740395_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813200.1|3740485_3742219_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715214.1|3742224_3742935_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3742959_3743856_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 277
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3747780	3753154	4850975		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|3747780_3749214_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|3749270_3750014_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195062.1|3750280_3753154_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 278
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3761290	3762523	4850975		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3761290_3762523_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 279
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3786025	3845867	4850975	transposase,protease,integrase,tRNA	Pseudomonas_phage(37.5%)	57	3797788:3797803	3848582:3848597
WP_001319878.1|3786025_3786784_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3786989_3787910_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|3788047_3790024_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3790032_3790164_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3790299_3790515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3790818_3791973_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3792396_3793791_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|3793867_3794365_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3794459_3795167_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|3795246_3795978_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3795990_3796941_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3797049_3797613_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3797612_3798029_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
3797788:3797803	attL	TCGGTTTGCCGCTGAA	NA	NA	NA	NA
WP_001326494.1|3798212_3799193_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3799210_3799915_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3799932_3800499_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|3800495_3800786_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|3800793_3801387_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|3801379_3802516_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745244.1|3802670_3803678_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|3803794_3804841_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3805016_3805736_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3805919_3806246_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3806245_3806965_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3807125_3808178_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3808205_3808481_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3808545_3809625_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|3809826_3811083_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839760.1|3811132_3813268_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234517.1|3813665_3814373_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_023293471.1|3815281_3815869_+	hypothetical protein	NA	O21975	Escherichia_phage	57.5	3.4e-59
WP_023892874.1|3816215_3817400_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_032165636.1|3817454_3817811_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_053266158.1|3817860_3819774_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.1	1.1e-16
WP_172614172.1|3819859_3821038_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	31.1	7.5e-21
WP_042111456.1|3821485_3821839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096998795.1|3821831_3822263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096998794.1|3822310_3822739_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_000286078.1|3822797_3823262_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_000113424.1|3823240_3823480_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017382952.1|3823557_3823941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063615036.1|3824084_3824834_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_000172688.1|3824936_3825650_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_172614173.1|3825708_3826020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160384670.1|3826093_3827959_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_172614174.1|3828162_3828378_+	type I restriction-modification system subunit M N-terminal domain-containing protein	NA	A0A2H4PQP4	Staphylococcus_phage	58.5	4.5e-09
WP_001313273.1|3829436_3829544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089581225.1|3829552_3829738_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_172614175.1|3829908_3831225_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_029397907.1|3832719_3834063_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_172614176.1|3834980_3836339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357807.1|3836345_3837053_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000777276.1|3837056_3838160_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000019446.1|3838714_3839695_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	4.4e-184
WP_001389182.1|3840622_3841360_-	porin family protein	NA	NA	NA	NA	NA
WP_172614206.1|3842740_3844249_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	5.6e-45
WP_038989268.1|3844790_3845867_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
3848582:3848597	attR	TTCAGCGGCAAACCGA	NA	NA	NA	NA
>prophage 280
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3879963	3881136	4850975		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|3879963_3881136_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 281
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3903346	3904231	4850975		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3903346_3904231_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 282
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3910307	3919658	4850975		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|3910307_3911135_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|3911334_3912261_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3912311_3912569_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_119188185.1|3912611_3914831_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	5.1e-103
WP_000059388.1|3914941_3916354_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|3916428_3917166_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3917399_3919658_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 283
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3922968	3923361	4850975		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3922968_3923361_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 284
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3927188	3938151	4850975		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3927188_3929081_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3929109_3929691_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444752.1|3929690_3930518_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3930542_3930965_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917138.1|3930965_3931595_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000735278.1|3931799_3933281_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3933428_3934100_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3934105_3935266_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001320780.1|3935303_3936092_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3936234_3937008_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3937065_3937236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3937497_3938151_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 285
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3947668	3949102	4850975		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3947668_3949102_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 286
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3954239	3955478	4850975	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3954239_3955478_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 287
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3961878	3978074	4850975	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|3961878_3962892_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3963129_3963345_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3963455_3965201_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|3965395_3967237_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3967315_3967822_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|3968075_3968840_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3969127_3969751_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094721.1|3969904_3971425_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001301395.1|3971842_3973222_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000450594.1|3973263_3973596_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3973814_3974798_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|3974981_3978074_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 288
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	3990928	3991894	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3990928_3991894_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 289
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4012472	4014767	4850975		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4012472_4014767_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 290
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4022973	4024119	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|4022973_4024119_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 291
