The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	568900	620091	5207261	integrase,coat,head,capsid,holin,portal,tRNA,tail,protease,terminase	Paenibacillus_phage(21.74%)	55	585174:585190	594528:594544
WP_172444131.1|568900_570094_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	34.5	1.5e-45
WP_172444132.1|570078_571062_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_098121060.1|571454_572297_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_172444133.1|572293_573139_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_172444134.1|573163_573547_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_172444135.1|573815_576602_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.3	7.6e-56
WP_098121064.1|576708_576879_+	YpmA family protein	NA	NA	NA	NA	NA
WP_098121065.1|576890_577355_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_172444136.1|577370_578558_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_172444137.1|578833_579562_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	42.5	4.6e-21
WP_098121068.1|579608_580271_+	endonuclease III	NA	NA	NA	NA	NA
WP_172444138.1|580260_580761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444139.1|581043_583848_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_172444140.1|583889_584501_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	8.3e-24
WP_172444141.1|584595_585603_+	DUF2515 family protein	NA	NA	NA	NA	NA
585174:585190	attL	AGAGCAATTAAAATTAA	NA	NA	NA	NA
WP_098121073.1|586359_586611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098121074.1|586739_586916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447587.1|587340_587871_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_172444142.1|588116_588845_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172444143.1|589553_590120_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_098121077.1|590196_590502_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_172444144.1|591097_592243_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_172444145.1|592377_593304_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JFF0	uncultured_Caudovirales_phage	24.4	1.1e-11
WP_172444146.1|593961_594234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444147.1|595007_595538_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
594528:594544	attR	AGAGCAATTAAAATTAA	NA	NA	NA	NA
WP_172444148.1|595906_597022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444149.1|597552_598059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444150.1|598075_598534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444151.1|599092_599278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172443645.1|599399_599621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444152.1|599876_600956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444153.1|600960_602094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444154.1|602751_603348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444155.1|603331_603595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444156.1|603657_603930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444157.1|603991_604330_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	51.6	3.0e-23
WP_172444158.1|604404_604776_+	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	56.2	7.1e-26
WP_172444159.1|604772_606458_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.0	3.3e-248
WP_172444160.1|606473_607631_+|portal	phage portal protein	portal	R9TLS1	Paenibacillus_phage	75.6	6.0e-148
WP_172447588.1|607649_608363_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	64.1	1.1e-78
WP_172444161.1|608355_609597_+|capsid	phage major capsid protein	capsid	R9TQG7	Paenibacillus_phage	72.6	1.9e-171
WP_172444162.1|609612_609801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444163.1|609797_610076_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	47.7	1.3e-16
WP_172444164.1|610068_610371_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_172444165.1|610363_610723_+	HK97 gp10 family phage protein	NA	Q0H235	Geobacillus_phage	47.5	5.4e-23
WP_172444166.1|610719_611049_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	60.6	4.6e-29
WP_172444167.1|611050_611608_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	57.8	1.9e-54
WP_172444168.1|611620_611971_+	hypothetical protein	NA	A6XMK4	Bacillus_virus	68.1	1.7e-37
WP_172444169.1|612232_614443_+	hypothetical protein	NA	A6XMK6	Bacillus_virus	52.4	6.7e-140
WP_172444170.1|614439_615228_+|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	42.3	3.9e-58
WP_172444171.1|615243_617016_+	right-handed parallel beta-helix repeat-containing protein	NA	U5PWM6	Bacillus_phage	33.5	1.5e-28
WP_172444172.1|617035_618823_+|tail	phage tail protein	tail	A0A2H4J3N3	uncultured_Caudovirales_phage	57.2	2.8e-168
WP_172444173.1|618822_619008_+	hypothetical protein	NA	A0A290GJM3	Caldibacillus_phage	50.0	4.7e-07
WP_098170080.1|619089_619452_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	29.3	8.7e-05
WP_172444174.1|619458_620091_+	peptidoglycan-binding protein	NA	A0A2D1GQ84	Lysinibacillus_phage	59.1	5.8e-36
>prophage 2
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	861251	868045	5207261	integrase	Bacillus_phage(50.0%)	10	858048:858062	868373:868387
858048:858062	attL	ATGCAAAAAGTTCAT	NA	NA	NA	NA
WP_172444390.1|861251_862118_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	28.3	2.4e-16
WP_172444391.1|862610_863048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444392.1|863139_863481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444393.1|863572_863776_-	helix-turn-helix domain-containing protein	NA	A0A288WG74	Bacillus_phage	53.0	3.0e-10
