The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	0	39685	4992761	tRNA,tail,protease,terminase,capsid,head	Stx2-converting_phage(44.83%)	40	NA	NA
WP_001537086.1|0_1662_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_105907392.1|1725_3663_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|3707_3929_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126002.1|6293_6620_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001537078.1|6629_6980_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	97.4	3.9e-58
WP_000573391.1|6976_7423_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|7419_7764_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001537075.1|7830_8547_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_001030063.1|8552_8927_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|9022_9232_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_113440875.1|9279_12522_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.0	0.0e+00
WP_001672459.1|12514_12856_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	92.9	5.8e-59
WP_062864471.1|13062_14226_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.8	2.5e-130
WP_001537069.1|14422_15121_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	95.3	2.3e-126
WP_001537068.1|15177_15714_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_000675426.1|15713_15962_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	46.2	8.9e-09
WP_000868195.1|16072_16213_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_172615469.1|16275_17190_+	phage repressor protein/antirepressor Ant	NA	A0A0P0ZE73	Stx2-converting_phage	87.9	4.4e-93
WP_001537065.1|17244_17982_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	93.9	7.0e-142
WP_122990144.1|17927_18560_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	2.2e-104
WP_172615559.1|18813_22287_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.7	0.0e+00
WP_032217644.1|22354_22954_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	89.9	1.1e-97
WP_033804532.1|23105_24527_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	99.1	4.9e-59
WP_001537058.1|24876_25548_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	86.1	1.5e-106
WP_062903568.1|25911_27378_+	YadA-like family protein	NA	Q9LA53	Enterobacteria_phage	84.0	2.9e-147
WP_001537055.1|27464_27938_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	6.3e-88
WP_001217531.1|28149_28398_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	84.0	1.3e-31
WP_000891610.1|28724_29291_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|29600_31373_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077221229.1|31365_31818_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|31846_32587_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|32621_33143_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|33144_33747_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|33817_33883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|34021_34633_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|34641_35652_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|35798_36584_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|36580_37336_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|37414_38347_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|38362_39685_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 2
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	43683	45159	4992761		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|43683_45159_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 3
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	53215	57688	4992761		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|53215_53878_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|53901_54558_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|54659_54890_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|55028_55403_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879282.1|55406_56279_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_113440764.1|56291_56636_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|57031_57688_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 4
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	65184	67233	4992761		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|65184_67233_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 5
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	72564	72774	4992761		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|72564_72774_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 6
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	78414	79971	4992761		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|78414_79971_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 7
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	83833	91946	4992761	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|83833_85195_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|85268_85448_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|85567_85927_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|86289_86634_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|86765_88676_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221000.1|88733_89429_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290564.1|89468_90050_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001367067.1|90254_91946_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	1.2e-35
>prophage 8
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	101289	102498	4992761	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_071531852.1|101289_102498_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.3	1.4e-208
>prophage 9
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	108449	113026	4992761		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|108449_109940_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616433.1|110120_111596_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|111742_113026_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 10
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	116344	117199	4992761		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|116344_117199_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 11
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	120442	121084	4992761		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|120442_121084_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 12
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	126010	127972	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|126010_127972_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 13
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	133570	134224	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315662.1|133570_134224_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	6.4e-14
>prophage 14
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	140988	142209	4992761		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|140988_142209_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 15
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	149685	150513	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_000175053.1|149685_150513_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 16
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	156640	158902	4992761		Tupanvirus(100.0%)	1	NA	NA
WP_000077844.1|156640_158902_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 17
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	170203	189743	4992761	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|170203_172132_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|172135_172678_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|172774_172972_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|173024_173381_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|173503_173548_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|173831_174815_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|174829_177217_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|177221_177521_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956519.1|177621_178602_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|178664_179216_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|179215_179965_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|180042_180507_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001315654.1|180753_181467_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175615.1|181529_182966_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|182969_183161_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082204.1|183292_184339_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|184495_185329_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|185661_188040_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_001297385.1|188096_189743_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
>prophage 18
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	208389	213473	4992761		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|208389_208758_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|208766_210254_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|210263_211010_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000908012.1|210984_212256_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144565.1|212252_213473_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 19
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	221763	224030	4992761		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|221763_222432_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069997.1|222428_223214_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|223217_224030_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 20
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	229534	238326	4992761		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|229534_230176_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|230215_231364_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182362.1|231654_232866_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|232978_233911_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|233907_234933_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|235231_235321_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|235486_236656_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|236801_237383_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|237510_238326_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 21
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	247129	248628	4992761		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|247129_248026_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|248106_248628_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 22
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	255539	256814	4992761	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|255539_256814_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 23
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	276601	278413	4992761		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|276601_278413_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 24
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	288489	289791	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|288489_289791_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 25
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	299891	364723	4992761	transposase,tail,protease,terminase,lysis,portal	Enterobacteria_phage(40.43%)	74	NA	NA
WP_001260855.1|299891_300713_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|300812_300896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|300988_301324_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|301720_302974_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|303080_303974_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|304108_305329_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|305453_306149_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|306101_307394_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|307552_308167_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|308209_309064_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213037.1|309065_309662_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.1e-72
WP_001340362.1|309672_312096_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|312156_314583_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|314781_315087_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|315194_315905_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|315907_316468_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|316502_316844_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|316978_317305_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|317510_318725_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|318736_319756_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|319813_319942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|319943_321224_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|321258_321510_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_072794393.1|321582_324054_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296931.1|324146_324338_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|324334_324523_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|325009_325585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|325586_325742_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003381.1|325934_326342_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|326419_326647_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|326630_327152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533283.1|327132_328098_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	1.7e-55
WP_057108556.1|328138_328540_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.6e-63
WP_042058399.1|328729_329662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546200.1|330135_330243_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_072794392.1|330287_330500_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	4.3e-20
WP_000980999.1|330716_330968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072794391.1|331034_331313_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.6e-11
WP_072794390.1|331314_332364_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.9e-109
WP_000904114.1|332376_332751_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762863.1|332747_333569_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_001300563.1|333916_335029_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000562553.1|335813_335945_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|336311_336740_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|336911_337286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|337537_337753_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000189918.1|337757_338069_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092971.1|338065_338599_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_072794603.1|338595_339093_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|339456_339669_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|339679_339868_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|340015_340171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000548593.1|340811_341018_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|341567_342107_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507030.1|342115_344215_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_001072975.1|344211_344424_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985957.1|344423_345932_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_089649018.1|345876_347904_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|347990_348314_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|348306_348582_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|348593_349172_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|349168_349570_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|349581_350325_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|350385_350772_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|350780_351110_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_072794572.1|351081_354147_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447248.1|354146_354476_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001724602.1|354485_355184_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_072794574.1|355189_355933_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	5.2e-145
WP_000090847.1|355869_356472_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_172615473.1|356532_360012_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_001233114.1|360079_360679_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_089648922.1|360743_364142_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_172615474.1|364141_364723_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	3.4e-99
>prophage 26
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	367828	369528	4992761		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_113440793.1|367828_369289_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|369324_369528_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 27
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	374894	375785	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|374894_375785_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 28
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	383289	385419	4992761		Pandoravirus(50.0%)	3	NA	NA
WP_000012613.1|383289_384729_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.2e-28
WP_000803659.1|384785_385004_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|385035_385419_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 29
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	393163	394582	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|393163_394582_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 30
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	402463	403999	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194881.1|402463_403999_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 31
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	407402	412823	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_001315515.1|407402_412823_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.3	1.6e-142
>prophage 32
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	429411	436347	4992761		Bacillus_phage(50.0%)	2	NA	NA
WP_000628544.1|429411_431097_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.0e-10
WP_001245018.1|433563_436347_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 33
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	441621	445428	4992761		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|441621_443004_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|443028_445428_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 34
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	449744	451650	4992761		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193551.1|449744_450731_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_001285553.1|450723_451650_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 35
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	454924	456366	4992761		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|454924_455935_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|456081_456366_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 36
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	462378	462669	4992761		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|462378_462669_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 37
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	469554	471099	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|469554_471099_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 38
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	476902	488220	4992761		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_172615476.1|476902_481165_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_071524591.1|481245_481488_-	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000960006.1|481705_482158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001073.1|483604_483814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014879.1|484011_488220_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 39
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	495302	497405	4992761		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|495302_497405_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 40
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	504537	514711	4992761	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|504537_505551_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|505568_506714_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760629.1|506958_508365_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|508443_508860_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|508905_509082_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|509303_509534_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|509625_511587_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429141.1|511659_512196_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001349372.1|512248_513463_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_001373192.1|513502_514711_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.9e-209
>prophage 41
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	526517	527466	4992761		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|526517_526691_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_172615477.1|526935_527466_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 42
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	531405	535308	4992761		Klosneuvirus(100.0%)	1	NA	NA
WP_113440777.1|531405_535308_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 43
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	566593	567583	4992761		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|566593_567583_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 44
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	572542	579812	4992761	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837924.1|572542_573676_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|573816_574251_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|574426_575362_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123745.1|575490_576864_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|577341_578325_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|578579_579812_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 45
