The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	682287	738076	4815440	transposase,integrase,tRNA	Salmonella_phage(23.08%)	39	669324:669339	710115:710130
669324:669339	attL	CCGCAACGGGCTGGAT	NA	NA	NA	NA
WP_000450589.1|682287_682620_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|682661_684041_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|684458_685979_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|686132_686756_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|687032_687797_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_023486172.1|688093_689410_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
WP_032228599.1|689539_690136_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	1.6e-96
WP_172615447.1|690222_691860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022145.1|692551_692779_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120392.1|692884_693112_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335694.1|693360_694794_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_130053454.1|695702_696266_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_172615448.1|696530_697499_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.1e-184
WP_172615340.1|697495_698896_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	1.3e-19
WP_020219275.1|700258_702679_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_172615449.1|702687_704706_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_071961403.1|704698_706024_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_020219278.1|706025_706439_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_034167421.1|706489_707278_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	3.0e-90
WP_001354443.1|707368_708355_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.4e-166
WP_000053329.1|708780_709791_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_000433621.1|709884_712011_+	alpha-galactosidase	NA	NA	NA	NA	NA
710115:710130	attR	CCGCAACGGGCTGGAT	NA	NA	NA	NA
WP_016240679.1|712065_713343_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813683.1|713339_714770_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_000523728.1|714833_715349_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001313182.1|715354_715558_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313183.1|715619_715931_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000108760.1|715960_716887_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000716410.1|716986_718483_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001407279.1|723293_725717_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	6.0e-25
WP_112923079.1|725723_727037_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_063085660.1|727046_728210_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_064055656.1|728224_731242_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_016240669.1|731454_731805_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	4.0e-39
WP_072661607.1|733279_733474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170386723.1|733549_734521_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|734716_736342_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_072661597.1|736413_736713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|736876_738076_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	1120437	1127577	4815440		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1120437_1121076_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1121072_1122335_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1122331_1123240_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1123435_1124203_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1124253_1124910_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1125015_1127577_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	1506803	1590751	4815440	head,capsid,integrase,plate,transposase,terminase,tRNA,tail,portal,holin	Enterobacteria_phage(84.78%)	91	1549536:1549559	1594567:1594590
WP_172615445.1|1506803_1508012_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	5.2e-235
WP_001593549.1|1508734_1509370_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000694697.1|1509388_1510996_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_000614781.1|1511495_1512392_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000936490.1|1512388_1513285_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_001593546.1|1513274_1514831_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	29.7	9.3e-19
WP_124038685.1|1515713_1515893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595306.1|1516016_1516382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218588.1|1516451_1517075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929405.1|1517178_1517511_-	YegP family protein	NA	NA	NA	NA	NA
WP_000908413.1|1518289_1519648_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001136879.1|1519650_1520307_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_106464772.1|1520721_1521984_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.8	1.5e-80
WP_000368131.1|1522310_1523243_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|1523536_1524292_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937840.1|1524473_1525532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|1525897_1527238_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1527609_1527894_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|1528073_1529384_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425059.1|1529383_1531528_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1531730_1532216_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|1532890_1533454_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112827.1|1533535_1536178_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281620.1|1536197_1536950_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|1536924_1537473_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1537469_1537940_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730293.1|1537936_1538461_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001356216.1|1538447_1539320_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|1539441_1539993_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001309606.1|1540158_1541091_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1541125_1542211_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043799.1|1542214_1543039_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1543038_1543848_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089232.1|1543847_1544396_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1544429_1544708_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000399648.1|1544956_1545937_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000683808.1|1546107_1548114_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1548272_1549493_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1549536:1549559	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127778.1|1549785_1550964_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1550960_1551956_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_072643722.1|1552224_1553118_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001173929.1|1553122_1553455_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1553717_1553858_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1554048_1554309_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_025653455.1|1554351_1555461_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.5e-204
WP_000005386.1|1555618_1556803_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000290462.1|1556802_1557315_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|1557370_1557745_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|1557753_1557909_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_072643723.1|1557895_1560703_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.3	0.0e+00
WP_000979955.1|1560715_1561204_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954202.1|1561360_1561933_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_072643724.1|1561976_1562555_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	3.5e-96
WP_072643725.1|1562554_1564897_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.1	4.1e-111
WP_072643726.1|1564899_1565430_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
WP_072643727.1|1565422_1566319_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_001380508.1|1566322_1566652_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.4e-54
WP_077249966.1|1566669_1567236_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	6.6e-100
WP_077249964.1|1567247_1567883_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_000920594.1|1567875_1568343_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780545.1|1568480_1568888_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
WP_000072327.1|1568884_1569277_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_072643729.1|1569273_1569597_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
WP_000864897.1|1569599_1569800_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_001297578.1|1569799_1570294_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_001297575.1|1570395_1571196_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
WP_001055119.1|1571241_1572294_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_032191985.1|1572317_1573154_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_072643730.1|1573308_1575060_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.4	0.0e+00
WP_000087812.1|1575059_1576106_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001068329.1|1576754_1577252_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_025653443.1|1577291_1578134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025653442.1|1578217_1578532_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	53.3	1.4e-19