WP_172444394.1|863964_864786_+	ParM/StbA family protein	NA	A0A1D6X898	Bacillus_phage	44.3	5.0e-56
WP_172444395.1|864778_865009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444396.1|865160_865445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444397.1|865457_865895_+	hypothetical protein	NA	A0A218KCI4	Bacillus_phage	39.9	4.9e-18
WP_172444398.1|865891_867616_+	ATP-binding protein	NA	A0A2D1Q768	Geobacillus_phage	39.4	1.2e-115
WP_172444399.1|867625_868045_+	hypothetical protein	NA	E5DV71	Deep-sea_thermophilic_phage	57.5	2.8e-39
868373:868387	attR	ATGCAAAAAGTTCAT	NA	NA	NA	NA
>prophage 3
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	1412961	1470058	5207261	head,capsid,holin,portal,tRNA,tail,protease,terminase	Bacillus_phage(34.62%)	61	NA	NA
WP_172444856.1|1412961_1416042_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	31.8	4.2e-156
WP_172444857.1|1416673_1417615_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_172444858.1|1417917_1418124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444859.1|1418110_1418371_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172444860.1|1418830_1419994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098119769.1|1420381_1420624_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_098119768.1|1420689_1420884_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_098119767.1|1420979_1421702_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_172444861.1|1421829_1423215_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.8	3.1e-50
WP_172444862.1|1423687_1424116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444863.1|1424375_1425083_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_172444864.1|1425102_1425873_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	25.0	6.2e-08
WP_172444865.1|1425888_1427163_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_098119761.1|1427172_1428156_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_172444866.1|1428323_1429502_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172444867.1|1430342_1432775_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.9	1.4e-101
WP_172444868.1|1432774_1434754_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.9	1.6e-129
WP_098119757.1|1435004_1435415_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_172444869.1|1435522_1436722_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	5.8e-21
WP_172444870.1|1436797_1438600_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	31.7	2.6e-25
WP_172444871.1|1438603_1439278_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	3.8e-38
WP_172444872.1|1439519_1440113_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_172444873.1|1440287_1440704_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_172444874.1|1440845_1441007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444875.1|1440987_1441878_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	48.9	6.4e-73
WP_172444876.1|1442033_1443317_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	37.1	4.6e-08
WP_172444877.1|1443370_1443601_-	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
WP_069032371.1|1443641_1443782_-	acid-soluble spore protein N	NA	NA	NA	NA	NA
WP_172444878.1|1443886_1444024_-	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_172444879.1|1444095_1444647_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_172444880.1|1445311_1448038_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_172444881.1|1448486_1448783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444882.1|1448794_1449079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444883.1|1449082_1449265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444884.1|1449275_1449437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444885.1|1449433_1449598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444886.1|1449575_1450208_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	44.2	4.3e-39
WP_172444887.1|1450191_1451445_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	37.3	1.1e-57
WP_172444888.1|1451694_1451898_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	46.0	2.6e-06
WP_172444889.1|1451995_1452265_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_172444890.1|1452317_1452584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172444891.1|1452962_1453154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444892.1|1453715_1454543_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	54.0	8.6e-48
WP_172444893.1|1454526_1454907_-|holin	phage holin family protein	holin	Q8SBN5	Clostridium_phage	53.1	3.7e-22
WP_172444894.1|1455154_1455691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444895.1|1455687_1457565_-	hypothetical protein	NA	M4HNS1	Bacillus_phage	28.3	3.2e-05
WP_172444896.1|1457575_1457947_-	hypothetical protein	NA	M9Q2F8	Clostridium_phage	41.8	4.3e-15
WP_172444897.1|1457959_1460578_-	hypothetical protein	NA	R9TLN4	Paenibacillus_phage	37.3	2.0e-42
WP_172444898.1|1460597_1460882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444899.1|1460914_1461262_-	hypothetical protein	NA	R9TMC6	Paenibacillus_phage	48.6	1.6e-19
WP_172444900.1|1461315_1462023_-	histidine kinase	NA	R9TNE5	Paenibacillus_phage	57.8	4.6e-34
WP_172444901.1|1462026_1462416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444902.1|1462412_1462859_-	HK97 gp10 family phage protein	NA	R9TLN1	Paenibacillus_phage	45.9	4.5e-27
