The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053708	Acetobacteraceae bacterium strain PAMC 26569 chromosome, complete genome	4799761	783321	819618	4799761	transposase	Salmonella_phage(33.33%)	27	NA	NA
WP_171833599.1|783321_784149_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.2	2.8e-22
WP_171833606.1|784085_785330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171833600.1|786209_786548_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_172443435.1|788689_789643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443436.1|789639_790827_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_172443437.1|790886_792005_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_171837923.1|792252_793026_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.9	1.3e-21
WP_172443438.1|793121_794651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443510.1|794710_795640_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172443439.1|795636_796482_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172443440.1|796478_797423_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.4e-17
WP_172443441.1|797427_798423_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.9e-18
WP_172443442.1|798419_799133_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_172443511.1|799165_800668_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_172443512.1|800685_801570_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_172443443.1|801761_804260_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_172443444.1|804259_805135_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172443445.1|805131_805923_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_172443446.1|805924_807022_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	29.5	5.9e-20
WP_172443447.1|807018_808239_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_172443448.1|810112_810913_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.2e-77
WP_172443513.1|810909_811143_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	50.6	5.1e-14
WP_172443449.1|811146_811878_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.7	1.5e-51
WP_172443450.1|811896_812700_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.5	3.2e-23
WP_171837745.1|812931_815880_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_171837768.1|816183_816891_+	response regulator	NA	NA	NA	NA	NA
WP_171837743.1|818217_819618_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053708	Acetobacteraceae bacterium strain PAMC 26569 chromosome, complete genome	4799761	842921	883343	4799761	transposase	Staphylococcus_prophage(42.86%)	43	NA	NA
WP_171837769.1|842921_843263_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_171837761.1|843758_843920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837762.1|844053_844578_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_171835345.1|844739_845243_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171837763.1|845232_845874_+	DUF1109 family protein	NA	NA	NA	NA	NA
WP_171837764.1|846271_846469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837765.1|846476_847736_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_171837766.1|848406_848787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837767.1|848819_849290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443451.1|849295_849787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443514.1|849980_851501_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.6e-124
WP_171837778.1|851511_852246_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.4	1.0e-60
WP_171837701.1|852357_852639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837706.1|853033_853885_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837700.1|855064_856633_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_171837699.1|856756_857665_-	EamA family transporter	NA	NA	NA	NA	NA
WP_171837698.1|857709_858516_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171837697.1|858543_858927_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_171837696.1|858990_859449_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_171837705.1|859445_860066_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_171837704.1|860102_860444_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_171837703.1|860571_861495_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_171837695.1|861740_862514_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_171837694.1|862677_863448_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171837693.1|863480_864350_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_171837692.1|864451_865381_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837702.1|865628_866606_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_172443452.1|867405_868452_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	2.6e-49
WP_171837663.1|868873_869908_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	45.5	1.5e-81
WP_171837629.1|870185_871004_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171837621.1|871182_871599_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_171837622.1|871608_872064_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_171837630.1|872060_872480_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_171837623.1|872503_873430_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_171837624.1|873654_874284_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837625.1|874676_875423_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171837626.1|875510_876530_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_171837627.1|876569_877463_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	37.5	4.6e-47
WP_171837628.1|878768_879131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443453.1|879140_880187_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.4e-49
WP_172443454.1|880235_880637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837861.1|880804_882178_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_172443453.1|882296_883343_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.4e-49
>prophage 3
NZ_CP053708	Acetobacteraceae bacterium strain PAMC 26569 chromosome, complete genome	4799761	1446010	1495439	4799761	portal,protease,capsid,head,terminase,tail,integrase,plate,tRNA	Pseudomonas_phage(20.0%)	65	1446499:1446515	1475544:1475560
WP_171834741.1|1446010_1447261_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
1446499:1446515	attL	GCTGAACACGCTCGGCG	NA	NA	NA	NA
WP_171834742.1|1447270_1448326_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_171834743.1|1448476_1449322_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_171835005.1|1449517_1450618_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_171835006.1|1450632_1451007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834744.1|1451146_1452007_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_171834745.1|1452350_1452827_+	DUF4167 domain-containing protein	NA	NA	NA	NA	NA
WP_171834746.1|1452918_1454061_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_171834747.1|1454332_1455442_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	35.7	2.7e-36
WP_171834748.1|1455442_1455682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834749.1|1455674_1455863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835007.1|1456459_1458217_-	DNA cytosine methyltransferase	NA	A0A068CDI9	Rhizobium_phage	46.3	2.5e-145
WP_171834750.1|1458249_1458495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834751.1|1458679_1459621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834752.1|1459617_1460082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834753.1|1460164_1460548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834754.1|1460534_1460771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834755.1|1460901_1461309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834756.1|1461642_1462161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834757.1|1462649_1463024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171834758.1|1463339_1463738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834759.1|1463744_1464059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834760.1|1464599_1465181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834761.1|1465361_1465694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834762.1|1465818_1466238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834763.1|1466230_1466509_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	55.7	5.3e-18
WP_171834764.1|1466513_1467047_+	HNH endonuclease	NA	V9SI64	Achromobacter_phage	30.6	3.1e-14
WP_171835008.1|1467145_1467487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834765.1|1467483_1467714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834766.1|1467973_1468558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834767.1|1468554_1469457_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	44.9	6.8e-22