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4047128	4054922	4850975		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|4047128_4047989_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249100.1|4048053_4050090_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|4050047_4050443_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|4050462_4051053_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|4051062_4051638_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|4051751_4052792_-	permease	NA	NA	NA	NA	NA
WP_119188189.1|4052864_4053500_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|4053627_4054146_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|4054125_4054569_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|4054619_4054922_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 292
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4060624	4062514	4850975		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4060624_4062514_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 293
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4067995	4074634	4850975		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|4067995_4070668_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|4070692_4072180_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4072207_4072660_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|4073290_4074634_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 294
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4078716	4081589	4850975	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4078716_4079565_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4079654_4081589_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 295
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4088363	4089842	4850975		Indivirus(50.0%)	2	NA	NA
WP_172614180.1|4088363_4089335_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4089563_4089842_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 296
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4093910	4108705	4850975		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4093910_4094720_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|4094929_4095907_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4095920_4096907_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|4096927_4097494_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4097490_4098066_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4098034_4098592_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4098598_4099324_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|4099371_4100805_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4100827_4101115_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|4101232_4101724_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4101769_4102624_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4102620_4102893_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|4103106_4103739_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|4103735_4104464_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|4104460_4105114_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4105343_4107680_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4107775_4108705_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 297
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4116199	4120569	4850975		Salmonella_phage(50.0%)	5	NA	NA
WP_119188338.1|4116199_4116949_+	YhcG family protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	3.5e-72
WP_000979882.1|4117008_4117473_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|4117469_4118345_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|4118341_4119031_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|4119078_4120569_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 298
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4124273	4124771	4850975	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|4124273_4124771_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 299
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4128737	4131262	4850975	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|4128737_4130105_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4130194_4131262_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 300
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4148038	4149082	4850975		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4148038_4149082_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 301
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4159647	4166188	4850975		Ostreococcus_lucimarinus_virus(33.33%)	6	NA	NA
WP_172614181.1|4159647_4160532_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	31.3	1.1e-24
WP_000825639.1|4161382_4161604_+	membrane protein	NA	NA	NA	NA	NA
WP_000738568.1|4162034_4163060_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|4163127_4164309_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|4164318_4165422_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|4165429_4166188_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 302
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4176683	4178155	4850975	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4176683_4177193_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|4177207_4178155_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 303
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4199370	4201323	4850975		Vibrio_phage(100.0%)	1	NA	NA
WP_024184641.1|4199370_4201323_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 304
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4210153	4218712	4850975		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|4210153_4212847_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|4213138_4214323_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4214393_4216508_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4216604_4217075_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4217171_4217546_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|4217671_4217959_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|4217966_4218326_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|4218325_4218712_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 305
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4224282	4233823	4850975		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4224282_4226196_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|4226195_4227218_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4227211_4227430_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4227483_4228353_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4228407_4228812_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4229113_4229746_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4229796_4231887_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|4231953_4233174_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|4233259_4233823_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 306
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4257910	4258747	4850975		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4257910_4258747_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 307
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4275651	4279418	4850975		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|4275651_4277274_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|4277349_4278702_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4278698_4279418_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 308
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4285981	4286860	4850975		Sodalis_phage(100.0%)	1	NA	NA
WP_000039072.1|4285981_4286860_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 309
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4292894	4295288	4850975		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081908.1|4292894_4295288_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 310
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4299667	4300894	4850975		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|4299667_4300894_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 311
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4306949	4309397	4850975		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4306949_4309397_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 312
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4329408	4331219	4850975		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073599.1|4329408_4330152_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
WP_000907792.1|4330148_4331219_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 313
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4334760	4336243	4850975		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416900.1|4334760_4335474_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082098.1|4335475_4336243_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 314
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4341977	4344796	4850975		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4341977_4342832_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4343076_4344135_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4344127_4344796_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 315
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4347802	4351934	4850975		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4347802_4348429_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106551.1|4348502_4350701_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|4350802_4351048_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|4351268_4351934_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 316