WP_172444903.1|1462858_1463179_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_172444904.1|1463175_1463448_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	52.9	9.4e-20
WP_172444905.1|1463431_1463716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444906.1|1463774_1465022_-|capsid	phage major capsid protein	capsid	A0A0F7L2V9	uncultured_marine_virus	38.3	3.9e-68
WP_172444907.1|1465023_1465683_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	59.6	3.1e-56
WP_172444908.1|1465630_1466914_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.4	5.3e-105
WP_172444909.1|1467209_1468190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444910.1|1468372_1470058_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	70.8	1.0e-233
>prophage 4
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	1473884	1488698	5207261	integrase	Bacillus_phage(26.67%)	19	1477734:1477748	1491847:1491861
WP_172444916.1|1473884_1475396_-	restriction endonuclease subunit S	NA	A0A142K7G3	Mycobacterium_phage	30.8	5.5e-08
WP_172444917.1|1475396_1476866_-	SAM-dependent DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	25.6	1.1e-18
WP_172444918.1|1476903_1479282_-	DEAD/DEAH box helicase family protein	NA	A0A0S0N4Y4	Pseudomonas_phage	23.8	1.4e-10
1477734:1477748	attL	TTGTACCACGACCAA	NA	NA	NA	NA
WP_076371991.1|1479319_1479523_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	52.5	1.2e-11
WP_172444919.1|1480008_1480392_-	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	53.6	3.5e-28
WP_172444920.1|1480507_1480783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444921.1|1480779_1480932_-	hypothetical protein	NA	O48496	Bacillus_phage	50.0	8.7e-07
WP_172444922.1|1480934_1481840_-	DnaD domain protein	NA	A0A2P1JTY8	Anoxybacillus_phage	39.2	1.1e-45
WP_172444923.1|1481864_1482743_-	recombinase RecT	NA	A0A0C5AEC1	Paenibacillus_phage	38.0	6.5e-46
WP_172444924.1|1482735_1484265_-	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	39.4	1.7e-86
WP_172444925.1|1484359_1484509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444926.1|1484574_1485243_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	46.5	1.0e-51
WP_165347280.1|1485242_1485380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172444927.1|1485393_1485576_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_129692472.1|1485645_1485846_-	helix-turn-helix transcriptional regulator	NA	Q6SEA0	Lactobacillus_prophage	35.9	4.8e-05
WP_172444928.1|1486011_1486398_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	51.6	2.8e-09
WP_172444929.1|1486462_1486924_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	35.5	2.5e-12
WP_172444930.1|1486962_1488111_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	38.6	8.8e-67
WP_172444931.1|1488437_1488698_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	40.0	4.2e-09
1491847:1491861	attR	TTGGTCGTGGTACAA	NA	NA	NA	NA
>prophage 5
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	1626353	1685387	5207261	transposase,protease,tRNA,integrase	Bacillus_phage(40.0%)	60	1647228:1647245	1664740:1664757
WP_172445053.1|1626353_1626608_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172445054.1|1626879_1627605_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172445055.1|1627867_1629304_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_098120699.1|1629378_1629777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445056.1|1630069_1630942_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_172447636.1|1631515_1632232_+	L,D-transpeptidase family protein	NA	A0A249Y2K3	Serratia_phage	54.0	4.7e-10
WP_172445057.1|1632331_1633696_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_172445058.1|1633695_1634226_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172445059.1|1635004_1635517_-	hypothetical protein	NA	L0L915	Bacillus_phage	32.9	5.9e-15
WP_172445060.1|1635633_1635804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445061.1|1636223_1637210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172445062.1|1637404_1638613_+	glycosyl transferase family 1	NA	E5KJ78	Phthorimaea_operculella_granulovirus	28.6	2.5e-11
WP_172445063.1|1638965_1639673_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_172445064.1|1639853_1640279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445065.1|1640451_1641054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445066.1|1641094_1641802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445067.1|1641965_1642151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172445068.1|1642363_1643740_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_172447637.1|1643848_1644229_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172445069.1|1644612_1645173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447638.1|1645577_1646345_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_172445070.1|1646410_1646635_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172445071.1|1646636_1647119_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
1647228:1647245	attL	CTTCCATTATATAAAAAG	NA	NA	NA	NA
WP_172445072.1|1647413_1647755_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172445073.1|1647747_1648230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172445074.1|1648226_1648760_+	permease	NA	NA	NA	NA	NA
WP_172445075.1|1649226_1649547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445076.1|1650222_1650696_-	DUF4825 domain-containing protein	NA	NA	NA	NA	NA
WP_172445077.1|1650774_1652070_-	MFS transporter	NA	NA	NA	NA	NA