WP_171834768.1|1469453_1470239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834769.1|1470235_1470970_+	phage antirepressor KilAC domain-containing protein	NA	A0A067ZIN2	Vibrio_phage	37.1	5.5e-30
WP_171834770.1|1471041_1471746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834771.1|1471856_1472276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834772.1|1472426_1473290_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_171834773.1|1473304_1473937_+	DUF3164 family protein	NA	A0A1B0T6G5	Thiobacimonas_phage	48.0	2.0e-49
WP_171834774.1|1473949_1474195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834775.1|1474244_1475285_+	glycosyltransferase family 1 protein	NA	B2ZY71	Ralstonia_phage	46.6	1.4e-74
WP_171834776.1|1475299_1475494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171835009.1|1475520_1475838_+	HNH endonuclease	NA	NA	NA	NA	NA
1475544:1475560	attR	CGCCGAGCGTGTTCAGC	NA	NA	NA	NA
WP_171834777.1|1476029_1476542_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_172443461.1|1476985_1479325_+	hypothetical protein	NA	A0A0R6PIP7	Moraxella_phage	50.6	6.1e-115
WP_171834779.1|1479324_1480629_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	34.9	1.0e-50
WP_171834780.1|1480651_1481347_+|head,protease	HK97 family phage prohead protease	head,protease	H9YSG6	environmental_Halophage	33.5	2.3e-14
WP_171834781.1|1481456_1483010_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	35.1	1.6e-58
WP_171834782.1|1483019_1483220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834783.1|1483226_1483631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834784.1|1483647_1484277_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_171834785.1|1484280_1484661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834786.1|1484660_1485191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834787.1|1485190_1485655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834788.1|1485651_1486194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834789.1|1486208_1486433_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_171834790.1|1486445_1487936_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	NA	NA	NA	NA
WP_171834791.1|1487947_1488346_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_171834792.1|1488345_1488660_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_171835010.1|1488605_1488809_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_171834793.1|1488808_1489594_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	30.4	2.0e-14
WP_171834794.1|1489590_1490160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834795.1|1490167_1491331_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.4	8.4e-41
WP_171834796.1|1491344_1493378_+	hypothetical protein	NA	W6Q7I9	Citrobacter_phage	40.5	1.8e-14
WP_171834797.1|1493374_1493869_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_171834798.1|1493872_1494325_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_171834799.1|1494326_1495439_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
>prophage 4
NZ_CP053708	Acetobacteraceae bacterium strain PAMC 26569 chromosome, complete genome	4799761	4274603	4299145	4799761	transposase	Stx2-converting_phage(37.5%)	28	NA	NA
WP_172443453.1|4274603_4275650_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.4e-49
WP_171837900.1|4276743_4277277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837901.1|4277990_4278347_+	phosphonate transporter	NA	NA	NA	NA	NA
WP_171837902.1|4278339_4278753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837903.1|4278946_4279156_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_171837898.1|4279441_4279633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837904.1|4279598_4279916_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_171837905.1|4279912_4280209_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_171837906.1|4280251_4280485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837899.1|4280448_4280586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837907.1|4281138_4281390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837908.1|4282268_4282865_+	hypothetical protein	NA	A0A0F6PKJ5	Escherichia_phage	36.9	6.9e-15
WP_172443453.1|4283483_4284530_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.4e-49
WP_171837535.1|4284510_4285074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837534.1|4285433_4285796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837533.1|4286366_4286843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837532.1|4287792_4288065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837390.1|4288851_4289619_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_171837391.1|4289630_4291163_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837970.1|4291371_4291737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837971.1|4291907_4292726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837972.1|4293581_4295588_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_171837973.1|4295641_4295962_+	response regulator	NA	NA	NA	NA	NA
WP_171837974.1|4296049_4296295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443497.1|4296327_4296747_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	48.4	9.1e-30
WP_172443516.1|4296770_4298306_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.8	2.4e-112
WP_172443498.1|4298396_4298744_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	4.3e-33
WP_171837671.1|4298740_4299145_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP053709	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence	441110	8626	59509	441110	integrase,transposase	Bacillus_virus(17.65%)	52	20315:20334	68383:68402
WP_171836533.1|8626_9088_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.6	1.0e-05
WP_171836534.1|9084_9288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836535.1|10698_11712_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_171836536.1|11719_11932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836537.1|12053_12491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171836538.1|12436_12586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836539.1|12582_12720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836540.1|12741_13074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836541.1|13216_13390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443519.1|13388_13661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836543.1|14163_16254_+	catalase	NA	A0A2K9L572	Tupanvirus	45.8	8.3e-132
WP_171836544.1|17950_20134_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.9	2.9e-26
20315:20334	attL	GGCGTTGGTGCACGGACCTT	NA	NA	NA	NA
WP_172443520.1|20572_21375_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	9.0e-26
WP_172443521.1|21383_21545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837635.1|21820_22192_+	response regulator	NA	NA	NA	NA	NA
WP_171837634.1|22275_22560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837633.1|22712_22880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837632.1|24750_25155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443522.1|25520_26174_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	31.0	8.9e-16
WP_172443523.1|26239_27892_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.6	4.3e-107
WP_172443524.1|27955_28303_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	56.1	2.2e-29
WP_172443525.1|28299_28644_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837651.1|28701_29034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837652.1|29076_29274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443526.1|29934_30537_-	YecA family protein	NA	NA	NA	NA	NA
WP_172443527.1|30533_32081_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.9	1.5e-93
WP_171837313.1|32123_32594_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_171837312.1|32491_32956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837311.1|33026_33323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837310.1|33324_33492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443528.1|33700_33922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837309.1|34021_34168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837308.1|34451_34829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837307.1|34864_35065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837306.1|35108_35324_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_171837305.1|36850_38782_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.8	1.6e-20
WP_171837304.1|39239_39692_-	response regulator	NA	W8CYM9	Bacillus_phage	34.2	2.2e-05
WP_171837303.1|39838_41971_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	40.5	2.6e-24
WP_171837302.1|42300_42630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837301.1|43138_43609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837300.1|43842_44829_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	7.6e-43
WP_171837299.1|46060_46795_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	1.3e-60
WP_171837314.1|46805_48326_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	3.7e-121