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4359827	4365479	4850975		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|4359827_4360634_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4360639_4361041_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_172614186.1|4361243_4365479_+	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 317
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4368854	4371590	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_172614187.1|4368854_4371590_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	7.1e-22
>prophage 318
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4385179	4387222	4850975		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|4385179_4387222_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 319
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4390567	4392702	4850975		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|4390567_4390921_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|4390974_4392264_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|4392276_4392702_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 320
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4396095	4396743	4850975		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4396095_4396743_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 321
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4442704	4444689	4850975		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|4442704_4443709_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4443705_4444689_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 322
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4454901	4457235	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|4454901_4457235_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 323
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4460889	4462890	4850975	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|4460889_4461102_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135738.1|4461289_4461442_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|4461521_4462890_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 324
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4466728	4467724	4850975		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|4466728_4467724_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 325
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4473042	4474584	4850975		Staphylococcus_phage(100.0%)	1	NA	NA
WP_063091756.1|4473042_4474584_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 326
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4499634	4509783	4850975	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582468.1|4499634_4501479_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|4501475_4502867_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|4502964_4503573_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_172614191.1|4503800_4507934_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000072850.1|4507954_4508797_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000887058.1|4508844_4509783_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
>prophage 327
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4525807	4536535	4850975		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|4525807_4526059_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4526200_4526632_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001350558.1|4526876_4528421_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4528430_4529714_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|4529717_4530677_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982115.1|4530663_4531698_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|4531936_4532962_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|4532971_4534168_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|4534442_4535300_-	protein YibB	NA	NA	NA	NA	NA
WP_000587760.1|4535602_4536535_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
>prophage 328
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4539934	4542028	4850975		Catovirus(50.0%)	2	NA	NA
WP_000064004.1|4539934_4540918_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364795.1|4541002_4542028_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 329
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4549466	4554029	4850975		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|4549466_4549946_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|4549984_4550794_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4550891_4551059_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4551079_4551316_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|4551532_4552201_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|4552372_4553593_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|4553570_4554029_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 330
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4557402	4564152	4850975		Morganella_phage(33.33%)	5	NA	NA
WP_001300958.1|4557402_4558227_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|4558517_4559135_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001295237.1|4561071_4561695_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4561749_4562025_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4562043_4564152_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 331
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4568588	4569980	4850975		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4568588_4569980_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 332
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4576122	4585895	4850975	integrase	Enterobacteria_phage(100.0%)	12	4575940:4575962	4586373:4586395
4575940:4575962	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_033802717.1|4576122_4577319_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	90.2	4.2e-205
WP_033802716.1|4577279_4578098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052908771.1|4578097_4578943_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_052908772.1|4579400_4579973_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	9.0e-97
WP_000984201.1|4579987_4580233_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_075034272.1|4580229_4580964_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	1.5e-128
WP_001149160.1|4581509_4581776_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_089567603.1|4581772_4582363_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_172614192.1|4582355_4582643_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	1.6e-46
WP_000459320.1|4582635_4583091_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000856729.1|4583226_4583547_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_172614193.1|4583561_4585895_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.2	0.0e+00
4586373:4586395	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 333
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4592531	4593866	4850975		Moraxella_phage(100.0%)	1	NA	NA
WP_002431302.1|4592531_4593866_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
>prophage 334
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4601172	4608200	4850975	transposase	Micromonas_sp._RCC1109_virus(20.0%)	10	NA	NA
WP_172614194.1|4601172_4602861_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	5.4e-57
WP_001300753.1|4602966_4603065_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4603629_4603719_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4603998_4605183_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4605190_4605688_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4605684_4606047_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4606036_4606384_-	YidH family protein	NA	NA	NA	NA	NA
WP_001705161.1|4606553_4607762_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	1.3e-206
WP_001342382.1|4607831_4607954_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
WP_000348572.1|4607954_4608200_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	63.3	1.3e-23
>prophage 335
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4614134	4615088	4850975		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4614134_4614563_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4614674_4615088_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 336
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4625338	4632707	4850975		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4625338_4627753_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4627781_4628855_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4628854_4629955_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4629959_4631363_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4631659_4631740_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4631969_4632110_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4632126_4632486_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4632449_4632707_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 337
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4642905	4644243	4850975		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|4642905_4644243_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 338
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4656007	4663615	4850975		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4656007_4656781_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4656963_4657854_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4657853_4658813_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4658899_4659940_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|4660253_4662083_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|4662244_4663615_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 339
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4675569	4676562	4850975		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|4675569_4676562_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 340
