The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	90633	132698	2994628	terminase,plate,holin,capsid,coat,integrase,tail,portal	Listeria_phage(91.38%)	65	91708:91752	133001:133045
WP_003724914.1|90633_91590_+	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	1.6e-29
91708:91752	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_069002475.1|91856_93059_-|integrase	site-specific integrase	integrase	A0A059T666	Listeria_phage	96.5	1.2e-218
WP_061724701.1|93124_93775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140902949.1|93830_93998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061724700.1|94155_94632_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	62.0	1.3e-40
WP_026747215.1|94804_95008_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061724699.1|95028_95295_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	95.5	1.5e-38
WP_003735007.1|95518_95713_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003735006.1|95724_96009_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	100.0	1.1e-47
WP_003727747.1|96034_96316_+	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	100.0	1.0e-40
WP_003735005.1|96347_96509_+	hypothetical protein	NA	A0A0B5CU39	Listeria_phage	100.0	5.6e-20
WP_003727749.1|96501_96744_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_069002476.1|96807_97587_+	phage antirepressor KilAC domain-containing protein	NA	A0A059T6E7	Listeria_phage	94.6	3.2e-137
WP_069002477.1|97709_98234_+	hypothetical protein	NA	A8ASM7	Listeria_phage	92.5	1.3e-81
WP_003731816.1|98240_98426_+	helix-turn-helix domain-containing protein	NA	A0A059T674	Listeria_phage	100.0	1.1e-27
WP_003734954.1|98441_98630_+	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	100.0	4.5e-29
WP_077914463.1|98862_99822_+	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	98.7	1.5e-176
WP_031673697.1|99821_100637_+	recombinase RecT	NA	A8ATY6	Listeria_phage	98.2	2.2e-149
WP_069002495.1|101849_102293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069002498.1|102309_102702_+	hypothetical protein	NA	A0A0B5CYQ9	Listeria_phage	95.4	3.9e-67
WP_069002500.1|102698_103304_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	67.3	4.5e-70
WP_069002503.1|103300_103711_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	57.1	2.2e-36
WP_164481695.1|103711_103882_+	hypothetical protein	NA	A0A059T7N2	Listeria_phage	100.0	9.3e-26
WP_069002506.1|103881_104070_+	alkylphosphonate utilization operon protein PhnA	NA	D7RWG4	Brochothrix_phage	44.6	1.7e-07
WP_069002508.1|104069_104258_+	hypothetical protein	NA	A8ATT5	Listeria_phage	58.3	1.8e-14
WP_069002515.1|104460_104790_+	hypothetical protein	NA	A8ATZ5	Listeria_phage	89.7	2.9e-07
WP_068995190.1|104782_105010_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	97.3	6.6e-35
WP_020830814.1|105021_105309_+	hypothetical protein	NA	R4IBL5	Listeria_phage	60.5	7.4e-23
WP_020830815.1|105305_105584_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	53.3	9.6e-20
WP_031646071.1|105580_105982_+	hypothetical protein	NA	A0A059T6C9	Listeria_phage	79.1	1.2e-52
WP_069002517.1|105981_106464_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	90.0	2.4e-74
WP_003743380.1|106482_106674_+	hypothetical protein	NA	A8ASP6	Listeria_phage	95.2	8.9e-25
WP_069002520.1|106618_107023_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	88.1	8.1e-60
WP_069002521.1|107026_107410_+	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	92.1	7.0e-61
WP_068996524.1|107536_107971_+	hypothetical protein	NA	A8AU03	Listeria_phage	96.5	4.8e-74
WP_069002523.1|108102_108420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069002525.1|108545_109226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069002527.1|109283_110039_+|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	46.1	1.1e-44
WP_069002528.1|110031_111342_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	65.6	2.5e-166
WP_069002529.1|111354_113124_+|portal	phage portal protein	portal	A0A059T657	Listeria_phage	95.5	4.9e-266
WP_012582403.1|113124_114264_+|capsid	phage minor capsid protein	capsid	A0A0B5D147	Listeria_phage	96.6	3.8e-203
WP_069002532.1|114343_114934_+	phage scaffolding protein	NA	A0A059T7N8	Listeria_phage	99.0	3.7e-85
WP_069002535.1|114933_115935_+|coat	coat protein	coat	A0A059T6D4	Listeria_phage	99.7	2.8e-186
WP_069002538.1|115953_116349_+	hypothetical protein	NA	A8ASJ8	Listeria_phage	84.7	2.0e-55
WP_069002547.1|116348_116711_+|capsid	minor capsid protein	capsid	A0A0B5D151	Listeria_phage	94.2	4.3e-60
WP_031645711.1|116710_117049_+	hypothetical protein	NA	A0A059T7W4	Listeria_phage	97.3	7.0e-57
WP_060567821.1|117048_117456_+|capsid	minor capsid protein	capsid	A8ASK1	Listeria_phage	98.5	4.5e-66
WP_003735047.1|117458_117896_+	hypothetical protein	NA	A0A059T6D6	Listeria_phage	100.0	2.5e-78