WP_172443529.1|48578_49571_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_172443530.1|49691_50449_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	34.4	2.3e-07
WP_171837393.1|50585_51185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837394.1|52726_53905_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_171837395.1|53991_54705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837396.1|54704_55349_-	ParA family protein	NA	M4HZI5	Mycobacterium_phage	33.3	4.7e-09
WP_171837397.1|56683_57817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837398.1|57893_58307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837408.1|58411_59509_-|integrase	site-specific integrase	integrase	Q5QBN6	Enterobacteria_phage	28.8	1.8e-16
68383:68402	attR	GGCGTTGGTGCACGGACCTT	NA	NA	NA	NA
>prophage 2
NZ_CP053709	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence	441110	64259	120898	441110	integrase,transposase	Stx2-converting_phage(33.33%)	49	82128:82143	125419:125434
WP_171837409.1|64259_65231_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.2	1.6e-40
WP_171837403.1|66219_67194_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	39.5	2.5e-46
WP_171837404.1|67272_68061_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_171837405.1|68223_68379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837406.1|68437_68617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837407.1|70714_70855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443485.1|73514_74624_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171837990.1|75007_76033_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_172443485.1|76322_77432_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171837856.1|77639_79445_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_171837855.1|79483_80224_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171837854.1|80232_81747_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.2	1.3e-73
WP_171837853.1|81798_82206_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
82128:82143	attL	TGCCGTCCGCCCGCTC	NA	NA	NA	NA
WP_171837852.1|82202_82880_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_171837851.1|84892_85783_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_171837850.1|86125_86272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837849.1|86496_87411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837848.1|87608_89228_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_171837859.1|89312_90722_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_171837858.1|90768_91908_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171837857.1|91917_93405_-	MFS transporter	NA	NA	NA	NA	NA
WP_171837846.1|95294_95492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837845.1|95536_96577_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172443531.1|96913_97312_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172443532.1|97447_97621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443560.1|97585_99121_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	4.9e-113
WP_172443533.1|99211_99559_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	61.7	3.0e-34
WP_171837828.1|99555_99960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172443534.1|100079_100421_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_171836571.1|100653_101202_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	40.4	5.3e-30
WP_171836583.1|101219_102869_+|transposase	transposase family protein	transposase	Q5ZR04	Pseudomonas_phage	24.4	2.2e-10
WP_171836572.1|102862_103834_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	26.9	1.6e-05
WP_171836573.1|103962_104652_+	BID domain-containing protein	NA	NA	NA	NA	NA
WP_171836574.1|104795_105227_-	VOC family protein	NA	NA	NA	NA	NA
WP_171836575.1|105332_105884_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_171836576.1|105905_106820_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171836577.1|106831_107923_-	alkene reductase	NA	NA	NA	NA	NA
WP_171836578.1|107970_108711_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171836579.1|109721_110678_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171836580.1|110922_111660_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	2.3e-20
WP_171836581.1|111734_112325_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172443535.1|112924_113737_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171837828.1|113695_114100_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172443533.1|114096_114444_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	61.7	3.0e-34
WP_172443560.1|114534_116070_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	4.9e-113
WP_171837295.1|116774_117794_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	29.1	5.0e-21
WP_171837294.1|118385_118856_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_171837293.1|118852_119359_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_171837292.1|119566_120898_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
125419:125434	attR	GAGCGGGCGGACGGCA	NA	NA	NA	NA
>prophage 3
NZ_CP053709	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence	441110	131896	183845	441110	protease,integrase,transposase	Escherichia_phage(18.75%)	46	125020:125037	190339:190356
125020:125037	attL	GGCCTCATCGAGCGCGTC	NA	NA	NA	NA
WP_172443520.1|131896_132699_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	9.0e-26
WP_171836555.1|132844_133555_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	33.5	4.2e-19
WP_171836558.1|133682_133925_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171836554.1|133944_134487_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	51.3	7.7e-13
WP_171836553.1|135029_136162_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	9.0e-48
WP_171836557.1|137255_137477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171836552.1|137477_137768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836551.1|137880_138492_+	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_171836550.1|138492_139491_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_172443542.1|139596_140922_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_171836548.1|141058_141580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836547.1|141590_141989_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_171836546.1|141985_142237_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171836545.1|142313_142502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837391.1|142667_144200_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837390.1|144211_144979_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_171837800.1|145228_145534_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_171837799.1|145934_148745_-	EAL domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	30.1	4.5e-24
WP_172443529.1|149087_150080_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_172443543.1|150177_151476_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172443544.1|151521_152514_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_171837688.1|152630_153385_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	37.2	1.7e-10
WP_171837687.1|154200_154611_-	dioxygenase	NA	NA	NA	NA	NA
WP_171837686.1|154650_156309_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_171837685.1|156532_157459_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_171837691.1|157517_159122_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171837684.1|159118_160072_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_171837683.1|160077_160965_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_171837690.1|162111_163248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837682.1|163247_164351_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_171837681.1|164347_165466_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_171837680.1|165465_167076_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_171837689.1|167117_168131_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.9e-14
WP_171837679.1|168127_169108_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	2.5e-22
WP_171837678.1|169304_172112_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.2	3.2e-30
WP_171837677.1|172879_173128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837676.1|173130_173382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837675.1|173393_174254_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.5	9.0e-24
WP_171837674.1|174343_177616_-	error-prone DNA polymerase	NA	Q8W6C3	Saccharomonospora_phage	26.5	4.4e-87
WP_171837673.1|177626_177866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837672.1|177882_178086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443561.1|178212_179475_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.5	7.5e-43
WP_172443545.1|179537_180332_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.9	6.1e-51
WP_171836871.1|180384_181740_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_171836872.1|181657_182419_-	damage-inducible mutagenesis protein	NA	NA	NA	NA	NA