WP_172445078.1|1652290_1652758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172445079.1|1652849_1653188_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_172445080.1|1653431_1654703_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_172445081.1|1654706_1655975_-	GTPase HflX	NA	NA	NA	NA	NA
WP_172445082.1|1656899_1657376_-	NADAR family protein	NA	A0A0S2MUW9	Bacillus_phage	75.5	2.2e-64
WP_172445083.1|1657528_1658485_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_172445084.1|1658492_1659440_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	41.6	7.3e-51
WP_172447639.1|1659742_1660675_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P793	Bacillus_phage	31.9	5.0e-36
WP_172445085.1|1660717_1661338_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_056470298.1|1661452_1661674_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_172445086.1|1661697_1662654_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_172445087.1|1662857_1664699_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_172445088.1|1664857_1665037_-	hypothetical protein	NA	NA	NA	NA	NA
1664740:1664757	attR	CTTCCATTATATAAAAAG	NA	NA	NA	NA
WP_098121932.1|1665425_1666091_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_172445089.1|1666839_1668213_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	28.5	1.7e-45
WP_172447640.1|1668584_1668815_-	universal stress protein	NA	NA	NA	NA	NA
WP_172445090.1|1668989_1670195_-	MFS transporter	NA	NA	NA	NA	NA
WP_172445091.1|1670291_1671635_-	amino acid permease	NA	NA	NA	NA	NA
WP_172445092.1|1671672_1672677_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_172445093.1|1672825_1673791_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_172445094.1|1673839_1675033_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	33.4	6.4e-52
WP_172445095.1|1675557_1676748_-	MFS transporter	NA	NA	NA	NA	NA
WP_172445096.1|1676849_1677950_-	alkene reductase	NA	NA	NA	NA	NA
WP_172445097.1|1678024_1678288_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172445098.1|1678791_1680051_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_172445099.1|1680286_1681168_+	flap endonuclease	NA	A0A0N7ACJ6	Bacillus_phage	47.7	3.6e-68
WP_172444318.1|1681366_1681690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172447596.1|1681626_1682553_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.0	5.9e-29
WP_172445100.1|1682638_1683391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445101.1|1684473_1685028_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_172447641.1|1685123_1685387_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	2626066	2635479	5207261		Bacillus_virus(50.0%)	11	NA	NA
WP_172445749.1|2626066_2627026_-	RtcB family protein	NA	X2JMN6	Bacillus_phage	59.4	1.7e-103
WP_098811617.1|2627301_2627520_-	RtcB family protein	NA	A0A223LGY9	Bacillus_phage	77.8	8.3e-27
WP_172445750.1|2627924_2628377_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172445751.1|2628642_2629194_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.5	4.7e-34
WP_172445752.1|2629190_2630660_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.8	1.3e-123
WP_098117108.1|2630652_2631282_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	48.1	9.4e-47
WP_172445753.1|2631278_2632100_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.6	4.8e-75
WP_141437756.1|2632203_2632347_+	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_172445754.1|2632478_2633987_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	28.7	1.3e-06
WP_172445755.1|2634199_2634613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172445756.1|2634843_2635479_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	34.7	2.2e-27
>prophage 7
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	3999491	4036428	5207261	integrase,head,capsid,portal,tRNA,tail,protease,terminase	Paenibacillus_phage(20.83%)	49	4007652:4007669	4031656:4031673
WP_172446690.1|3999491_3999959_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_098172723.1|3999939_4000632_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_172446691.1|4000641_4001094_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_172447761.1|4001093_4002113_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.8	1.6e-67
WP_172446692.1|4002330_4004256_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	2.4e-61
WP_172446693.1|4004417_4005044_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_098120714.1|4005086_4005758_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_172446694.1|4006031_4006316_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	3.7e-19
WP_098120712.1|4006374_4008000_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.5	3.8e-156
4007652:4007669	attL	AATTGAAGCAGAAGGTGA	NA	NA	NA	NA
WP_172446695.1|4008119_4009451_+	serine/threonine protein kinase	NA	M1I9S0	Paramecium_bursaria_Chlorella_virus	28.4	2.5e-12
WP_172446696.1|4009544_4010696_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	59.7	4.3e-122
WP_172446697.1|4010933_4011146_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172446698.1|4011242_4011563_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172446699.1|4011842_4012040_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_172446700.1|4012052_4012190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446701.1|4012189_4012858_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	45.5	2.7e-52
WP_172446702.1|4012924_4013074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446703.1|4013166_4014696_+	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	40.0	1.3e-86
WP_172446704.1|4014688_4015567_+	recombinase RecT	NA	A0A0C5AEC1	Paenibacillus_phage	38.4	4.5e-47