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4679730	4685583	4850975		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4679730_4681599_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|4681765_4682185_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|4682192_4683698_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4683702_4684668_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4684692_4685583_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 341
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4698975	4700622	4850975		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|4698975_4700622_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 342
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4709095	4714507	4850975		Bacillus_phage(33.33%)	4	NA	NA
WP_001238884.1|4709095_4711117_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
WP_001299253.1|4711163_4712648_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4712781_4714047_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4714177_4714507_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 343
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4718549	4724693	4850975		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|4718549_4719680_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|4719676_4720939_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226602.1|4720938_4722006_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000676056.1|4722024_4722906_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|4722883_4723558_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|4723562_4724693_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 344
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4732777	4734433	4850975		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|4732777_4734433_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 345
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4744742	4748601	4850975		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4744742_4745639_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4745638_4746355_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4746438_4748601_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 346
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4754319	4756149	4850975		Catovirus(100.0%)	1	NA	NA
WP_001395096.1|4754319_4756149_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 347
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4768672	4771959	4850975		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_172614197.1|4768672_4770313_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001351992.1|4770391_4770661_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4770664_4771180_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4771182_4771959_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 348
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4780840	4781455	4850975		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4780840_4781455_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 349
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4795302	4798089	4850975		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|4795302_4798089_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 350
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4802203	4804674	4850975		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4802203_4803613_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4803624_4804674_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 351
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4813645	4816425	4850975		Staphylococcus_phage(50.0%)	3	NA	NA
WP_119188267.1|4813645_4814542_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	3.6e-60
WP_000621647.1|4814709_4815606_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4815639_4816425_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 352
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4823742	4826793	4850975		Escherichia_phage(100.0%)	1	NA	NA
WP_077249888.1|4823742_4826793_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 353
NZ_CP053787	Escherichia coli isolate J31 chromosome, complete genome	4850975	4841780	4850714	4850975	integrase	Escherichia_phage(30.0%)	13	4837177:4837189	4849440:4849452
4837177:4837189	attL	CGGCGCATAGCTG	NA	NA	NA	NA
WP_000122641.1|4841780_4842401_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|4842660_4843644_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4843792_4844467_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4844572_4845946_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4845942_4846641_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4846790_4847291_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|4847477_4848458_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4848527_4848821_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4848957_4849230_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4849399_4849900_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
4849440:4849452	attR	CAGCTATGCGCCG	NA	NA	NA	NA
WP_000557703.1|4849963_4850188_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|4850187_4850490_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|4850489_4850714_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
>prophage 1
NZ_CP053788	Escherichia coli isolate J31 plasmid pJ31, complete sequence	108661	2508	49652	108661	integrase,transposase	Salmonella_phage(11.11%)	58	3394:3409	37365:37380
WP_000198533.1|2508_3717_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
3394:3409	attL	GGTGAAGACCAGGTGC	NA	NA	NA	NA
WP_000019163.1|3697_3970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|6464_7025_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|7200_7551_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|7753_8767_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|8924_9398_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|9528_10317_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001067855.1|10518_11223_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000954592.1|12212_12389_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043265.1|12718_13534_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000251875.1|13620_13923_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|13816_14068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140202.1|14098_15235_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000079941.1|15601_15871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970007.1|15867_16149_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021265674.1|16188_17037_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_001334658.1|17153_17627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955263.1|18103_18370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459505.1|18369_18864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517695.1|18919_19522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132032.1|19875_21222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283341.1|21500_23381_+	colicin 1B	NA	NA	NA	NA	NA
WP_000762570.1|23398_23746_-	colicin 1B immunity protein	NA	NA	NA	NA	NA
WP_000194553.1|24232_24823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371888.1|24822_25080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774874.1|25430_26432_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_025653526.1|26607_26952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678527.1|27450_27705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|27749_28676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465043.1|29207_29621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537353.1|29622_30402_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|30581_31226_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|31312_31621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|32034_33015_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|33007_33424_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457492.1|33425_34700_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
WP_000109071.1|34699_35137_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|35133_35382_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273918.1|35799_36702_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891263.1|36698_37010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|37086_37770_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
37365:37380	attR	GCACCTGGTCTTCACC	NA	NA	NA	NA
WP_001104887.1|37770_37992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274403.1|38003_38438_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015059345.1|39131_39704_+	YubH family protein	NA	NA	NA	NA	NA
WP_072132163.1|39799_40102_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271729.1|40148_40571_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027500.1|40567_40759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276110.1|41528_42056_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_000006014.1|42113_42347_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_021265661.1|42405_44364_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	2.1e-20
WP_000845897.1|44418_44853_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|44849_45569_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|45565_46162_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001347396.1|46233_46704_+	YubH family protein	NA	NA	NA	NA	NA
WP_000117609.1|46624_47125_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000218863.1|47853_48288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|48379_48646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038339.1|48710_49652_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