WP_171836873.1|182621_183845_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	24.5	1.3e-15
190339:190356	attR	GGCCTCATCGAGCGCGTC	NA	NA	NA	NA
>prophage 4
NZ_CP053709	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence	441110	250730	259042	441110	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_172443547.1|250730_251345_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837086.1|251307_252951_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.7	3.4e-112
WP_171837087.1|253011_253359_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.1	3.7e-29
WP_172443548.1|253355_253766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172443549.1|253833_254172_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837953.1|254400_255372_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_171837952.1|255617_256151_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.4	4.6e-10
WP_171837951.1|256287_256698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837950.1|256797_257565_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171837419.1|258367_259042_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.3	1.8e-48
>prophage 5
NZ_CP053709	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence	441110	352074	392501	441110	integrase,transposase	Escherichia_phage(11.11%)	35	351950:351984	355621:355655
351950:351984	attL	AATTATCTGCAGCAGATATTTATGTAGAGGACGCC	NA	NA	NA	NA
WP_171833848.1|352074_353079_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	4.1e-12
WP_171833847.1|353075_353990_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_171833846.1|353983_355528_-|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	26.2	2.4e-11
WP_171833845.1|355628_358958_-	hypothetical protein	NA	I6NW45	Burkholderia_virus	42.8	4.4e-220
355621:355655	attR	GGCGTCCTCTACATAAATATCTGCTGCAGATAATT	NA	NA	NA	NA
WP_171833844.1|359301_359853_-	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_171833843.1|359839_360262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833842.1|360402_360741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833841.1|360740_361706_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	36.7	6.5e-47
WP_171833840.1|361987_362725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833839.1|362796_363141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833838.1|363230_363521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833837.1|363595_364180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833836.1|364251_364575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833835.1|364625_364772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833834.1|365245_365530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171833833.1|365526_365904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171833832.1|365935_368059_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_171833923.1|368070_368250_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171833831.1|368744_369239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171833830.1|369361_372127_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	24.8	5.3e-17
WP_171833829.1|372133_375262_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_171833828.1|375251_375899_-	DUF3780 domain-containing protein	NA	A0A1P8DTE9	Proteus_phage	43.9	8.5e-27
WP_171833827.1|375895_379018_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_171833826.1|379340_379595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171833825.1|379603_380449_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.1	5.7e-23
WP_171833824.1|380542_382627_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	34.8	4.5e-93
WP_171833922.1|383542_384466_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_171833823.1|385212_386124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171833822.1|386233_386626_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_171833821.1|386622_386865_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171837741.1|388261_389617_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	45.3	3.5e-107
WP_171837740.1|389808_390126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837739.1|390180_390480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837738.1|390616_390784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443544.1|391508_392501_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	0	37680	354209	transposase,integrase	Enterobacteria_phage(18.18%)	43	674:690	44176:44192
WP_171835733.1|556_1171_-	hypothetical protein	NA	NA	NA	NA	NA
674:690	attL	CTCCACCCGGACGGTGC	NA	NA	NA	NA
WP_171835732.1|1167_2046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835731.1|2045_2762_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_171835730.1|2825_3368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835749.1|3771_4893_+|integrase	site-specific integrase	integrase	Q5QBN6	Enterobacteria_phage	28.8	2.4e-16
WP_171835729.1|6206_7277_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	29.5	7.3e-15
WP_171835728.1|7306_8179_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.1	1.3e-06
WP_171835727.1|9135_10104_+	plasmid replication initiator	NA	NA	NA	NA	NA
WP_171835726.1|10177_10390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835725.1|11095_11386_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172443579.1|11422_11797_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	51.3	7.1e-26
WP_171837916.1|11968_13042_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171837795.1|13067_13250_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171837794.1|13171_13543_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	59.1	2.3e-21
WP_171837793.1|13539_13767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837792.1|14029_15184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837791.1|15501_16182_-	WHG domain-containing protein	NA	NA	NA	NA	NA
WP_171837790.1|16199_16655_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_171837927.1|16868_17738_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.7	5.3e-40
WP_171837926.1|17665_18016_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837824.1|18095_18425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837823.1|18797_20132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837822.1|20557_20707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837821.1|20787_21114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837820.1|21360_21732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837819.1|21728_22178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837818.1|22177_22570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837826.1|24695_25664_+	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	36.1	4.8e-34
WP_171837817.1|25740_26118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837816.1|26144_26693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837815.1|26708_27158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837814.1|27610_28081_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	55.1	5.8e-41
WP_171837813.1|28052_28442_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171837812.1|28653_28851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837811.1|28850_29072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443563.1|29236_29512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837809.1|29513_30629_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_171837808.1|30698_30917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837807.1|31462_32449_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_171837806.1|32445_32751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837391.1|33042_34575_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837390.1|34586_35354_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_171835381.1|36693_37680_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.9	4.9e-42
44176:44192	attR	CTCCACCCGGACGGTGC	NA	NA	NA	NA
>prophage 2
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	41362	42310	354209		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_171835375.1|41362_42310_-	phosphoglycerate dehydrogenase	NA	M1GWB3	Acanthocystis_turfacea_Chlorella_virus	26.7	6.4e-23
>prophage 3
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	45738	53875	354209		Staphylococcus_phage(33.33%)	7	NA	NA
WP_171835370.1|45738_47316_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.0e-17
WP_171835369.1|47316_48312_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_171835380.1|48323_49871_+	pentose kinase	NA	NA	NA	NA	NA
WP_171835368.1|49886_50672_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	3.6e-19
WP_171835367.1|50684_50936_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171835366.1|51821_52772_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171835365.1|52864_53875_+	zinc-binding dehydrogenase	NA	K7Z7U2	Megavirus	24.1	9.6e-09
>prophage 4
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	60036	226048	354209	transposase,integrase	Mycobacterium_phage(11.11%)	149	182241:182256	216184:216199