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	586138	586654	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|586138_586654_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 46
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	603273	604356	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|603273_604356_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 47
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	618360	619626	4992761		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|618360_619626_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 48
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	632541	638201	4992761		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|632541_633348_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968857.1|633415_633769_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|634138_634927_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|635071_636199_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|636266_638201_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 49
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	646016	646607	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039060377.1|646016_646607_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 50
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	651531	656823	4992761	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|651531_654129_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|654508_654760_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|654795_655845_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|656064_656823_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
>prophage 51
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	661756	664714	4992761		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|661756_663352_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983929.1|663352_664714_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	5.6e-36
>prophage 52
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	676371	678386	4992761		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|676371_677376_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|677372_678386_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 53
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	686795	696805	4992761		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068074.1|686795_687413_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.3e-53
WP_001287378.1|688017_688431_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|688574_689483_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|689684_690698_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|690789_691695_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|691807_692266_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|692315_693158_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|693882_694560_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|694559_695270_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|695266_696805_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 54
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	707936	708167	4992761		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|707936_708167_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 55
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	711268	715276	4992761		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|711268_712123_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|712158_712968_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200392.1|712971_713364_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|713360_714194_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|714193_715276_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 56
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	718412	721164	4992761		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|718412_719360_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|719484_721164_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 57
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	747924	749612	4992761		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|747924_749193_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|749192_749612_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 58
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	758148	760470	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_001373188.1|758148_760470_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	2.3e-90
>prophage 59
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	766337	770066	4992761		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|766337_767069_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|767289_767694_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|767746_767857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|768389_768713_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|768815_770066_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 60
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	773202	774573	4992761		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423719.1|773202_774573_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 61
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	779693	781671	4992761		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|779693_780830_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|780813_781671_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 62
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	784947	788670	4992761		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|784947_785769_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|785784_786696_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_113440848.1|786724_787969_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|787968_788670_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 63
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	795959	796217	4992761		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|795959_796217_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 64
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	808548	810191	4992761		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|808548_809553_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|809549_810191_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 65
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	813463	814645	4992761		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|813463_813700_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|813910_814645_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 66
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	827003	827945	4992761		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|827003_827945_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 67
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	843791	844037	4992761		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|843791_844037_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 68
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	848699	849620	4992761		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|848699_849620_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 69
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	858928	859462	4992761		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857414.1|858928_859462_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.0e-25
>prophage 70
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	863595	864429	4992761		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|863595_864429_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 71
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	869299	871861	4992761	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|869299_870461_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409850.1|870502_871861_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
>prophage 72
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	878680	879469	4992761		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|878680_879469_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 73
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	894380	896480	4992761		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|894380_894875_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240629.1|894895_896224_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001273658.1|896306_896480_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 74
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	900783	913038	4992761		Klosneuvirus(20.0%)	13	NA	NA
WP_000420629.1|900783_901704_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|901703_902009_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|902101_902701_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|902697_905244_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|905243_906416_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|906545_907238_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|907210_908239_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001367057.1|908321_911066_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829672.1|911137_912211_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|912258_912432_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001315395.1|912421_912652_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|912626_912815_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|912825_913038_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 75
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	932303	932963	4992761	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|932303_932963_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 76
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	937196	939251	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_001315388.1|937196_939251_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 77
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	951861	953769	4992761		Tupanvirus(100.0%)	1	NA	NA
WP_000053120.1|951861_953769_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 78
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	969691	980824	4992761	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090514.1|969691_970459_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193844.1|970665_973278_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|973543_974746_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|974914_976315_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|976916_978005_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|978189_979380_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|979601_980249_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|980275_980824_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 79
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	995529	1000070	4992761		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|995529_997278_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|997314_999579_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|999785_1000070_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 80
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1005156	1006245	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1005156_1006245_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 81
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1010343	1013558	4992761		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1010343_1012626_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1012817_1013558_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 82
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1019867	1043665	4992761	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|1019867_1020485_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850317.1|1020495_1022940_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000886683.1|1023178_1024471_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1024561_1025905_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1025915_1026527_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|1026681_1030788_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1030922_1031417_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1031961_1032927_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|1033049_1034816_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|1034816_1036538_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|1036579_1037284_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1037568_1037787_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1038471_1040748_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1040778_1041099_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1041421_1041646_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|1041718_1043665_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 83
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1052962	1054681	4992761		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|1052962_1054681_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 84
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1058268	1061006	4992761		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|1058268_1059099_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1059095_1059419_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1059544_1060060_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1060277_1061006_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 85
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1064348	1073499	4992761		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149733.1|1064348_1065476_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1065516_1066005_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1066064_1066910_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|1066906_1067860_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|1067869_1069003_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|1069097_1070210_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1070561_1071038_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1071125_1072028_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1072088_1072811_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1072794_1073082_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1073241_1073499_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 86
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1082065	1083268	4992761		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1082065_1083268_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 87
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1094602	1096474	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|1094602_1096474_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 88
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1099792	1108134	4992761		Synechococcus_phage(33.33%)	6	NA	NA
WP_000424889.1|1099792_1100455_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
WP_001295295.1|1100585_1101485_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_172615482.1|1101490_1103923_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|1104068_1104884_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168779.1|1105035_1106301_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|1106541_1108134_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 89
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1113131	1118356	4992761		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1113131_1113647_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1113699_1113765_-	protein YliM	NA	NA	NA	NA	NA
WP_001315365.1|1113999_1114887_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1115185_1115689_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1116092_1116839_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1116977_1117637_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1117633_1118356_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 90
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1121893	1125759	4992761		Erwinia_phage(33.33%)	4	NA	NA
WP_000710619.1|1121893_1122154_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|1122417_1124700_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|1124741_1125419_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|1125492_1125759_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
>prophage 91
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1130006	1139261	4992761	transposase	Bacillus_phage(33.33%)	6	NA	NA
WP_001307069.1|1130006_1132157_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_000399648.1|1133018_1133999_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000007102.1|1134269_1135634_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|1135862_1136534_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1136536_1137532_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|1137524_1139261_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 92
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1150572	1151481	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1150572_1151481_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 93
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1157962	1159252	4992761		Klosneuvirus(100.0%)	1	NA	NA
WP_001367048.1|1157962_1159252_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 94
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1169515	1176089	4992761		Planktothrix_phage(33.33%)	7	NA	NA
WP_113440907.1|1169515_1170574_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1170576_1171266_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101990.1|1171265_1172039_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1172205_1172355_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1172483_1173272_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_113440908.1|1173339_1174812_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265438.1|1175072_1176089_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 95
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1180445	1183965	4992761		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1180445_1181498_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|1181813_1182194_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|1182307_1183249_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|1183245_1183965_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 96
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1219896	1220688	4992761		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|1219896_1220688_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 97
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1224066	1244192	4992761		Hokovirus(28.57%)	14	NA	NA
WP_001032694.1|1224066_1225548_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207157.1|1225589_1227008_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
WP_001076014.1|1227004_1227514_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000832338.1|1229028_1229598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000267527.1|1229594_1231028_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	1.9e-26
WP_000873944.1|1231145_1231472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904123.1|1231471_1235665_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|1235907_1236114_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1236426_1236516_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|1236515_1238189_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087972.1|1238211_1240260_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	9.3e-27
WP_001297248.1|1240268_1240841_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001306984.1|1240833_1243518_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|1243514_1244192_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 98
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1250847	1251612	4992761		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|1250847_1251612_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 99
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1255761	1259575	4992761	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1255761_1257426_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023134.1|1257628_1259575_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 100
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1264201	1265866	4992761		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|1264201_1265866_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 101
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1270001	1271042	4992761		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1270001_1271042_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 102
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1278938	1282471	4992761		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1278938_1279664_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207519.1|1279781_1280717_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367891.1|1280800_1282471_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 103
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1289409	1291992	4992761	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|1289409_1291992_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 104
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1299002	1301442	4992761		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|1299002_1300091_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1300230_1301442_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 105
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1306257	1306905	4992761		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1306257_1306641_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1306695_1306905_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 106
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1322329	1324444	4992761		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1322329_1322758_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1322878_1324444_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 107
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1327511	1329334	4992761		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|1327511_1328732_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|1328704_1329334_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 108
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1343880	1349923	4992761		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1343880_1344696_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096702.1|1344692_1345826_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077727.1|1346041_1349923_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 109