WP_172446705.1|4015594_4016404_+	DnaD domain protein	NA	A0A2P1JTY8	Anoxybacillus_phage	37.8	2.7e-38
WP_172446706.1|4016297_4017194_+	ATP-binding protein	NA	S6B1M2	Thermus_phage	46.0	7.1e-64
WP_172446707.1|4017195_4017381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446708.1|4017471_4017699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446709.1|4017685_4017928_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_172446710.1|4017943_4018219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446711.1|4018215_4018638_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	72.0	7.2e-51
WP_172446712.1|4018651_4019371_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_172446713.1|4019596_4019947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446714.1|4019943_4020378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446715.1|4020952_4021108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446716.1|4021135_4021519_+	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	52.0	3.0e-27
WP_172446717.1|4021731_4022619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447762.1|4023316_4023691_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.0	6.2e-30
WP_172446718.1|4023848_4024313_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	59.5	4.5e-46
WP_172446719.1|4024309_4025998_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	57.9	6.2e-186
WP_172446720.1|4026011_4026164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446721.1|4026163_4027474_+|portal	phage portal protein	portal	D0R0D3	Streptococcus_phage	45.2	5.5e-97
WP_172446722.1|4027415_4028021_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	41.6	4.0e-26
WP_172446723.1|4028043_4029315_+|capsid	phage major capsid protein	capsid	A0A0F7L2V9	uncultured_marine_virus	40.7	7.7e-72
WP_172446724.1|4029372_4029651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446725.1|4029634_4029907_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	54.1	2.1e-19
WP_172446726.1|4029903_4030230_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_172446727.1|4030229_4030676_+	HK97 gp10 family phage protein	NA	R9TLN1	Paenibacillus_phage	43.2	7.9e-24
WP_172446728.1|4030672_4031062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446729.1|4031064_4031772_+	histidine kinase	NA	R9TNE5	Paenibacillus_phage	57.0	6.0e-34
4031656:4031673	attR	TCACCTTCTGCTTCAATT	NA	NA	NA	NA
WP_172446730.1|4032595_4032763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446731.1|4033088_4033448_+	hypothetical protein	NA	R9TMC6	Paenibacillus_phage	53.2	3.5e-22
WP_172446732.1|4033471_4033756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446733.1|4033773_4036428_+	hypothetical protein	NA	A0A1S5SEV9	Streptococcus_phage	35.6	9.6e-08
>prophage 8
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	4042837	4056415	5207261		Bacillus_phage(22.22%)	16	NA	NA
WP_172446743.1|4042837_4043803_+	Abi family protein	NA	A0A1S5S8T0	Streptococcus_phage	33.2	2.1e-37
WP_172446744.1|4043995_4045000_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	31.7	1.2e-16
WP_172446745.1|4045548_4045824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172446746.1|4045879_4046311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172446747.1|4046406_4046601_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXH7	Bacillus_phage	53.1	3.8e-15
WP_172446748.1|4048116_4048734_+	replication-relaxation family protein	NA	B3RH37	Bacillus_virus	45.2	1.1e-42
WP_172446749.1|4048748_4049225_+	hypothetical protein	NA	A6XML4	Bacillus_virus	44.9	5.3e-18
WP_172446750.1|4049228_4049879_+	M23 family metallopeptidase	NA	U5PY92	Bacillus_phage	38.6	1.7e-27
WP_172446751.1|4049883_4050180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172447764.1|4050623_4050860_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_172446752.1|4051323_4052175_-	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	29.2	1.5e-26
WP_172446753.1|4052409_4052814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172446754.1|4052962_4053721_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	53.7	4.9e-58
WP_098120708.1|4053775_4054096_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_172446755.1|4054096_4054444_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_172447765.1|4054861_4056415_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.0	1.2e-18
>prophage 9
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	4101465	4109808	5207261		Synechococcus_phage(50.0%)	8	NA	NA
WP_172446777.1|4101465_4102761_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.9e-17
WP_172446778.1|4102878_4103601_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	40.5	5.2e-41
WP_098118149.1|4103588_4103843_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_172446779.1|4103839_4104523_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_172446780.1|4104506_4106726_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	1.8e-161
WP_172446781.1|4106710_4108123_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.4	2.4e-50
WP_172446782.1|4108207_4109245_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.1	2.1e-67
WP_172446783.1|4109244_4109808_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	4.1e-25
>prophage 10
NZ_CP053688	Arthrobacter citreus strain NEB 577 chromosome, complete genome	5207261	4325007	4332909	5207261		Escherichia_phage(33.33%)	7	NA	NA
WP_172446937.1|4325007_4326174_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.7	4.1e-112