WP_171835358.1|60036_60777_+	glucose 1-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.8	5.8e-11
WP_171835357.1|60904_62137_-	MFS transporter	NA	NA	NA	NA	NA
WP_171835356.1|62382_63060_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	41.9	2.6e-34
WP_172443506.1|63051_64199_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.5	7.7e-63
WP_172443580.1|64897_65737_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.4	2.9e-51
WP_171836567.1|67242_68670_+	DUF4331 family protein	NA	NA	NA	NA	NA
WP_171836566.1|68699_69980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836565.1|69976_71122_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_171836564.1|72896_73373_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_171836563.1|73692_73926_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	47.9	3.0e-06
WP_171836562.1|75268_76063_-	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_171836561.1|76450_76636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836560.1|76958_77468_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_171836559.1|77596_77965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837778.1|78420_79155_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.4	1.0e-60
WP_172443514.1|79165_80686_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.6e-124
WP_172443564.1|80976_81411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443565.1|81407_81548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837289.1|81662_83186_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.5	4.6e-23
WP_171837288.1|83175_83955_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.9	9.0e-31
WP_171837788.1|85024_85762_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_171837789.1|86274_87177_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837787.1|87293_87752_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_171837786.1|87865_89473_-	MFS transporter	NA	NA	NA	NA	NA
WP_171837785.1|89469_90675_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171837784.1|90860_91772_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171837783.1|92358_93738_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_171837782.1|94168_95641_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_172443566.1|95880_96780_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.7	4.8e-44
WP_171837288.1|96859_97639_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.9	9.0e-31
WP_171837289.1|97628_99152_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.5	4.6e-23
WP_171837860.1|99784_100594_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	29.6	1.0e-05
WP_171837663.1|100703_101738_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	45.5	1.5e-81
WP_171837949.1|103656_105108_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.4	9.5e-34
WP_171837597.1|106014_106593_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837574.1|107561_109298_+	ubiquinone-dependent pyruvate dehydrogenase	NA	G8DDL3	Micromonas_pusilla_virus	24.2	9.0e-31
WP_171837575.1|109596_109974_-	response regulator	NA	NA	NA	NA	NA
WP_171837576.1|109970_110732_-	response regulator	NA	NA	NA	NA	NA
WP_171837577.1|110877_111714_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_171837578.1|111754_112219_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.1	7.0e-15
WP_171837579.1|112301_113312_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171837580.1|113410_114256_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_171837581.1|114328_115138_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171837582.1|115580_117662_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.7	4.1e-06
WP_171837583.1|117836_118265_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_171837584.1|118361_119240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837585.1|119584_119971_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_171837586.1|120257_121124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837587.1|121120_121738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837588.1|121734_122094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837589.1|122154_122682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443567.1|122753_123356_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_172443568.1|123352_124900_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.4	3.3e-93
WP_171837598.1|124942_125239_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_171837592.1|125310_125778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837593.1|125854_126319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837594.1|127240_127990_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.1e-14
WP_171837595.1|128518_129490_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.0	2.1e-45
WP_171837596.1|129726_130005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443485.1|130844_131954_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172443569.1|133639_134731_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171837391.1|134909_136442_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837390.1|136453_137221_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_171837660.1|138850_139225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837659.1|139221_139773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837658.1|139772_139970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837657.1|140205_140403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837656.1|140399_140567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837655.1|140568_140976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837654.1|141053_141302_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_171837652.1|141488_141686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837653.1|141728_142037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443581.1|142211_142978_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.6	1.8e-23
WP_172443506.1|143072_144219_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.5	7.7e-63
WP_171834383.1|145097_145448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834384.1|145469_145727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834389.1|146069_147071_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_171834385.1|147149_147302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834386.1|147466_148264_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.6	1.2e-22
WP_171834387.1|148449_148968_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	64.2	1.0e-51
WP_171834388.1|151631_152186_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.2e-16
WP_172443570.1|152289_154479_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	2.4e-12
WP_171835762.1|155367_155712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835763.1|156254_156422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171835764.1|156686_158621_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_171835765.1|158744_159014_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_171835766.1|159231_159540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443571.1|159825_160533_-	3'-5' exonuclease	NA	A0A0K1LLS9	Caulobacter_phage	41.2	2.7e-42
WP_171837935.1|160532_160991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443572.1|160990_161713_-	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	28.4	9.3e-06
WP_171837946.1|161747_162173_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.7	7.3e-19
WP_171837945.1|162663_162927_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_171837606.1|163158_164472_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_171837605.1|164701_165238_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837604.1|165325_165628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837603.1|165853_166465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837602.1|167664_168033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837601.1|168047_170384_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_171837600.1|170439_170973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837599.1|171963_172251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443573.1|174031_174833_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	9.0e-26
WP_171837288.1|174992_175772_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.9	9.0e-31
WP_171837119.1|178197_178983_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_171837120.1|179064_179235_-	CsbD family protein	NA	NA	NA	NA	NA
WP_171837121.1|179416_181273_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_171837122.1|181445_181880_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_171837123.1|182207_183002_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
182241:182256	attL	ACCGCTGCTCATGCCG	NA	NA	NA	NA
WP_171837124.1|183099_183483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837125.1|183523_184141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837145.1|184436_185408_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.2	2.7e-40