WP_077398121.1|117825_118158_+	Ig-like domain-containing protein	NA	Q9T1B0	Listeria_phage	87.3	6.3e-42
WP_003743404.1|118210_118633_+|tail	phage tail assembly chaperone	tail	A8ASK4	Listeria_phage	100.0	3.1e-70
WP_069002551.1|118637_119240_+	hypothetical protein	NA	A8ASK5	Listeria_phage	99.5	1.1e-108
WP_069002553.1|119250_124617_+	tape measure protein	NA	A0A0B5CU25	Listeria_phage	86.2	0.0e+00
WP_077951578.1|124613_125441_+|tail	phage tail family protein	tail	A0A059T6D8	Listeria_phage	98.5	1.1e-156
WP_077951579.1|125455_126478_+|tail	phage tail protein	tail	A8ASK8	Listeria_phage	99.7	5.8e-195
WP_069002557.1|126478_127504_+	hypothetical protein	NA	A8ASK9	Listeria_phage	90.9	8.1e-173
WP_069002559.1|127500_128568_+|plate	BppU family phage baseplate upper protein	plate	A0A059T7W9	Listeria_phage	97.7	4.1e-143
WP_031648724.1|128564_128906_+	hypothetical protein	NA	A0A059T7P5	Listeria_phage	99.1	2.1e-56
WP_012581446.1|128906_129053_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	100.0	1.1e-19
WP_003743972.1|129089_129533_+	hypothetical protein	NA	Q8W5Z1	Listeria_phage	100.0	8.0e-77
WP_015970824.1|129511_129916_+	hypothetical protein	NA	Q8W5Z0	Listeria_phage	100.0	9.6e-53
WP_020830702.1|129936_130218_+|holin	phage holin	holin	A0A059T664	Listeria_phage	98.9	5.1e-45
WP_077398116.1|130217_131168_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0B5CTW5	Listeria_phage	96.8	6.8e-182
WP_164481696.1|131428_131602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645688.1|131617_132229_+	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	3.1e-26
WP_010991147.1|132464_132698_+	hypothetical protein	NA	A8ATX0	Listeria_phage	98.7	2.1e-36
133001:133045	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
>prophage 2
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	172397	178924	2994628	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|172397_172850_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|172855_173191_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|173407_173836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724947.1|173847_174264_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	38.6	1.3e-20
WP_003728212.1|174543_174933_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|174945_175458_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|175505_175808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|175849_176254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|176240_178109_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003724951.1|178105_178924_+|tail	phage tail family protein	tail	A0A2H4JAE4	uncultured_Caudovirales_phage	34.9	1.7e-40
>prophage 3
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	1166002	1172928	2994628	integrase	Bacillus_virus(33.33%)	8	1155413:1155426	1173507:1173520
1155413:1155426	attL	AGAAGCGGGAATAA	NA	NA	NA	NA
WP_003724632.1|1166002_1167493_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.5	2.8e-113
WP_003727000.1|1167504_1168329_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003724634.1|1168341_1168650_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003724635.1|1168709_1169114_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012681222.1|1169242_1170799_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
WP_003724637.1|1170997_1171477_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	34.3	7.3e-07
WP_003724638.1|1171654_1171852_+	LysR family transcriptional regulator	NA	Q8SBM7	Clostridium_phage	46.3	1.5e-06
WP_003740555.1|1171854_1172928_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	46.5	5.5e-87
1173507:1173520	attR	AGAAGCGGGAATAA	NA	NA	NA	NA
>prophage 4
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	1323951	1380804	2994628	tRNA,protease	Bacillus_virus(16.67%)	56	NA	NA
WP_003734523.1|1323951_1325091_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1325170_1325566_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1325716_1325932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1326055_1326589_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1326604_1327270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1327531_1328470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1328584_1329868_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1330052_1331312_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1331430_1331997_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1332031_1332601_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1332702_1333245_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1333254_1334118_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1334114_1334900_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1335033_1335894_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1336166_1338245_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1338307