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1354902	1444167	4992761	integrase,transposase,tail,protease,terminase,lysis,capsid,head,portal	Enterobacteria_phage(44.44%)	91	1396998:1397044	1444181:1444227
WP_001300563.1|1354902_1356015_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956465.1|1356091_1356244_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1356638_1357751_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956456.1|1357943_1358096_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130622.1|1358537_1359656_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682518.1|1359721_1359970_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|1360034_1360403_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351464.1|1360496_1361150_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153146.1|1361257_1362505_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786320.1|1362572_1363949_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573957.1|1364050_1367194_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.9e-59
WP_000717162.1|1367205_1368429_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709879.1|1368444_1368777_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074237.1|1368800_1370183_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770941.1|1370339_1371023_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|1371012_1372461_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103243.1|1373197_1375099_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_001160804.1|1375126_1375588_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_085947771.1|1380372_1381535_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000718944.1|1381676_1382216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170011.1|1384536_1385247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|1387778_1387988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299580.1|1388102_1388414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420935.1|1388517_1389654_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_113440677.1|1392146_1395119_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224567.1|1395119_1396010_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|1396192_1396954_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1396998:1397044	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|1397466_1398420_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|1398606_1400091_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239874.1|1400636_1401305_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|1401670_1401784_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1401852_1402086_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|1402402_1402993_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|1403090_1403666_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001367620.1|1403665_1406626_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	5.2e-55
WP_001233090.1|1406690_1407290_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_172615485.1|1407360_1410858_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.7	0.0e+00
WP_000090891.1|1410917_1411550_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140728.1|1411486_1412230_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_001152632.1|1412235_1412934_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847379.1|1412933_1413263_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840349.1|1413259_1415839_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000459457.1|1415831_1416266_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|1416247_1416670_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001406215.1|1416685_1417426_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	3.0e-129
WP_000683105.1|1417433_1417829_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975081.1|1417825_1418404_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|1418415_1418769_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1418780_1419176_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063236.1|1419217_1420243_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001358225.1|1420298_1420631_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123248.1|1420640_1421960_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001367683.1|1421940_1423542_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.5e-309
WP_000198149.1|1423538_1423745_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|1423741_1425667_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453602.1|1425641_1426187_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	1.2e-93
WP_001415975.1|1426575_1426770_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|1427132_1427426_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1427516_1427699_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001362419.1|1427915_1428410_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.7e-88
WP_000839596.1|1428409_1428625_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|1429213_1430311_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204780.1|1430500_1430884_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971071.1|1430969_1431110_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|1431106_1431469_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000386643.1|1431675_1432017_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|1432019_1432196_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|1432192_1432720_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|1432716_1433157_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000676507.1|1433230_1433521_-	hypothetical protein	NA	A0A1I9LJP5	Stx_converting_phage	99.0	3.7e-46
WP_000788798.1|1433517_1434219_-	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	3.8e-129
WP_000185506.1|1434215_1435115_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000438492.1|1435147_1435444_-	Regulatory protein CII from phage origin	NA	A0A0N7KZD0	Stx2-converting_phage	99.0	8.9e-48
WP_000067727.1|1435585_1435801_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|1435876_1436572_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000854876.1|1436744_1437041_+	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_000478870.1|1437052_1437337_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000088205.1|1437769_1438042_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392425.1|1438326_1438776_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000065359.1|1438971_1439340_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	98.4	7.6e-65
WP_001198865.1|1439412_1439577_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	98.1	3.1e-26
WP_000372937.1|1439545_1439689_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|1439762_1440059_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1440064_1440850_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611718.1|1440846_1441527_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.0e-131
WP_000682305.1|1441523_1441706_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|1441678_1441870_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001386642.1|1441880_1442162_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|1442260_1442479_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|1442526_1442805_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051902.1|1443003_1444167_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
1444181:1444227	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 110
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1451257	1454388	4992761	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|1451257_1452124_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1452125_1452338_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1452445_1452967_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1453002_1454388_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 111
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1465807	1466953	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|1465807_1466953_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 112
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1473143	1474925	4992761		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1473143_1474925_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 113
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1481832	1482519	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110579.1|1481832_1482519_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.7e-33
>prophage 114
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1485655	1486333	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1485655_1486333_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 115
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1490872	1493832	4992761		uncultured_virus(50.0%)	2	NA	NA
WP_000078268.1|1490872_1493377_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
WP_001344274.1|1493490_1493832_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 116
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1502026	1510588	4992761		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|1502026_1502986_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250088.1|1502982_1503945_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1504180_1504825_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|1505005_1506880_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1506989_1507595_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1507594_1507924_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|1507976_1509908_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1510036_1510588_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 117
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1517596	1520746	4992761		Leptospira_phage(100.0%)	1	NA	NA
WP_172615487.1|1517596_1520746_+	efflux RND transporter permease AcrB	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 118
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1529581	1533128	4992761		Bacillus_phage(100.0%)	2	NA	NA
WP_172615488.1|1529581_1531363_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.1e-42
WP_001235609.1|1531355_1533128_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 119
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1536451	1537147	4992761		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1536451_1537147_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 120
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1540275	1545322	4992761	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1540275_1540548_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1540756_1543111_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1543298_1544573_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1544698_1545322_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 121
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1569153	1578134	4992761	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1569153_1569624_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|1569712_1570816_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|1570819_1571269_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001297136.1|1571419_1571959_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1572257_1573142_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1573318_1573666_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1573794_1574766_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1574776_1576624_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1576651_1576984_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1577006_1578134_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 122
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1585086	1595058	4992761		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|1585086_1586382_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1586439_1587129_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|1587318_1588521_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698839.1|1588517_1591661_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|1591786_1592971_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|1593113_1594022_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1594146_1595058_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 123
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1599401	1600517	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_113440724.1|1599401_1600517_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 124
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1607932	1609090	4992761		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1607932_1609090_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 125
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1615983	1616751	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|1615983_1616751_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 126
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1622046	1623156	4992761		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_047657033.1|1622046_1623156_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	6.8e-32
>prophage 127
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1626234	1628195	4992761		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|1626234_1627248_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|1627244_1628195_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 128
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1633606	1637886	4992761		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|1633606_1634689_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177903.1|1634811_1637886_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
>prophage 129
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1642427	1648022	4992761		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952482.1|1642427_1643327_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001299008.1|1643366_1644650_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|1644639_1645899_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010276.1|1646135_1648022_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 130
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1656402	1724059	4992761	plate,integrase,transposase,tail,protease,capsid,head,holin	Shigella_phage(53.49%)	78	1670189:1670204	1730379:1730394
WP_000692742.1|1656402_1657452_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|1657538_1658495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|1658491_1659463_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172615490.1|1659455_1660109_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_001536754.1|1660197_1660935_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	3.7e-103
WP_001443803.1|1660888_1661089_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_172615491.1|1661575_1661713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001536755.1|1661744_1661945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536756.1|1662019_1662265_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001536757.1|1662300_1662480_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	57.4	2.7e-07
WP_001536758.1|1662515_1664597_-	hypothetical protein	NA	Q20GJ1	Phage_258-320	55.9	5.5e-184
WP_172615492.1|1664687_1665248_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	1.6e-74
WP_077633590.1|1665352_1665697_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	64.2	4.5e-19
WP_024192107.1|1665732_1666254_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	46.8	2.6e-42
WP_172615561.1|1666374_1666599_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	60.9	2.0e-15
WP_172615493.1|1667270_1667828_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	45.8	3.6e-42
WP_172615562.1|1667818_1668901_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.9	1.1e-98
WP_172615494.1|1668900_1669338_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	54.2	1.1e-38
WP_172615495.1|1669330_1669945_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	6.2e-51
WP_172615496.1|1669934_1671059_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.0	5.7e-95
1670189:1670204	attL	ACCGGCCATCATCCCG	NA	NA	NA	NA
WP_172615497.1|1671042_1672401_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	30.6	7.5e-49
WP_172615498.1|1672387_1674445_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	39.4	1.3e-76
WP_001149937.1|1674448_1674595_-	hypothetical protein	NA	C9DGQ0	Escherichia_phage	55.8	6.8e-09
WP_172615499.1|1674572_1675052_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.0	1.8e-21
WP_172615500.1|1675066_1675432_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	50.8	3.8e-24
WP_172615501.1|1675440_1676943_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	52.1	2.8e-137
WP_001536777.1|1676939_1677185_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	52.7	1.8e-06
WP_001536778.1|1677185_1677746_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.3	1.6e-42
WP_001104956.1|1677742_1678162_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_062860978.1|1678158_1678530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615502.1|1678573_1679521_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	66.2	1.0e-121
WP_172615503.1|1679520_1680645_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.3	3.0e-75
WP_032182829.1|1680821_1681295_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.3	8.7e-37
WP_172615504.1|1681417_1682743_-|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	59.0	2.7e-152
WP_062857689.1|1682726_1684316_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	4.2e-168
WP_172615505.1|1684315_1685980_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360582.1|1685979_1686561_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001279083.1|1686563_1686854_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|1686850_1687159_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001536792.1|1687139_1687367_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|1687376_1687595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129944207.1|1687578_1688007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125304.1|1688041_1688542_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_001536795.1|1688613_1689036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024192020.1|1689141_1689378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536796.1|1689376_1689799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172615506.1|1689825_1690335_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.8	1.7e-25
WP_001536798.1|1690331_1690643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633438.1|1690656_1690968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615507.1|1690964_1691516_-	AsnC family protein	NA	NA	NA	NA	NA
WP_001536801.1|1691519_1692035_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	1.5e-45
WP_172615508.1|1692034_1692568_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.3	1.8e-62
WP_032307002.1|1692713_1693244_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.4	1.4e-46
WP_000049304.1|1693255_1693549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049430.1|1693553_1693826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615563.1|1693900_1694128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615509.1|1694545_1694767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615510.1|1694769_1695702_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	44.6	6.0e-66
WP_172615511.1|1695778_1697866_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.5	3.6e-167
WP_001575658.1|1697868_1698099_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
WP_172615512.1|1698283_1698829_+	XRE family transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	39.7	1.2e-05
WP_001042114.1|1699998_1700982_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001325907.1|1701235_1701646_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000665131.1|1701944_1703327_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661649.1|1703336_1704287_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_000083455.1|1704429_1705848_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111812.1|1705847_1707395_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001315281.1|1707384_1708248_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000023635.1|1708287_1708893_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013880.1|1709150_1709648_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084379.1|1709739_1710672_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000146391.1|1710713_1711802_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001406337.1|1711943_1715927_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	37.9	3.5e-123
WP_000131044.1|1716501_1718535_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|1718663_1719251_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|1719264_1720737_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1720750_1722421_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|1723495_1724059_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
1730379:1730394	attR	ACCGGCCATCATCCCG	NA	NA	NA	NA
>prophage 131
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1733985	1737290	4992761		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046293.1|1733985_1735311_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|1735419_1735656_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1735667_1736261_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1736420_1737290_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 132
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1756192	1763774	4992761		Streptococcus_phage(50.0%)	6	NA	NA
WP_000667026.1|1756192_1758391_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121354.1|1758400_1759357_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111353.1|1759335_1759746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893255.1|1760062_1761316_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|1761327_1762431_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749882.1|1762718_1763774_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 133
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1768451	1769591	4992761		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528869.1|1768451_1769591_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
>prophage 134