WP_171837126.1|185624_186410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171837127.1|187388_187778_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	43.6	3.2e-05
WP_172443582.1|187995_188550_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837129.1|188628_189600_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171837130.1|189767_189905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837131.1|189936_190257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837132.1|190269_190512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837133.1|191275_194047_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.3	3.9e-28
WP_171837134.1|195009_195183_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_171837118.1|195133_195403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837135.1|196053_196686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837136.1|196988_197198_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837137.1|197330_197720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837138.1|197721_197889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837139.1|197885_198083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837140.1|198344_199286_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	28.0	2.1e-18
WP_171837141.1|199494_199731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837143.1|200252_203093_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	1.6e-13
WP_171837144.1|205164_206463_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172443529.1|206508_207501_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_172443574.1|207621_208379_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	34.4	2.3e-07
WP_171837297.1|208519_209725_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172443575.1|209986_210979_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_171837726.1|211448_211640_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837727.1|211634_211997_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	34.4	4.6e-06
WP_171837728.1|212195_212507_-	TolC family protein	NA	NA	NA	NA	NA
WP_171837729.1|212591_213563_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.1	1.9e-46
WP_171837730.1|213691_213832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837731.1|215336_215843_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171837735.1|216000_218337_-	arginine decarboxylase	NA	NA	NA	NA	NA
216184:216199	attR	CGGCATGAGCAGCGGT	NA	NA	NA	NA
WP_171837736.1|218407_219574_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_171837732.1|220269_221760_+	amino acid permease	NA	NA	NA	NA	NA
WP_171837733.1|221802_222384_+	pyruvoyl-dependent arginine decarboxylase	NA	NA	NA	NA	NA
WP_171837734.1|222398_223298_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	49.0	1.8e-75
WP_171837737.1|223284_224430_+	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	47.2	2.1e-89
WP_172443520.1|224481_225283_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	9.0e-26
WP_172443576.1|225245_225440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834373.1|225468_225750_+	ammonium transporter	NA	NA	NA	NA	NA
WP_171834372.1|225865_226048_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	232652	241465	354209		Bandra_megavirus(25.0%)	7	NA	NA
WP_171834380.1|232652_233636_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9V7Y5	Bandra_megavirus	33.0	3.7e-21
WP_171834368.1|233723_234800_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_171834367.1|235466_236954_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.9	4.1e-24
WP_171834366.1|236953_237886_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.3	1.2e-18
WP_171834365.1|237938_238424_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_171834364.1|238695_239118_-	response regulator	NA	NA	NA	NA	NA
WP_171834363.1|239212_241465_-	response regulator	NA	A0A1V0SGX0	Hokovirus	24.9	1.4e-20
>prophage 6
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	249319	253436	354209		Megavirus(50.0%)	3	NA	NA
WP_171834356.1|249319_251215_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	51.6	4.4e-148
WP_171834378.1|251468_252119_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_171834355.1|252401_253436_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	26.9	3.4e-33
>prophage 7
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	262122	263058	354209		Salmonella_phage(100.0%)	1	NA	NA
WP_171834346.1|262122_263058_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	39.2	1.1e-11
>prophage 8
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	272132	272960	354209		Tupanvirus(100.0%)	1	NA	NA
WP_171834377.1|272132_272960_-	slipin family protein	NA	A0A2K9KZA2	Tupanvirus	32.4	2.4e-29
>prophage 9
NZ_CP053710	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence	354209	282630	337769	354209	transposase	Stx2-converting_phage(22.22%)	42	NA	NA
WP_171834337.1|282630_283431_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171834336.1|283945_284188_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	49.4	1.5e-13
WP_171834375.1|284425_285136_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_171834335.1|285295_285688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834334.1|285742_286534_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_171834333.1|286636_288292_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	24.7	4.1e-17
WP_171834332.1|288288_296799_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_171834331.1|296803_297013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834330.1|297228_297408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834328.1|299267_299528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834327.1|299536_300151_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_171834326.1|300153_301248_-	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	47.9	2.8e-70
WP_171834325.1|301244_303668_-	phosphoketolase	NA	NA	NA	NA	NA
WP_171834324.1|303800_304655_-	glucokinase	NA	NA	NA	NA	NA
WP_171834323.1|304651_304852_-	glucokinase	NA	NA	NA	NA	NA
WP_171834322.1|305111_305858_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_171834329.1|305868_306180_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_171834321.1|306598_307306_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.8	1.3e-23
WP_171834320.1|307805_309155_-	MFS transporter	NA	NA	NA	NA	NA
WP_171834319.1|309151_309766_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_171834318.1|311273_311579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837839.1|312556_312808_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171837838.1|312807_313158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837837.1|313162_313402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171837834.1|314469_314655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837836.1|314654_315833_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_171837835.1|315986_316799_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_171837086.1|317598_319242_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.7	3.4e-112
WP_171837087.1|319302_319650_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.1	3.7e-29
WP_172443548.1|319646_320057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837383.1|320665_321151_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_171837384.1|321248_325628_-	response regulator	NA	A0A1V0SGX0	Hokovirus	25.6	5.6e-21
WP_171837385.1|325903_326308_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837386.1|327602_327950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837387.1|328690_329782_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_171837388.1|329871_331023_-	alcohol dehydrogenase catalytic domain-containing protein	NA	M1PHA2	Moumouvirus	36.6	1.3e-54
WP_172443577.1|331281_332084_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	9.0e-26
WP_171837568.1|332843_333131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837569.1|333218_334283_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_171837570.1|334279_334744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837571.1|334814_335246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171835747.1|336749_337769_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053711	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence	214302	68758	172578	214302	transposase	Stx2-converting_phage(25.81%)	111	NA	NA
WP_172443508.1|68758_70282_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	24.7	1.9e-08
WP_171836903.1|70513_71179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836902.1|71470_71893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171836901.1|72155_72524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836900.1|72624_73578_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_171836899.1|73740_74148_-	VOC family protein	NA	NA	NA	NA	NA