WP_001504475.1|1578536_1579496_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_072643731.1|1579572_1582413_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.0	0.0e+00
WP_000564228.1|1582409_1582799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447282.1|1582795_1583413_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|1583424_1583724_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153674.1|1583720_1583966_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985159.1|1583962_1584166_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021656.1|1584252_1584366_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514283.1|1584362_1584605_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158962.1|1584616_1584904_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813367.1|1584914_1585256_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
WP_000200501.1|1585508_1585715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1585721_1586009_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1586122_1586443_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023401.1|1586539_1587544_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_025653439.1|1587702_1588860_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	6.0e-23
WP_032239947.1|1588925_1589939_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|1589938_1590751_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1594567:1594590	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 4
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	1790295	1799737	4815440		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1790295_1791222_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1791226_1791958_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1791938_1792046_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1792105_1792837_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1793058_1794744_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1794740_1795460_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1795506_1795977_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1796017_1796479_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1796603_1798604_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1798600_1799737_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	1812248	1868510	4815440	head,capsid,integrase,plate,terminase,lysis,tRNA,tail,portal,holin	Escherichia_phage(47.06%)	63	1839496:1839523	1863426:1863453
WP_001295427.1|1812248_1814282_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005440.1|1814413_1815523_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001351454.1|1815785_1816067_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1816359_1816902_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677398.1|1816982_1817657_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945409.1|1817672_1820153_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|1820166_1821201_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1821282_1821621_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|1821839_1822664_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1822784_1823057_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|1823279_1824068_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1824064_1824865_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_053264383.1|1824929_1825748_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1825799_1826546_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1826519_1827485_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1827481_1828486_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1828482_1829760_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1830016_1831069_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001307281.1|1831376_1832231_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853886.1|1832259_1833522_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182903.1|1833531_1833984_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823287.1|1834014_1834299_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490693.1|1834302_1835658_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844264.1|1835705_1836746_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1836845_1837625_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1837706_1838606_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1839020_1839338_+	hypothetical protein	NA	NA	NA	NA	NA
1839496:1839523	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1839602_1840616_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1840731_1841031_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1841145_1841421_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1841431_1841602_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217677.1|1841598_1842099_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|1842162_1842387_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277897.1|1842386_1842689_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_001113163.1|1842688_1842913_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	5.0e-35
WP_000027664.1|1842909_1843185_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_021577683.1|1845419_1846667_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_047669217.1|1846653_1848486_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023351983.1|1848831_1849866_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.6e-200
WP_000156861.1|1849865_1851638_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|1851811_1852666_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_047669220.1|1852724_1853798_+|capsid	phage major capsid protein, P2 family	capsid	Q94ME5	Enterobacteria_phage	99.7	1.3e-200
WP_047669221.1|1853801_1854539_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	3.4e-128
WP_000988633.1|1854638_1855148_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|1855147_1855351_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|1855354_1855636_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1855635_1856133_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021563761.1|1856147_1856573_+	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_047669223.1|1856560_1856986_+|lysis	LysB family phage lysis regulatory protein	lysis	M1SNP0	Escherichia_phage	94.3	4.4e-64
WP_000917186.1|1857093_1857561_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|1857553_1858006_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_047669224.1|1858077_1858863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047669225.1|1858946_1859582_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	4.2e-111
WP_047669227.1|1859578_1859926_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
WP_001121474.1|1859930_1860839_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285314.1|1860831_1861362_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_000468308.1|1863105_1863324_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1863597_1864959_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1863426:1863453	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1865061_1865358_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1865359_1865656_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1865864_1866197_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|1866387_1867110_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|1867106_1868510_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	2417070	2434825	4815440	tail,lysis	Escherichia_phage(23.53%)	23	NA	NA
WP_000598292.1|2417070_2417397_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001299931.1|2418806_2418971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|2418974_2419193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2419352_2419508_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|2419800_2420139_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|2420530_2420773_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|2420756_2421182_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|2421253_2422324_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|2422364_2422787_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|2422978_2423941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277548.1|2423956_2424958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557860.1|2425366_2425474_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_021541900.1|2425518_2425731_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.3e-29
WP_001332495.1|2426189_2426468_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_023277547.1|2426469_2427519_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904114.1|2427531_2427906_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762863.1|2427902_2428724_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000562553.1|2429617_2429749_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000839561.1|2431337_2431553_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_153060473.1|2431557_2431662_+	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_001101168.1|2431742_2432285_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_001611687.1|2432546_2434244_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.6	1.4e-174
WP_106464794.1|2434243_2434825_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.7e-103
>prophage 7
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	2636465	2645740	4815440	coat,lysis	Enterobacteria_phage(30.0%)	13	NA	NA
WP_000837924.1|2636465_2637599_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2637739_2638174_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|2638950_2639064_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|2639132_2639366_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000144678.1|2639754_2640147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2640143_2640524_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2640524_2640908_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2640907_2641303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|2641306_2641483_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_106504757.1|2641525_2642662_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	73.0	1.3e-155