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1774669	1778588	4992761		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543895.1|1774669_1775443_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1775628_1775889_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|1775891_1776170_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1776325_1777066_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1777036_1777804_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1778009_1778588_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 135
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1789492	1791634	4992761		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103320.1|1789492_1791634_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 136
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1795350	1859179	4992761	tRNA,plate,transposase,protease	Enterobacteria_phage(11.11%)	53	NA	NA
WP_000611742.1|1795350_1795764_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|1795767_1797618_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|1797581_1798664_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|1798688_1799969_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1799965_1800490_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_113440821.1|1800492_1801824_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|1801828_1802590_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614334.1|1802598_1805358_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_113440822.1|1805354_1806098_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|1806102_1807515_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|1807623_1811058_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|1811068_1812421_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|1812444_1812927_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|1812970_1813885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1813894_1814374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1814510_1815296_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1815835_1816567_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1816631_1817099_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1817095_1817818_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|1817851_1818607_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1818678_1820037_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|1820084_1820855_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1820932_1821733_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|1821973_1822888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1822884_1823688_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1829446_1830019_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1830206_1831238_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1831230_1831884_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1831923_1832739_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|1832856_1833261_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1833257_1833965_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1834076_1835795_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|1836875_1837856_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|1838105_1838816_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1838829_1839252_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1839248_1839794_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1839959_1840160_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1840146_1840407_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|1840455_1841754_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1841818_1842208_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1842264_1844406_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1844504_1845464_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|1845476_1848959_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1848995_1849592_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|1849588_1850737_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1850736_1851525_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1851528_1851984_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139288.1|1852088_1853114_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1853117_1853603_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1853724_1856157_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_172615513.1|1856186_1857539_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|1857550_1858408_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|1858420_1859179_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 137
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1871062	1872487	4992761	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1871062_1872487_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 138
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1876416	1876761	4992761		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1876416_1876761_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 139
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1882672	1883470	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315242.1|1882672_1883470_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 140
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1888713	1895519	4992761	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001367042.1|1888713_1891143_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.7e-40
WP_001294700.1|1891216_1891747_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|1891761_1892466_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1892643_1893099_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|1893135_1894062_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|1894100_1895519_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 141
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1905425	1906328	4992761		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|1905425_1906328_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 142
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1909590	1911865	4992761		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_000150637.1|1909590_1910517_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1910625_1911288_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1911328_1911865_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
>prophage 143
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1915948	1917499	4992761		Mamastrovirus(100.0%)	1	NA	NA
WP_001189608.1|1915948_1917499_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 144
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1925148	1926573	4992761		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1925148_1926573_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 145
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1935200	1935752	4992761		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1935200_1935752_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 146
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1939997	1941041	4992761		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1939997_1941041_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 147
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1967014	1968739	4992761		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|1967014_1968739_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 148
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1981441	1982140	4992761		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|1981441_1982140_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 149
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	1988472	1993895	4992761		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035650.1|1988472_1990824_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
WP_001117011.1|1990988_1993895_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 150
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2001639	2003039	4992761		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|2001639_2002482_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|2002559_2003039_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 151
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2010934	2016595	4992761		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|2010934_2012449_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2012479_2013622_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|2013750_2014968_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|2015041_2016595_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 152
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2022065	2023214	4992761		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2022065_2023214_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 153
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2027620	2030437	4992761	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|2027620_2030437_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 154
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2037469	2047887	4992761	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_000681360.1|2037469_2038636_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|2039164_2039374_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001300563.1|2039451_2040564_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118464.1|2040826_2041957_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2042045_2043962_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|2044338_2044743_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|2044768_2045482_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2045630_2046197_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|2046231_2046819_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130182.1|2046933_2047887_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	7.4e-11
>prophage 155
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2060934	2063048	4992761		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|2060934_2062359_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|2062358_2063048_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 156
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2066279	2071634	4992761		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|2066279_2068217_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2068427_2070095_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093818.1|2070401_2071634_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	3.0e-81
>prophage 157
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2078377	2079700	4992761		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2078377_2079700_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 158
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2086614	2089490	4992761		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2086614_2086776_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2086902_2087508_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2087900_2089490_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 159
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2097419	2098699	4992761		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2097419_2097959_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2097961_2098699_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 160
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2101926	2107291	4992761		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|2101926_2102949_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2103087_2104002_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410127.1|2104216_2105578_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|2105626_2107291_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 161
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2127441	2127912	4992761	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001379453.1|2127441_2127912_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.6	4.3e-12
>prophage 162
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2136024	2136579	4992761		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|2136024_2136579_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 163
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2143147	2144608	4992761		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208202.1|2143147_2144608_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 164
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2154874	2156551	4992761		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2154874_2155471_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_113440772.1|2155948_2156551_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	2.4e-55
>prophage 165
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2159911	2160892	4992761		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991444.1|2159911_2160892_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	2.5e-102
>prophage 166
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2166069	2167365	4992761		Pseudomonas_phage(50.0%)	2	NA	NA
WP_032267591.1|2166069_2166513_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	28.7	2.8e-13
WP_032267590.1|2166543_2167365_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	4.0e-45
>prophage 167
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2176520	2184400	4992761		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_072004755.1|2176520_2179370_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	40.3	6.6e-188
WP_032267579.1|2179395_2180376_+	ATP-binding protein	NA	Q677Q6	Lymphocystis_disease_virus	31.6	3.2e-17
WP_032267578.1|2180385_2182773_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_032267577.1|2182783_2184400_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	42.9	1.5e-88
>prophage 168
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2189248	2200334	4992761	tRNA,integrase	Stenotrophomonas_phage(25.0%)	8	2177394:2177406	2192537:2192549
2177394:2177406	attL	TCCTCATATTTGC	NA	NA	NA	NA
WP_032267573.1|2189248_2190511_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.9	6.2e-82
WP_001514390.1|2191028_2191238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294576.1|2191320_2192823_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	2.3e-83
2192537:2192549	attR	GCAAATATGAGGA	NA	NA	NA	NA
WP_001295681.1|2192941_2194024_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2194023_2195124_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2195390_2196902_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2197035_2197479_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|2197478_2200334_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 169
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2208612	2215069	4992761	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_000013046.1|2208612_2209548_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2209560_2210022_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2210094_2210481_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118337.1|2210546_2211002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000471866.1|2211046_2213743_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2213883_2213937_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|2214121_2215069_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 170
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2218707	2221468	4992761		Vibrio_phage(100.0%)	2	NA	NA
WP_000187778.1|2218707_2220846_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|2221003_2221468_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
>prophage 171
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2225710	2232368	4992761		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2225710_2226709_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|2226741_2227737_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001339490.1|2227723_2228746_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205793.1|2228759_2230262_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|2230571_2231528_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2231837_2232368_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 172
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2265885	2267067	4992761	integrase	Enterobacteria_phage(100.0%)	1	2263824:2263838	2270604:2270618
2263824:2263838	attL	GCCCTTCTGGCTGTG	NA	NA	NA	NA
WP_001131670.1|2265885_2267067_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
WP_001131670.1|2265885_2267067_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
2270604:2270618	attR	GCCCTTCTGGCTGTG	NA	NA	NA	NA
>prophage 173
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2274095	2275142	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_001545794.1|2274095_2275142_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
>prophage 174
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2292030	2294343	4992761	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001171554.1|2292030_2292411_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2292407_2292755_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_094472072.1|2292804_2294343_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.7e-295
>prophage 175
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2298591	2300715	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_000376544.1|2298591_2300715_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	8.4e-47
>prophage 176
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2306033	2307185	4992761	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254876.1|2306033_2307185_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
>prophage 177
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2310395	2324972	4992761		Moraxella_phage(66.67%)	6	NA	NA
WP_000737516.1|2310395_2310971_-	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	31.7	1.8e-15
WP_032186113.1|2312801_2313245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001222075.1|2313579_2313834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113440893.1|2313830_2322767_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.2	1.9e-55
WP_001243916.1|2322782_2323310_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_001376511.1|2323319_2324972_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	2.2e-39
>prophage 178
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2343934	2346069	4992761		Yersinia_phage(33.33%)	4	NA	NA
WP_001234620.1|2343934_2344753_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_044860884.1|2344807_2345293_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.0e-12
WP_001186726.1|2345308_2345785_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|2345847_2346069_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 179
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2358160	2359324	4992761		Ralstonia_phage(100.0%)	1	NA	NA
WP_172615518.1|2358160_2359324_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	7.0e-80
>prophage 180
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2363256	2376287	4992761	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|2363256_2365698_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2365736_2366162_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2366366_2367665_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2367768_2367966_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2368047_2369052_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2369054_2370314_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2370399_2371680_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2371755_2372064_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2372149_2373100_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122499.1|2373092_2374940_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|2374949_2376287_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 181
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2380090	2380636	4992761		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2380090_2380636_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 182
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2388064	2389042	4992761		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2388064_2389042_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 183
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2393962	2394496	4992761		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2393962_2394496_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 184
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2399007	2400991	4992761		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2399007_2400654_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2400697_2400991_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 185
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2415268	2418480	4992761	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|2415268_2416726_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|2416962_2418480_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 186
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2439676	2441179	4992761		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2439676_2441179_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 187
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2446018	2446807	4992761		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2446018_2446807_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 188
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2452430	2453980	4992761		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|2452430_2453189_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611404.1|2453299_2453980_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 189
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2457965	2459951	4992761		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001315959.1|2457965_2459951_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.6e-148
>prophage 190
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2465196	2467344	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2465196_2467344_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 191
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2476626	2478585	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2476626_2478585_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 192
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2484168	2485518	4992761		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2484168_2485518_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 193
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2489335	2495325	4992761	transposase	Enterobacteria_phage(33.33%)	5	NA	NA
WP_000168305.1|2489335_2489872_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2490125_2492948_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|2492982_2493339_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270372.1|2493342_2493759_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_085947771.1|2494163_2495325_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 194