WP_171836898.1|74761_75493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836897.1|76047_77409_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_171836906.1|77405_78119_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	3.1e-30
WP_171836896.1|78413_79169_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_171836895.1|79353_79641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836894.1|79661_79895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836893.1|80237_80591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836892.1|80664_82206_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	50.3	1.5e-138
WP_171836891.1|83084_83756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836890.1|85744_85951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836889.1|86297_88295_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.1e-21
WP_171836905.1|89458_90073_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171836904.1|90178_90916_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.4	1.2e-16
WP_171836888.1|91024_91312_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_171837916.1|91784_92858_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172443590.1|93029_93731_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	45.6	2.4e-43
WP_172443591.1|93727_94042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837377.1|94141_94966_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.6	1.4e-10
WP_171837378.1|95212_95485_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_171837379.1|95632_96718_-|transposase	IS5 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	28.2	1.1e-10
WP_172443600.1|99102_100674_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	2.7e-111
WP_171837380.1|100728_101076_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	6.6e-34
WP_172443453.1|101285_102332_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.4e-49
WP_171836887.1|102341_102593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171836886.1|102764_103034_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_171836885.1|103492_103846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171836884.1|104203_104377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836883.1|104433_104760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837631.1|105091_105745_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_172443592.1|105810_107463_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.8	1.1e-107
WP_172443524.1|107526_107874_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	56.1	2.2e-29
WP_172443593.1|107870_108215_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837932.1|108261_109866_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	33.5	1.3e-15
WP_171837931.1|109900_110239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837930.1|110385_111063_-	SOS response-associated peptidase family protein	NA	V9IQW7	Stenotrophomonas_phage	32.5	2.6e-18
WP_171837929.1|111091_111340_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_171837928.1|113406_113634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837391.1|114022_115555_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837390.1|115566_116334_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_172443601.1|116487_117234_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	39.4	9.2e-41
WP_171837777.1|117365_118373_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_171837775.1|118380_118752_-	response regulator	NA	NA	NA	NA	NA
WP_171837774.1|118869_119944_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172443594.1|120140_120419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837773.1|120601_121015_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171837772.1|121120_122023_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_171837771.1|121991_122204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837912.1|125121_125868_+	response regulator	NA	NA	NA	NA	NA
WP_171837911.1|126125_126524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837910.1|126563_126743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837909.1|127270_127534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837086.1|128287_129931_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.7	3.4e-112
WP_171837087.1|129991_130339_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.1	3.7e-29
WP_172443548.1|130335_130746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837965.1|130796_131354_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_172443595.1|131360_131705_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_171837967.1|131732_132260_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_171837968.1|132451_132649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837969.1|133274_133475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837288.1|133904_134684_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.9	9.0e-31
WP_172443596.1|134673_136197_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.5	3.6e-23
WP_171834199.1|136660_137989_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_171834162.1|138235_138850_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171834163.1|138874_139666_-	dioxygenase	NA	NA	NA	NA	NA
WP_171834164.1|139742_140639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171834165.1|140843_141251_-	septal ring lytic transglycosylase RlpA family lipoprotein	NA	F5B3X9	Synechococcus_phage	46.6	2.5e-08
WP_171834166.1|141499_141787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834167.1|141780_142611_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171834168.1|142661_143081_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_171834169.1|143257_143662_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171834170.1|143703_143841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171834171.1|144155_144620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834172.1|144616_144994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834173.1|145074_145548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834174.1|145532_145790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834175.1|145800_146154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834176.1|146386_146635_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171834177.1|146746_147136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834178.1|147137_147305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834179.1|147301_147505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834180.1|147717_147954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834181.1|147953_148358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834182.1|148357_148729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834183.1|148891_149194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834200.1|149839_151267_+	DUF4331 family protein	NA	NA	NA	NA	NA
WP_171834184.1|151294_152572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171834185.1|152568_153714_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_171834201.1|153699_154422_-	SOS response-associated peptidase family protein	NA	A0A291AUP1	Sinorhizobium_phage	45.0	1.0e-41
WP_171834186.1|154463_154811_-	septal ring lytic transglycosylase RlpA family lipoprotein	NA	NA	NA	NA	NA
WP_171834187.1|154809_155643_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.6	9.0e-21
WP_171834188.1|155715_157302_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.4	1.2e-93
WP_171834189.1|157609_157795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171834190.1|157976_158378_-	response regulator	NA	NA	NA	NA	NA
WP_171834191.1|158380_159844_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_171834202.1|159840_160542_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.0	1.4e-14
WP_171834192.1|160684_162142_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	37.3	2.7e-20
WP_171834193.1|162381_163353_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.0	4.2e-46
WP_171834194.1|163424_163820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171834195.1|164151_164796_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171834203.1|164981_166139_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171834196.1|166135_167704_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	26.0	1.3e-20
WP_171834204.1|167728_169312_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_171834197.1|170082_171054_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171834198.1|171093_171687_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172443597.1|171775_172578_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	1.5e-25
>prophage 1
NZ_CP053712	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence	149789	2916	71813	149789	integrase,transposase	Escherichia_phage(23.53%)	56	2312:2326	20803:20817
2312:2326	attL	GGAACTGCAGCTGGA	NA	NA	NA	NA
WP_171835223.1|2916_4236_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_171835214.1|4402_4807_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_171835215.1|5345_6575_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_171835216.1|8533_10159_-	dynamin family protein	NA	NA	NA	NA	NA