WP_001097895.1|2643186_2644644_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2644840_2645026_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|2645242_2645740_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
>prophage 8
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	2655781	2674080	4815440	tRNA,holin	Escherichia_phage(66.67%)	21	NA	NA
WP_001676522.1|2655781_2657779_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2658119_2658542_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|2658582_2659653_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|2659724_2660150_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2660146_2660401_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2660480_2660900_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|2661331_2661487_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2661483_2661972_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2662413_2662635_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2662634_2662805_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2662879_2663155_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001532611.1|2663256_2665857_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2665849_2666659_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2666715_2666910_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2666902_2667112_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2667190_2667406_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2667407_2668643_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|2668694_2669630_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|2669758_2671132_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2671609_2672593_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2672847_2674080_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP053723	Escherichia coli strain CP66-6_Sichuan chromosome, complete genome	4815440	3770859	3777325	4815440	integrase	Shigella_phage(50.0%)	6	3766167:3766180	3773411:3773424
3766167:3766180	attL	ATTTAAATCAATAA	NA	NA	NA	NA
WP_106743334.1|3770859_3771678_+	hypothetical protein	NA	A0A0H4IU65	Shigella_phage	94.9	4.5e-150
WP_001471956.1|3771674_3772019_+	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000051887.1|3772245_3773409_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3773613_3774867_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3773411:3773424	attR	TTATTGATTTAAAT	NA	NA	NA	NA
WP_001285288.1|3774878_3775982_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3776269_3777325_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 1
NZ_CP053724	Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFIC, complete sequence	99734	0	53834	99734	transposase,integrase	Escherichia_phage(37.93%)	53	4326:4385	30992:31813
WP_000361612.1|0_978_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_063078056.1|2123_2291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172615465.1|2878_3496_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.7e-115
WP_172615465.1|3633_4251_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.7e-115
4326:4385	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4388_5093_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001814923.1|5858_5975_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_025989258.1|5990_7910_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_000336323.1|8028_8196_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000800531.1|9335_9668_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|9837_10629_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|10721_11981_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|12242_13034_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|13039_13330_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|13441_13939_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845048.1|14083_15097_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_071830595.1|15299_15650_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|15775_16336_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|16338_19290_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|19298_19700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|19784_20489_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_012728215.1|21413_22298_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|22514_23729_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|23756_24062_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|24173_25667_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|25697_25949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|25842_26145_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|26231_27047_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_172615445.1|27578_28787_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	5.2e-235
WP_170628443.1|29748_30108_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_001067855.1|30283_30988_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|32625_32868_+|transposase	transposase	transposase	NA	NA	NA	NA
30992:31813	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCCACCTATGTGCTCGACGGCC	NA	NA	NA	NA
WP_001493764.1|32899_33550_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|33655_34855_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|34886_35771_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|35908_36316_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_072796249.1|37984_38326_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	97.3	1.1e-54
WP_001067855.1|38434_39139_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|39328_40144_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|40294_40999_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|41062_41302_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|41447_42311_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|42348_42594_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|43062_43854_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_050190632.1|44111_44972_-	class A beta-lactamase TEM-215	NA	Q1MVP3	Enterobacteria_phage	99.7	5.1e-160
WP_001235713.1|45154_45712_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|46003_46708_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000939727.1|46860_47682_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_065800310.1|47813_48605_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|49603_50308_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000587837.1|50844_51387_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|51399_52260_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|53129_53834_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP053724	Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFIC, complete sequence	99734	73509	81266	99734	transposase	Escherichia_phage(50.0%)	9	NA	NA
WP_000457136.1|73509_73887_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_000457518.1|73886_75158_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000340829.1|75162_75555_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103690.1|75559_76531_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|76752_77397_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|77390_77666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001707302.1|78590_79022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304467.1|79087_79792_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.7e-137
WP_001046306.1|79940_81266_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 1
NZ_CP053725	Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence	74817	2376	31686	74817	transposase,integrase	Escherichia_phage(50.0%)	28	NA	NA
WP_039022048.1|2376_5409_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039022047.1|5412_5973_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	1.7e-47
WP_000454193.1|6103_6454_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|6656_7670_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|7814_8312_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001389365.1|8489_9254_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|9746_10331_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|10330_11569_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|11565_12471_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|12592_13297_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_034169466.1|13682_14099_+	fosfomycin resistance glutathione transferase FosA4	NA	Q2LI91	Bacillus_phage	37.7	1.1e-06
WP_034169467.1|14103_14622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|15346_16051_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023281052.1|16361_16811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152930637.1|16789_16939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021305.1|17458_17998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021304.1|18008_18458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021303.1|18441_18984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567331.1|19055_19463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567330.1|19505_19709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281053.1|19957_22006_+	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	37.8	9.5e-64
WP_023281054.1|22010_24647_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_050190632.1|24930_25791_-	class A beta-lactamase TEM-215	NA	Q1MVP3	Enterobacteria_phage	99.7	5.1e-160
WP_089613755.1|27210_28836_+	phosphoethanolamine--lipid A transferase MCR-3.5	NA	NA	NA	NA	NA
WP_039026395.1|28953_29334_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001067858.1|29471_30176_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_172615465.1|30313_30931_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.7e-115
WP_172615465.1|31068_31686_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.7e-115