WP_172447781.1|4326862_4327771_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172447782.1|4328005_4328884_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.3	1.1e-104
WP_172446938.1|4328897_4329461_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.6	1.6e-42
WP_172446939.1|4329462_4330332_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.7	3.4e-39
WP_172446940.1|4330335_4331349_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.4	6.5e-82
WP_172447783.1|4331796_4332909_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.3	5.4e-05
>prophage 1
NZ_CP053689	Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence	250451	61626	134022	250451	transposase,integrase,protease	Bacillus_phage(36.36%)	60	119719:119743	141195:141219
WP_172448002.1|61626_62136_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.5	1.8e-32
WP_172447856.1|62142_62424_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	5.5e-07
WP_172447857.1|62483_62789_-	hypothetical protein	NA	A0A0N7GFG6	Staphylococcus_phage	49.5	2.8e-20
WP_172448003.1|63732_64134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447858.1|64280_66164_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.0	1.1e-63
WP_172447859.1|67815_68799_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_172447860.1|68810_71246_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_172447861.1|71271_71538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447862.1|71539_71995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447863.1|72004_73645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_091024467.1|73652_73901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447864.1|74179_75043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447865.1|75062_75638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447866.1|75648_76755_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	1.7e-46
WP_172447867.1|76759_78718_-	type IV secretion system protein VirB4	NA	NA	NA	NA	NA
WP_172447868.1|78731_79370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_091024476.1|79366_79675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447869.1|79676_81665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447870.1|81664_82093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447871.1|82112_84554_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_172447872.1|85048_86161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447873.1|86241_86469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447874.1|87016_87232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447875.1|87309_87651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447876.1|88851_89433_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172447877.1|89444_90788_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_172448004.1|90793_91765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447878.1|92297_92720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447879.1|92952_93363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447880.1|93575_93800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447881.1|93947_94202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447882.1|95108_96659_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172447883.1|97372_99367_-	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_172447884.1|100018_100315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447885.1|100631_104636_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	31.1	2.0e-17
WP_172447886.1|105526_109645_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	31.4	1.5e-20
WP_172447887.1|109990_113521_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	26.3	7.0e-14
WP_172447888.1|114923_115229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447889.1|115586_115823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447890.1|117511_117661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447891.1|118017_118584_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_172447892.1|118770_119073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447893.1|119281_119617_-	hypothetical protein	NA	NA	NA	NA	NA
119719:119743	attL	TTCCTTATTCAACTAAACTGCCATT	NA	NA	NA	NA
WP_172447894.1|121453_122059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167555277.1|122541_122718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172447895.1|122972_123989_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172447896.1|124407_125574_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	26.7	1.5e-05
WP_172447897.1|125989_126889_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_172447898.1|126971_127187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447899.1|127329_127623_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_172447900.1|127826_128666_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.6	3.5e-20
WP_172447901.1|128739_129135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447902.1|129388_129886_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_172447903.1|130125_130524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447889.1|130681_130918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172448005.1|131007_131256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447904.1|131547_131835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447905.1|131997_132468_-	NUDIX hydrolase	NA	A0A1V0SJK7	Klosneuvirus	28.3	9.3e-07
WP_172447906.1|132671_133115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172447907.1|133320_134022_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
141195:141219	attR	TTCCTTATTCAACTAAACTGCCATT	NA	NA	NA	NA