WP_171835217.1|10370_11600_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_171835218.1|11601_12417_+	universal stress protein	NA	NA	NA	NA	NA
WP_171835219.1|12937_13144_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_172443603.1|13233_13536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443604.1|13529_13835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443605.1|13950_14625_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.3	6.3e-49
WP_172443606.1|14681_15035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837321.1|15162_15540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837320.1|16740_17994_+	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.0	7.7e-32
WP_171837663.1|18094_19129_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	45.5	1.5e-81
WP_172443548.1|19769_20180_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837087.1|20176_20524_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.1	3.7e-29
WP_171837086.1|20584_22228_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.7	3.4e-112
20803:20817	attR	GGAACTGCAGCTGGA	NA	NA	NA	NA
WP_171837410.1|22357_22819_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837411.1|22782_23013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837412.1|23125_24526_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_171837413.1|24679_25957_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_171837414.1|26431_27823_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_171837415.1|27866_28793_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.5	1.9e-40
WP_171837416.1|30731_31295_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_171837417.1|31291_32731_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_171837418.1|32759_33239_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_172443619.1|34586_35261_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.8	4.8e-49
WP_171837420.1|35610_36348_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.4	6.1e-29
WP_172443607.1|36381_37056_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.8	2.8e-49
WP_171837318.1|37369_37504_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837317.1|37646_39413_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.8	4.7e-11
WP_171837316.1|40736_40997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171837315.1|42615_43449_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	5.8e-20
WP_172443605.1|43482_44157_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.3	6.3e-49
WP_171837798.1|44261_44645_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171837797.1|44750_45212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172443608.1|45481_46759_+	porin	NA	NA	NA	NA	NA
WP_171837609.1|47293_47383_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_171837612.1|47396_49106_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_171837613.1|49117_51181_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.9	5.1e-33
WP_171837611.1|51193_51847_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_172443609.1|51846_54588_+	sensor histidine kinase KdpD	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.2	8.7e-12
WP_171837548.1|54584_55463_+	response regulator	NA	W8CYM9	Bacillus_phage	31.7	2.6e-26
WP_171837547.1|55491_56653_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	1.1e-37
WP_171837537.1|56982_57372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837546.1|57404_61004_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_172443610.1|61056_61398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837544.1|61538_62117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837543.1|62193_62985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837542.1|62981_63761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443611.1|64189_64594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837540.1|64571_64928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171837550.1|65271_66807_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_171837539.1|67672_68742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171837549.1|68843_69215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837289.1|70289_71813_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.5	4.6e-23
>prophage 2
NZ_CP053712	Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence	149789	74896	138953	149789	integrase,transposase	Mycobacterium_phage(16.67%)	53	72297:72312	141048:141063
72297:72312	attL	CGACCTCGTCATCCTG	NA	NA	NA	NA
WP_172443614.1|74896_75698_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.6	1.3e-24
WP_171837668.1|75660_75819_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_171837667.1|75815_75998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837664.1|76129_76270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837666.1|78057_79014_+	replication protein RepA	NA	NA	NA	NA	NA
WP_171837665.1|79317_79797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837391.1|79985_81518_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	3.3e-117
WP_171837390.1|81529_82297_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.2e-57
WP_171837941.1|82377_82950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171837940.1|83723_84407_-	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	43.6	2.5e-37
WP_171837942.1|86472_87594_-|integrase	site-specific integrase	integrase	Q5QBN6	Enterobacteria_phage	28.8	1.5e-15
WP_171835752.1|87998_88454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443615.1|88453_89296_+	AAA family ATPase	NA	A0A0F7L6J1	uncultured_marine_virus	27.1	2.4e-05
WP_171836848.1|89295_90174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836849.1|90182_90785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836850.1|90777_91623_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.6	5.2e-08
WP_171836851.1|91874_92435_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_171836852.1|92493_93315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171836854.1|95253_95685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171836855.1|95598_96369_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.2	1.1e-09
WP_171836856.1|96601_97603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171836857.1|97668_98658_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_171836858.1|98659_99310_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_172443616.1|99351_100317_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_171836860.1|100596_101469_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	33.1	1.4e-35
WP_171836861.1|101542_102700_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_171836862.1|102744_104196_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_171836863.1|104259_105723_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171836864.1|105824_106145_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_171836866.1|106762_107701_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171836867.1|107805_108354_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_171836868.1|108393_108822_+	RidA family protein	NA	NA	NA	NA	NA
WP_171836869.1|113982_114252_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_171836870.1|114650_115405_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172443617.1|116288_117091_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.0	1.5e-25
WP_171837433.1|117282_117444_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171837432.1|117822_118995_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	5.5e-16
WP_171837431.1|119361_121251_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_171837436.1|121375_121645_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_171837430.1|121863_122307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171837429.1|122436_122793_-	DUF3820 family protein	NA	A0A0K1LLS9	Caulobacter_phage	44.7	3.8e-21
WP_171837428.1|124698_125682_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.5	1.7e-10
WP_171837435.1|125771_126653_+	alpha/beta fold hydrolase	NA	A0A0M3UKI8	Mycobacterium_phage	30.8	6.0e-07
WP_171837427.1|126732_127638_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171837426.1|127659_128811_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_171837425.1|129120_130092_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_171837424.1|131285_131813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171837423.1|132024_132699_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.4	3.5e-47
WP_171837422.1|132985_133552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443618.1|133943_135090_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.5	7.7e-63
WP_171837116.1|135164_135362_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_171837117.1|135897_138204_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	1.3e-21
WP_171837115.1|138443_138953_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9RU54	Staphylococcus_phage	36.4	2.0e-15
141048:141063	attR	CAGGATGACGAGGTCG	NA	NA	NA	NA