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2498416	2500964	4992761		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|2498416_2499496_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2499548_2500964_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 195
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2507560	2508169	4992761		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2507560_2508169_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 196
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2517293	2518409	4992761		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2517293_2518409_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 197
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2534216	2535008	4992761		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130548.1|2534216_2535008_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	2.4e-47
>prophage 198
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2540658	2544342	4992761		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|2540658_2544342_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 199
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2559717	2561307	4992761		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187562.1|2559717_2561307_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 200
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2566675	2568439	4992761		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2566675_2566948_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2567134_2567725_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|2567767_2568439_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 201
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2577657	2585986	4992761		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2577657_2581881_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2581957_2585986_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 202
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2590102	2593155	4992761		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2590102_2591287_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2592204_2593155_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 203
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2601660	2603505	4992761		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|2601660_2603505_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 204
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2610255	2611470	4992761		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690946.1|2610255_2611470_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	4.5e-45
>prophage 205
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2623587	2630834	4992761		Serratia_phage(33.33%)	5	NA	NA
WP_000184827.1|2623587_2625885_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2625935_2626256_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2626270_2627350_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_113440767.1|2627658_2630160_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2630171_2630834_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 206
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2643826	2648011	4992761		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_172615519.1|2643826_2648011_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 207
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2653648	2658152	4992761		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|2653648_2654980_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|2655046_2655973_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2656065_2656551_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2656635_2656881_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2657306_2658152_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 208
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2669727	2674588	4992761		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2669727_2670426_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2670422_2671796_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2671901_2672576_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2672724_2673708_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2673967_2674588_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 209
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2689296	2692347	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2689296_2692347_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 210
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2701221	2704001	4992761		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|2701221_2702007_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|2702040_2702937_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718896.1|2703104_2704001_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
>prophage 211
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2720368	2722839	4992761		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2720368_2721418_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2721429_2722839_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 212
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2726917	2729704	4992761		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2726917_2729704_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 213
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2743390	2744005	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2743390_2744005_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 214
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2752795	2756082	4992761		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2752795_2753572_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2753574_2754090_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001315927.1|2754093_2754363_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2754441_2756082_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 215
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2768494	2770324	4992761		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|2768494_2770324_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 216
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2777808	2781667	4992761		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|2777808_2779971_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|2780054_2780771_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2780770_2781667_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 217
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2784703	2787491	4992761		Salmonella_phage(100.0%)	2	NA	NA
WP_001315924.1|2784703_2786182_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_001349386.1|2786165_2787491_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.8e-08
>prophage 218
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2803812	2809956	4992761		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|2803812_2804943_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|2804947_2805622_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2805599_2806481_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|2806499_2807567_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006621.1|2807566_2808829_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|2808825_2809956_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 219
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2813998	2819410	4992761		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2813998_2814328_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2814458_2815724_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|2815857_2817342_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|2817388_2819410_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 220
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2829162	2830809	4992761		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012633.1|2829162_2830809_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.9e-68
>prophage 221
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2844199	2850052	4992761		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2844199_2845090_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2845114_2846080_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_172615522.1|2846084_2847590_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|2847597_2848017_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|2848183_2850052_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 222
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2853220	2854213	4992761		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845103.1|2853220_2854213_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.7e-50
>prophage 223
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2866165	2869527	4992761		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|2866165_2867536_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|2867697_2869527_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 224
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2875058	2878899	4992761		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|2875058_2876099_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2876185_2877145_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2877144_2878035_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2878125_2878899_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 225
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2889888	2891226	4992761		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2889888_2891226_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 226
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2901425	2908794	4992761		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|2901425_2901683_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2901646_2902006_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2902022_2902163_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2902392_2902473_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2902769_2904173_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2904177_2905278_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_113440722.1|2905277_2906351_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072071.1|2906379_2908794_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
>prophage 227
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2913500	2914649	4992761		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2913500_2914649_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 228
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2919076	2920030	4992761		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2919076_2919490_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2919601_2920030_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 229
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2926383	2935545	4992761		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|2926383_2928099_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|2928095_2929589_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|2929635_2930085_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|2930194_2930542_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2930531_2930894_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148039.1|2930890_2931388_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|2931395_2932580_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|2932998_2933088_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|2933652_2933751_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|2933856_2935545_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 230
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2942849	2944184	4992761		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|2942849_2944184_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 231
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2956302	2957694	4992761		environmental_Halophage(100.0%)	1	NA	NA
WP_113440721.1|2956302_2957694_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 232
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2962815	2969566	4992761		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|2962815_2964924_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2964942_2965218_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2965272_2965896_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870053.1|2966153_2967836_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_000924289.1|2967832_2968450_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|2968741_2969566_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 233
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2972939	2977502	4992761		Xanthomonas_phage(25.0%)	6	NA	NA
WP_000976070.1|2972939_2973398_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|2973375_2974596_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000091955.1|2975652_2975889_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2975909_2976077_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2976174_2976984_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2977022_2977502_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 234
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2984940	2987034	4992761		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364782.1|2984940_2985966_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064012.1|2986050_2987034_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 235
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	2990433	2999939	4992761		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|2990433_2991366_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|2991579_2992776_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|2992785_2993811_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|2994049_2995084_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|2995070_2996030_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|2996033_2997317_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|2997326_2998871_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|2999115_2999547_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2999687_2999939_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 236
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3022035	3032726	4992761	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_000887058.1|3022035_3022974_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
WP_113440895.1|3023021_3023864_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001271686.1|3023968_3024352_-	protein YhhH	NA	NA	NA	NA	NA
WP_172615523.1|3024323_3028559_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_000779792.1|3028787_3029396_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|3029493_3030885_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582482.1|3030881_3032726_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 237
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3061150	3062692	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3061150_3062692_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 238
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3068010	3069006	4992761		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3068010_3069006_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 239
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3073230	3073443	4992761		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3073230_3073443_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 240
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3077097	3079431	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_113440708.1|3077097_3079431_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	2.8e-72
>prophage 241
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3089645	3091630	4992761		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|3089645_3090629_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107018.1|3090625_3091630_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 242
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3137644	3138292	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3137644_3138292_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 243
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3143172	3145307	4992761		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|3143172_3143598_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|3143610_3144900_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3144953_3145307_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 244
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3148652	3150695	4992761		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3148652_3150695_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 245
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3164144	3170027	4992761		Staphylococcus_phage(50.0%)	5	NA	NA
WP_000149165.1|3164144_3166880_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_113440861.1|3166879_3168004_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|3168334_3168694_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3168813_3169215_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|3169220_3170027_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 246
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3177920	3182052	4992761		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3177920_3178586_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3178806_3179052_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106510.1|3179153_3181352_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.1e-118
WP_000964718.1|3181425_3182052_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 247
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3185058	3187877	4992761		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3185058_3185727_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3185719_3186778_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3187022_3187877_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 248
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3194358	3195841	4992761		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3194358_3195126_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3195127_3195841_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 249
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3199381	3201192	4992761		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|3199381_3200452_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073609.1|3200448_3201192_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
>prophage 250
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3221200	3223648	4992761		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3221200_3223648_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 251
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3232910	3234095	4992761		Ralstonia_phage(100.0%)	1	NA	NA
WP_113440864.1|3232910_3234095_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.1	7.3e-133
>prophage 252
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3238473	3240867	4992761		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3238473_3240867_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 253
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3246836	3247715	4992761		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|3246836_3247715_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 254
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3254278	3258790	4992761		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|3254278_3254998_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3254994_3256347_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|3256378_3256675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|3256733_3257051_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001265681.1|3257167_3258790_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 255
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3275768	3276605	4992761		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3275768_3276605_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 256
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3300840	3310381	4992761		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|3300840_3301404_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963784.1|3301489_3302710_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3302776_3304867_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3304917_3305550_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3305851_3306256_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3306310_3307180_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3307233_3307452_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057405.1|3307445_3308468_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3308467_3310381_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 257
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3315951	3321525	4992761		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209689.1|3315951_3316338_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
WP_000820720.1|3316337_3316697_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3316704_3316992_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3317117_3317492_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3317588_3318059_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3318155_3320270_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3320340_3321525_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 258
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3341402	3342874	4992761	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|3341402_3342350_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3342364_3342874_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 259
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3353374	3357528	4992761		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|3353374_3354133_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001299298.1|3354140_3355244_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|3355253_3356435_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738575.1|3356502_3357528_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 260
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3361350	3366230	4992761	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_162841971.1|3361350_3362564_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
WP_172615526.1|3362589_3362850_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000160334.1|3362861_3364019_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001129522.1|3364417_3365080_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001295275.1|3365082_3365262_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258900.1|3365345_3366230_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 261
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3376795	3377839	4992761		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3376795_3377839_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 262
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3394334	3396859	4992761	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497724.1|3394334_3395402_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3395491_3396859_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 263
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3400825	3401323	4992761	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_089648904.1|3400825_3401323_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	2.5e-26
>prophage 264
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3405027	3409775	4992761		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108460.1|3405027_3406518_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|3406565_3407255_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209027.1|3407251_3408127_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_089648905.1|3408123_3408588_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445142.1|3408647_3409775_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 265
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3416524	3431318	4992761		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|3416524_3417454_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3417549_3419886_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|3420115_3420769_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3420765_3421494_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|3421490_3422123_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3422335_3422608_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3422604_3423459_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3423504_3423996_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3424113_3424401_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3424423_3425857_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3425904_3426630_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3426636_3427194_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3427162_3427738_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|3427734_3428301_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3428321_3429308_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|3429321_3430299_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3430508_3431318_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 266
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3435386	3436864	4992761		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3435386_3435665_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3435892_3436864_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 267
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3443492	3446365	4992761	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3443492_3445427_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_053293847.1|3445516_3446365_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
>prophage 268
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3450447	3457086	4992761		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|3450447_3451791_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3452421_3452874_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3452901_3454389_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133043.1|3454413_3457086_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.5e-24
>prophage 269
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3462567	3464457	4992761		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3462567_3464457_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 270
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3471563	3479356	4992761		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001345969.1|3471563_3471866_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
WP_000449451.1|3471916_3472360_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3472339_3472858_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001315854.1|3472985_3473621_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147619.1|3473693_3474734_+	permease	NA	NA	NA	NA	NA
WP_113440787.1|3474847_3475423_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3475432_3476023_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|3476042_3476438_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249144.1|3476395_3478432_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809253.1|3478495_3479356_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 271
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3502371	3503517	4992761		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3502371_3503517_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 272
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3511836	3514131	4992761		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3511836_3514131_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 273
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3540364	3541330	4992761		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3540364_3541330_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 274
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3553751	3569946	4992761	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082883.1|3553751_3556844_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.0e-158
WP_000212465.1|3557027_3558011_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3558229_3558562_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|3558603_3559983_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|3560400_3561921_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|3562074_3562698_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065909.1|3562985_3563750_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3564003_3564510_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3564588_3566430_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3566624_3568370_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3568480_3568696_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264360.1|3568932_3569946_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	8.2e-109
>prophage 275
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3576328	3577567	4992761	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|3576328_3577567_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 276
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3582704	3584138	4992761		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3582704_3584138_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 277
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3593653	3604615	4992761		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3593653_3594307_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3594567_3594738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3594795_3595569_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001299419.1|3595711_3596500_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3596537_3597698_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3597703_3598375_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3598522_3600004_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3600208_3600838_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3600838_3601261_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3601285_3602113_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3602112_3602694_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3602722_3604615_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 278
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3616726	3627549	4992761		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|3616726_3617119_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|3617171_3617654_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|3618199_3620458_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3620690_3621428_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3621502_3622915_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3623025_3625245_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3625287_3625545_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|3625595_3626522_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3626721_3627549_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 279
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3633625	3634510	4992761		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3633625_3634510_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 280
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3658002	3659175	4992761		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3658002_3659175_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 281
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3673531	3745269	4992761	transposase,integrase,protease	Enterobacteria_phage(22.22%)	58	3690151:3690171	3745444:3745464
WP_001034504.1|3673531_3678100_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001317326.1|3678239_3679049_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001349452.1|3679114_3679525_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001317325.1|3679542_3680502_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498824.1|3680531_3682592_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249368.1|3682591_3684085_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173448.1|3684084_3685308_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|3685324_3685780_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115139.1|3685783_3686347_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820125.1|3686343_3686715_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255030.1|3686711_3687317_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633239.1|3687313_3688291_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094989.1|3688287_3689466_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942795.1|3689467_3690004_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
3690151:3690171	attL	AGTGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
WP_000779483.1|3690417_3690744_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|3690740_3691004_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000014510.1|3691075_3691942_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839255.1|3692026_3692224_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761662.1|3692235_3692724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854896.1|3692720_3693098_-	toxin	NA	NA	NA	NA	NA
WP_024175300.1|3693144_3693519_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692358.1|3693681_3693903_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186727.1|3693965_3694442_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214386.1|3694457_3694943_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.9e-12
WP_033884686.1|3695032_3695851_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.4e-45
WP_001117568.1|3695941_3696175_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_113440878.1|3696245_3699092_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069783.1|3699463_3700336_-	GTPase family protein	NA	NA	NA	NA	NA
WP_024213478.1|3700843_3701602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351765.1|3701774_3702719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000263652.1|3705321_3706497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|3708184_3708400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813431.1|3708872_3709475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371489.1|3709568_3709775_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001335904.1|3710160_3710952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|3712456_3713619_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001124813.1|3714046_3715267_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	1.6e-63
WP_024165505.1|3715496_3717242_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000021267.1|3717423_3718053_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_000977392.1|3718642_3719434_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001562691.1|3719452_3721423_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_136750695.1|3721597_3721759_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878009.1|3722533_3723553_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071525616.1|3723694_3723886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001367505.1|3723867_3724125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367551.1|3724298_3724514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032733.1|3724734_3724992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401034.1|3725060_3726758_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001228922.1|3726853_3727990_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.8e-117
WP_000634450.1|3730139_3730877_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000264907.1|3736735_3736927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323314.1|3736960_3737284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045149369.1|3737671_3738094_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	44.3	2.8e-26
WP_001371002.1|3738110_3739154_-	subtilase AB5 cytotoxin subunit A	NA	NA	NA	NA	NA
WP_000719907.1|3739943_3740690_+	porin family protein	NA	NA	NA	NA	NA
WP_001026217.1|3740851_3742354_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000999862.1|3742712_3743756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218745.1|3744084_3745269_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	4.4e-122
3745444:3745464	attR	AGTGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
>prophage 282
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3769309	3770464	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3769309_3770464_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 283
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3784040	3784718	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|3784040_3784718_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 284
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3802724	3803957	4992761		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3802724_3803957_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 285
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3812484	3817852	4992761		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195050.1|3812484_3815358_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
WP_000951964.1|3815618_3816362_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001363803.1|3816418_3817852_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
>prophage 286
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3821657	3837049	4992761	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3821657_3822554_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|3822578_3823289_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|3823294_3825028_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3825118_3826216_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3826226_3827744_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192804.1|3827786_3828335_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3828389_3828461_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3828457_3828583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3828584_3830033_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001367088.1|3830468_3832388_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3832387_3832876_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3832911_3834279_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3834314_3835631_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|3835648_3837049_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 287
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3861328	3862084	4992761		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3861328_3862084_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 288
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3884911	3887399	4992761		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|3884911_3885673_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|3885980_3887399_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 289
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3897030	3903803	4992761		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3897030_3897744_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3897812_3898502_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3899186_3899717_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3899729_3901976_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3902126_3903002_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3903008_3903803_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 290
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3909280	3924667	4992761	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138163.1|3909280_3912169_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
WP_001285985.1|3912161_3915704_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|3915703_3917530_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|3917591_3918923_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3919154_3920408_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|3920987_3922085_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|3922161_3922968_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184253.1|3923018_3923462_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|3923461_3924667_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 291
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3936193	3936949	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3936193_3936949_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 292
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3941807	3942656	4992761		Vibrio_phage(100.0%)	1	NA	NA
WP_000100394.1|3941807_3942656_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 293
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3950190	3954305	4992761		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|3950190_3952947_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046790.1|3953003_3954305_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 294
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3958337	3964180	4992761		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
WP_000210878.1|3958337_3959975_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3960062_3961361_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000034929.1|3961416_3961779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793004.1|3961814_3962720_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001379137.1|3962733_3963336_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199982.1|3963508_3964180_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 295
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	3972183	4018539	4992761	tRNA,transposase	Escherichia_phage(47.06%)	43	NA	NA
WP_001300563.1|3972183_3973296_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001233938.1|3973533_3976233_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_001084076.1|3976330_3977893_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_000029315.1|3977889_3978426_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_000206429.1|3978440_3979496_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_000085053.1|3979506_3980253_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_000281423.1|3980234_3980885_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_000144848.1|3980881_3981805_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_000063176.1|3981801_3982095_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_000490440.1|3982974_3984012_-	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_000372108.1|3984263_3985172_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_001090346.1|3985173_3986601_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
WP_001173673.1|3986600_3987206_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001246104.1|3987255_3987579_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_000517476.1|3987772_3988084_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_000246136.1|3988102_3988813_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001219242.1|3988812_3989292_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000568943.1|3989288_3990338_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001295182.1|3990318_3991080_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3991073_3991700_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3991839_3992979_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3993041_3994034_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208070.1|3994154_3994562_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767707.1|3994708_3995302_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863223.1|3995301_3996729_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562984.1|3996739_3996976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104439.1|3997014_3998379_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|3998467_3999244_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3999248_3999887_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3999883_4001146_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4001142_4002051_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4002246_4003014_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001067858.1|4003869_4004574_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|4005341_4006046_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001452812.1|4006157_4006871_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|4007087_4008302_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001323889.1|4009273_4010851_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001067858.1|4011498_4012203_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012477564.1|4012969_4013560_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|4013696_4014269_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	38.5	9.9e-19
WP_001493761.1|4014305_4015697_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|4016476_4017133_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067858.1|4017834_4018539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 296
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4021756	4028546	4992761	transposase	Escherichia_phage(66.67%)	4	NA	NA
WP_001067858.1|4021756_4022461_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000656305.1|4023257_4023635_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|4023835_4024495_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001272898.1|4025984_4028546_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 297
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4046374	4047385	4992761		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001374632.1|4046374_4047385_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 298
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4054958	4055924	4992761		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4054958_4055924_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 299
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4061390	4066950	4992761	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4061390_4061888_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4061967_4063029_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4063271_4063772_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|4063899_4066530_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4066764_4066950_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 300
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4080133	4085429	4992761		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4080133_4081336_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|4081690_4082650_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246542.1|4082659_4084804_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.8e-196
WP_000080944.1|4084776_4085187_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223235.1|4085183_4085429_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	2.4e-06
>prophage 301
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4089364	4093415	4992761		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4089364_4089814_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4089814_4090477_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4090497_4091898_-	GABA permease	NA	NA	NA	NA	NA
WP_000097674.1|4092134_4093415_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	1.1e-33
>prophage 302
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4102896	4161353	4992761	plate,integrase,tRNA,transposase,tail,protease,terminase,capsid,head,portal,holin	Shigella_phage(33.33%)	74	4092500:4092514	4138569:4138583
4092500:4092514	attL	CGCAGGCAATCGGGT	NA	NA	NA	NA
WP_000340076.1|4102896_4103085_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
WP_001120794.1|4103239_4103359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950812.1|4103863_4105077_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
WP_085947771.1|4105136_4106299_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000188801.1|4106396_4108649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113815.1|4108787_4110029_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_053272596.1|4110344_4111163_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.6	4.6e-118
WP_001293201.1|4111166_4111415_-	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
WP_172615532.1|4111710_4112886_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.1	3.6e-148
WP_001331174.1|4112846_4113053_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|4113112_4113328_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_172615533.1|4113324_4113687_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	95.8	3.7e-64
WP_172615534.1|4113677_4114214_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	4.8e-100
WP_000917896.1|4114890_4115187_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450735.1|4115372_4115999_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|4116096_4116297_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|4116334_4116886_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|4117061_4117241_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|4117230_4118172_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_172615535.1|4118168_4118663_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	2.4e-85
WP_000210164.1|4118662_4118989_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_021574731.1|4118985_4119375_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_172615536.1|4119394_4120192_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	2.9e-149
WP_104770090.1|4120199_4121189_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_058589848.1|4121202_4121955_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.8e-137
WP_002432029.1|4122105_4122363_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	1.6e-37
WP_001283167.1|4122442_4122829_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	99.2	2.7e-60
WP_000422366.1|4122815_4123097_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_097466065.1|4123096_4123711_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.5	1.4e-111
WP_023277412.1|4123707_4124100_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	90.6	2.8e-57
WP_023277411.1|4124271_4124466_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	4.3e-27
WP_023277410.1|4124518_4124860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615537.1|4124999_4125350_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	79.3	2.3e-50
WP_000929187.1|4125479_4125974_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	2.5e-87
WP_122988558.1|4126207_4127704_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	3.1e-290
WP_000838374.1|4127700_4127862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923137.1|4127851_4129078_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.0	1.1e-240
WP_172615538.1|4129070_4129673_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	3.4e-110
WP_072644932.1|4129683_4130913_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	5.8e-226
WP_000924828.1|4130991_4131315_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|4131311_4131722_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224835.1|4131696_4132203_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_072644931.1|4132199_4132760_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|4132768_4132939_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_172615539.1|4132922_4134419_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.8	1.1e-274
WP_000090997.1|4134418_4134775_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_000661054.1|4134774_4135044_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_172615540.1|4135185_4137018_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.5	7.0e-300
WP_000679479.1|4137109_4137640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172615541.1|4137701_4139030_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.3	1.9e-243
4138569:4138583	attR	ACCCGATTGCCTGCG	NA	NA	NA	NA
WP_000999503.1|4139026_4140106_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_015364403.1|4140105_4140654_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424732.1|4140653_4141079_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_172615542.1|4141065_4142124_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.6e-200
WP_172615543.1|4142114_4142699_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.6e-112
WP_024189877.1|4143715_4144072_+|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	49.6	1.8e-23
WP_172615564.1|4144140_4144686_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.6	1.1e-83
WP_024245926.1|4144793_4145213_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.0	1.4e-33
WP_053272582.1|4145215_4146484_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	85.5	4.3e-216
WP_021574712.1|4146607_4148356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021574711.1|4149075_4149909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|4150658_4151141_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4151272_4151749_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4151738_4152029_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4152090_4152432_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4152580_4154242_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4154327_4155206_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4155328_4155922_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4155976_4157263_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001407013.1|4157283_4158075_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4158241_4159603_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4159739_4159988_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4160006_4160555_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4160585_4161353_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 303
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4164775	4165846	4992761		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|4164775_4165846_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 304
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4171752	4174326	4992761		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4171752_4174326_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 305
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4180189	4181488	4992761		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4180189_4181488_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 306
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4186781	4193039	4992761	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4186781_4187201_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997411.1|4187407_4188445_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4188492_4189182_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627807.1|4189486_4189870_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189206.1|4189924_4190512_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4190614_4191496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4191704_4193039_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 307
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4198810	4202553	4992761		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4198810_4200610_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4200625_4201600_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4201872_4202553_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 308
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4206011	4206272	4992761		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4206011_4206272_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 309
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4210391	4221699	4992761		Bacillus_phage(50.0%)	7	NA	NA
WP_000970122.1|4210391_4214279_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
WP_001297612.1|4214854_4216282_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|4216446_4217160_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4217149_4218484_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4218544_4218883_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4218927_4220118_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4220445_4221699_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 310
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4227452	4228964	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493473.1|4227452_4228964_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 311
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4244128	4250585	4992761		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4244128_4245343_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4245370_4245757_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4245773_4246097_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4246192_4246708_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_113440657.1|4246724_4248575_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	1.2e-102
WP_001124469.1|4248576_4248912_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4248923_4249124_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|4249301_4250585_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 312
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4260470	4260902	4992761		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4260470_4260902_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 313
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4269731	4276214	4992761		Escherichia_phage(66.67%)	7	NA	NA
WP_000937933.1|4269731_4271102_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|4271263_4272730_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4272798_4274376_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755179.1|4274468_4275008_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
WP_001317257.1|4275023_4275542_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|4275852_4276044_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4276061_4276214_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 314
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4282460	4286462	4992761		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4282460_4283099_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4283098_4284136_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4284460_4285087_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4285172_4286462_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 315
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4307503	4308217	4992761		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4307503_4308217_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 316
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4326264	4327215	4992761		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4326264_4327215_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 317
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4345769	4350707	4992761		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|4345769_4346639_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4346852_4347278_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|4347264_4347714_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|4347774_4348350_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4348445_4349345_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|4349402_4350707_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 318
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4354185	4369555	4992761		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|4354185_4354977_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290223.1|4355147_4356164_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|4356163_4356997_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4356996_4357872_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|4357861_4358959_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_029488409.1|4359092_4360004_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	2.2e-57
WP_000719943.1|4360006_4360375_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|4360479_4361331_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4361372_4361882_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4361922_4363650_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4363694_4363952_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034408.1|4364335_4365307_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.2e-74
WP_000254839.1|4365491_4366253_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|4366482_4367469_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4367539_4369555_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 319
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4391098	4391833	4992761		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4391098_4391833_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 320
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4395651	4396572	4992761		Morganella_phage(100.0%)	1	NA	NA
WP_113440913.1|4395651_4396572_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 321
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4400263	4407840	4992761		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|4400263_4401958_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4402027_4402972_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|4403045_4404191_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001348569.1|4404246_4407840_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 322
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4414493	4415927	4992761		Bacillus_phage(100.0%)	1	NA	NA
WP_032219946.1|4414493_4415927_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.2	1.2e-28
>prophage 323
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4418961	4419894	4992761		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4418961_4419894_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 324
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4437756	4438842	4992761		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4437756_4438842_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 325
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4447424	4448561	4992761		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699122.1|4447424_4448561_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 326
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4455037	4456555	4992761		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4455037_4456555_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 327
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4460766	4462639	4992761		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4460766_4461540_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|4461736_4462639_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 328
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4473198	4476426	4992761		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203410.1|4473198_4473849_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|4473935_4475768_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813848.1|4475826_4476426_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
>prophage 329
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4510841	4515845	4992761		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|4510841_4512824_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|4512823_4513792_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001342601.1|4513795_4514935_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_001297077.1|4515242_4515845_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 330
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4518997	4519900	4992761	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_113440915.1|4518997_4519900_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	3.1e-67
>prophage 331
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4525793	4531795	4992761		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779084.1|4525793_4526870_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|4527332_4527983_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4528036_4528291_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4528290_4529421_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_096971325.1|4529509_4531795_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.5e-283
>prophage 332
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4537221	4539849	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|4537221_4539849_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 333
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4549549	4552399	4992761		Hokovirus(100.0%)	1	NA	NA
WP_172615548.1|4549549_4552399_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 334
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4556676	4562475	4992761		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865609.1|4556676_4557801_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
WP_000406098.1|4557912_4558968_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710368.1|4559041_4560106_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|4560105_4560756_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|4560831_4562475_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 335
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4571242	4571860	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4571242_4571860_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 336
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4583559	4591207	4992761		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4583559_4584567_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|4584705_4584990_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578076.1|4585114_4586875_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|4587023_4587719_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|4587746_4588937_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|4589269_4589614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194928.1|4589617_4591207_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 337
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4596961	4601262	4992761		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241012.1|4596961_4597528_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|4597939_4598653_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|4598691_4599678_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848214.1|4599795_4601262_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 338
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4615760	4616618	4992761		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4615760_4616618_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 339
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4620687	4624480	4992761		Acinetobacter_phage(50.0%)	4	NA	NA
WP_172615549.1|4620687_4622085_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.4e-13
WP_001703890.1|4622077_4622686_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000425462.1|4622717_4623554_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4623811_4624480_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 340
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4628174	4629695	4992761		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4628174_4629695_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 341
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4650007	4659451	4992761		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|4650007_4650934_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4650938_4651670_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4651650_4651758_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4651817_4652549_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4652770_4654456_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4654452_4655172_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4655218_4655689_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001373589.1|4655728_4656190_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001373876.1|4656314_4658318_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_072756770.1|4658314_4659451_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 342
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4671083	4673117	4992761	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|4671083_4673117_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 343
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4683765	4687322	4992761		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001373513.1|4683765_4684584_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
WP_000434045.1|4684635_4685382_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011950.1|4685355_4686321_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|4686317_4687322_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 344
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4696542	4702649	4992761	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000807356.1|4696542_4697442_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|4697847_4698165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|4698495_4699857_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|4700003_4700336_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|4700526_4701249_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|4701245_4702649_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 345
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4716090	4717443	4992761		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|4716090_4717443_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 346
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4722169	4732560	4992761		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|4722169_4722811_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|4722902_4723484_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001683007.1|4723505_4725359_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001296218.1|4725632_4727216_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|4727416_4727566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|4727874_4729014_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|4729019_4729463_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_001683006.1|4729465_4731628_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|4731720_4732560_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 347
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4736803	4743597	4992761		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|4736803_4737925_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043652.1|4737927_4738893_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.4e-86
WP_000479826.1|4738895_4739375_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699721.1|4739371_4740595_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|4740597_4742034_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001356294.1|4742226_4743597_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
>prophage 348
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4749309	4752998	4992761		Klebsiella_phage(33.33%)	3	NA	NA
WP_001683004.1|4749309_4750704_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|4750861_4751857_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001683003.1|4752098_4752998_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
>prophage 349
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4758869	4761690	4992761		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001683000.1|4758869_4760276_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000704889.1|4760523_4761690_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	5.0e-110
>prophage 350
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4769047	4769947	4992761		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|4769047_4769947_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 351
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4777591	4778758	4992761		Stx2-converting_phage(100.0%)	1	NA	NA
WP_042031746.1|4777591_4778758_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.1e-226
>prophage 352
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4783190	4785342	4992761		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|4783190_4783412_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186710.1|4783474_4783951_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860065.1|4783962_4784442_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234631.1|4784523_4785342_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.1e-44
>prophage 353
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4801547	4877929	4992761	integrase,transposase,tail,terminase,capsid,head,holin	Escherichia_phage(47.17%)	75	4819896:4819911	4856359:4856374
WP_000567766.1|4801547_4801913_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
WP_162535843.1|4801915_4802257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000973159.1|4804715_4805261_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|4805257_4806001_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_042031606.1|4806012_4807092_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986331.1|4807153_4808089_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|4808546_4809464_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_113440890.1|4809565_4810516_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|4810633_4812277_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|4812906_4813623_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|4813965_4815420_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378575.1|4815521_4816838_-	shikimate transporter	NA	NA	NA	NA	NA
WP_172615553.1|4818466_4825543_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
4819896:4819911	attL	AGCGTTGCCGTCAGAG	NA	NA	NA	NA
WP_001474389.1|4826030_4826828_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533611.1|4827063_4828089_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	1.7e-101
WP_000096347.1|4828088_4828292_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_172615554.1|4828350_4830795_-	3'-5' exoribonuclease	NA	V5UQJ3	Shigella_phage	58.8	1.1e-178
WP_042969578.1|4830887_4831076_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_063106819.1|4831072_4831261_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935583.1|4831271_4832126_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	65.7	8.5e-67
WP_000380312.1|4832621_4832774_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000233320.1|4833066_4833486_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|4833565_4833820_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_113440923.1|4833816_4834242_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_062857679.1|4834264_4835218_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	53.2	3.1e-73
WP_113440922.1|4835224_4835965_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	8.1e-114
WP_172615555.1|4835994_4836720_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.3	1.9e-83
WP_113440811.1|4836735_4837131_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.5	1.2e-31
WP_113440812.1|4837127_4837433_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	4.4e-50
WP_113440813.1|4837582_4838008_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	83.0	1.1e-14
WP_000206823.1|4838521_4838866_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
WP_157910004.1|4838988_4839162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062863467.1|4839350_4839563_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	75.7	4.4e-17
WP_088888715.1|4839731_4840004_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.0e-10
WP_113440717.1|4840005_4841055_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000904153.1|4841067_4841427_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	5.6e-36
WP_000640044.1|4841435_4841996_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_000917768.1|4842212_4842410_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_113440770.1|4842560_4843619_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.3	9.5e-193
WP_073547487.1|4844080_4844512_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	95.8	3.6e-66
WP_000216624.1|4844508_4844673_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_000143458.1|4847263_4847443_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|4847483_4847729_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_113440684.1|4847806_4848022_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.6e-33
WP_001041949.1|4848025_4848817_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092874.1|4849328_4849862_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|4850018_4850201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072057482.1|4850569_4850776_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_047083440.1|4850840_4851065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|4851519_4852029_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_044721865.1|4852000_4853929_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.0e-261
WP_000259002.1|4853912_4854119_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_113440850.1|4855696_4857202_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.1	3.0e-99
4856359:4856374	attR	AGCGTTGCCGTCAGAG	NA	NA	NA	NA
WP_000256795.1|4857238_4857586_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_033804227.1|4857643_4858672_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_033804228.1|4858723_4859107_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204533.1|4859099_4859453_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000234888.1|4859468_4860047_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	89.1	2.3e-71
WP_021574153.1|4860043_4860439_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	82.4	1.5e-58
WP_063105109.1|4860446_4861196_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	95.6	1.9e-131
WP_033806765.1|4861212_4861644_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.0	2.6e-40
WP_071997252.1|4861670_4862084_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	85.9	2.2e-44
WP_172615556.1|4862064_4864626_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	89.3	0.0e+00
WP_000847280.1|4864622_4864952_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_062874514.1|4864951_4865650_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	1.5e-130
WP_113440789.1|4865660_4866404_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	9.5e-147
WP_113440790.1|4866301_4866940_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	98.9	1.5e-95
WP_172615557.1|4867364_4870832_+	host specificity protein J	NA	S5MW25	Escherichia_phage	97.1	0.0e+00
WP_044191898.1|4871030_4871171_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_113440704.1|4871313_4872714_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	91.6	9.5e-148
WP_001367204.1|4872723_4872948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113440703.1|4872944_4873613_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	88.6	2.6e-111
WP_113440702.1|4874104_4875376_+	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	56.4	1.8e-97
WP_113440706.1|4875462_4875936_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	88.5	5.4e-79
WP_001079074.1|4877398_4877929_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 354
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4881473	4893966	4992761		Bacillus_phage(40.0%)	12	NA	NA
WP_001339045.1|4881473_4882145_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_001422416.1|4882144_4883503_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218232.1|4883610_4884462_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001373147.1|4884717_4884930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001422414.1|4885053_4886247_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.8	5.7e-101
WP_047627286.1|4887209_4887905_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	9.5e-08
WP_001157222.1|4887971_4889390_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000785987.1|4889370_4889841_+	VSPR family DNA mismatch endonuclease	NA	NA	NA	NA	NA
WP_001212226.1|4889829_4890750_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|4890922_4891840_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|4891918_4892101_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077632748.1|4892271_4893966_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	5.0e-18
>prophage 355
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4907980	4908649	4992761		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334569.1|4907980_4908649_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.6e-81
>prophage 356
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4920469	4921222	4992761		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4920469_4921222_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 357
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4933214	4934729	4992761		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|4933214_4934729_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 358
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4944816	4950460	4992761		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|4944816_4946478_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483239.1|4946523_4948125_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_000204337.1|4948143_4949004_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036360.1|4949006_4950056_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000763867.1|4950070_4950460_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 359
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4955712	4957446	4992761	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|4955712_4957446_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 360
NZ_CP053731	Escherichia coli strain CP55_Sichuan chromosome, complete genome	4992761	4964062	4991912	4992761	transposase,lysis,holin	Enterobacteria_phage(37.84%)	41	NA	NA
WP_000019588.1|4964062_4964806_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|4964846_4965242_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_170991873.1|4965294_4966071_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_001537108.1|4966075_4967362_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	97.7	2.5e-248
WP_033804497.1|4967395_4967650_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	5.7e-43
WP_000457723.1|4967806_4968049_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628767.1|4968133_4969078_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	58.6	2.6e-80
WP_113440788.1|4969591_4969942_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.3	3.2e-28
WP_000015506.1|4969938_4970163_-	hypothetical protein	NA	Q286X0	Escherichia_phage	100.0	1.2e-36
WP_001242710.1|4970159_4970771_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
WP_000008177.1|4970761_4971298_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_001537101.1|4971426_4972251_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.0e-149
WP_000135680.1|4972316_4972679_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4973401_4974094_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191669.1|4974191_4974452_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001537100.1|4974444_4975002_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	94.1	7.0e-94
WP_001537099.1|4974998_4976150_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	83.6	3.8e-179
WP_000620694.1|4976146_4976371_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	93.2	2.9e-35
WP_000995577.1|4976367_4976667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|4977589_4978702_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_012601564.1|4978992_4979487_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	87.2	1.5e-76
WP_001537098.1|4979486_4980140_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	1.4e-125
WP_000210143.1|4980136_4980463_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|4980459_4980855_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|4981017_4981833_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001223333.1|4981848_4982364_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_001537097.1|4982373_4983363_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_085960473.1|4983377_4983773_+	DUF1133 family protein	NA	S5M7R9	Escherichia_phage	92.1	1.4e-61
WP_016232130.1|4983974_4984172_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.0e-28
WP_089563324.1|4985228_4987208_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	59.6	2.2e-219
WP_024194314.1|4987348_4987543_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001537095.1|4987568_4987838_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	3.7e-08
WP_000284506.1|4987913_4988129_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001537094.1|4988132_4988663_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	82.5	5.9e-50
WP_001537093.1|4988896_4989430_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	94.9	1.5e-98
WP_052834940.1|4989586_4989769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537092.1|4989781_4989925_+	hypothetical protein	NA	Q5MBV9	Stx1-converting_phage	71.8	4.3e-08
WP_001537088.1|4989921_4990389_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.6e-75
WP_001537087.1|4990565_4991114_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	90.3	3.8e-84
WP_000095740.1|4991304_4991505_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	2.1e-29
WP_000829192.1|4991546_4991912_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
>prophage 1
NZ_CP053733	Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence	141846	67058	79535	141846	transposase	Stx2-converting_phage(75.0%)	10	NA	NA
WP_001536670.1|67058_67709_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.8e-16
WP_001536669.1|67708_68056_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	5.4e-44
WP_001536666.1|70213_72262_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
WP_001171554.1|74120_74501_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_142905907.1|74497_74656_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.4e-23
WP_077761304.1|74662_74845_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.1e-27
WP_172615575.1|74894_76433_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	7.9e-297
WP_000264909.1|76655_76847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536659.1|76856_77222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|78383_79535_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
>prophage 1
NZ_CP053732	Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence	156025	1262	75975	156025	integrase,protease,transposase,bacteriocin	Enterobacteria_phage(30.0%)	57	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|2685_3588_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|7766_8979_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_000450494.1|9963_11157_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000738422.1|14242_14536_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|17686_18802_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111199.1|18941_22601_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_172615565.1|22704_23934_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|24018_24975_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|25019_27197_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|28051_29086_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000142437.1|29644_29992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|30293_30776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001058005.1|30892_31741_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.5	3.8e-27
WP_000969990.1|31786_32068_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|32064_32334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000489607.1|34288_35563_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_109045958.1|35537_37652_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|37821_38133_-	colicin V	NA	NA	NA	NA	NA
WP_014640552.1|38110_38347_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001300563.1|38618_39731_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001105066.1|40160_40442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113440680.1|40799_41327_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|41570_42386_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|42435_42789_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|42966_43758_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_089583722.1|43754_44444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|44487_44838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990619.1|45629_45920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112916244.1|47578_51655_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	43.1	1.6e-264
WP_001159649.1|51840_52608_-	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	1.7e-29
WP_000160640.1|52776_53391_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001219114.1|53428_54139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113440678.1|54166_54649_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.3	2.0e-60
WP_001067855.1|54688_55393_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001214976.1|56707_57115_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|57252_58137_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|58168_59368_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|59473_60124_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|60155_60398_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|62035_62740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|63110_66077_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|66155_67160_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|67341_67518_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|67847_68663_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082320.1|68723_69527_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|69526_70363_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|70593_71454_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|71636_72194_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|72622_73327_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001398199.1|74637_75039_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|74971_75229_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|75321_75975_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