_1339612_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003731303.1|1339894_1340797_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003724001.1|1340817_1341357_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1341370_1342780_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003726695.1|1342800_1343580_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003726696.1|1343683_1344103_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1344125_1344437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726697.1|1344439_1345312_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003726698.1|1345353_1345950_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003726699.1|1346107_1346515_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003727510.1|1346695_1348663_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_003734522.1|1348659_1351119_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	1.1e-101
WP_003726814.1|1351202_1351670_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_020830742.1|1352296_1354117_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003734520.1|1354149_1356036_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	32.2	2.9e-43
WP_003726657.1|1356248_1356947_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	6.4e-12
WP_003723738.1|1357179_1358856_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726658.1|1358982_1359900_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1360021_1360255_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012681271.1|1360365_1361589_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003727505.1|1361581_1362808_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1363009_1363378_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1363448_1364783_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003726564.1|1364926_1366222_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.6	2.5e-147
WP_003726565.1|1366255_1366780_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|1366810_1367425_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003726566.1|1367581_1367911_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003726567.1|1368004_1368232_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003734516.1|1368378_1370373_+	transketolase	NA	NA	NA	NA	NA
WP_003726667.1|1370593_1370833_+	YneF family protein	NA	NA	NA	NA	NA
WP_003726668.1|1370881_1371613_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726669.1|1371634_1372141_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003726670.1|1372150_1373455_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	51.9	4.7e-133
WP_012681273.1|1373444_1374650_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003726672.1|1374627_1375002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1375294_1376023_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1376022_1376580_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_031642179.1|1376810_1377569_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	3.3e-22
WP_003727496.1|1377582_1378371_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003726414.1|1378385_1379528_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003726415.1|1379541_1380804_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	1871907	1880193	2994628		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1871907_1872474_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1872470_1873520_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1873538_1874966_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003726211.1|1874950_1877170_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	2.5e-158
WP_003726212.1|1877162_1877846_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003726213.1|1877849_1878095_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1878106_1878820_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003726215.1|1878900_1880193_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	2412810	2452404	2994628	terminase,tail,plate,holin	Listeria_phage(91.38%)	66	NA	NA
WP_031642367.1|2412810_2413020_+	hypothetical protein	NA	R4IBK5	Listeria_phage	95.7	2.3e-26
WP_003734985.1|2413070_2413463_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A8ATC1	Listeria_phage	100.0	5.1e-67
WP_015987299.1|2413459_2413963_-	DUF4065 domain-containing protein	NA	A8ATC0	Listeria_phage	100.0	7.0e-93
WP_031642366.1|2414365_2414782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031642365.1|2414803_2415754_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0B5D123	Listeria_phage	98.7	6.6e-185
WP_010991150.1|2415753_2416035_-|holin	phage holin	holin	A0A059T664	Listeria_phage	100.0	3.0e-45
WP_003733957.1|2416034_2416340_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_003740843.1|2416380_2416527_-	XkdX family protein	NA	A0A0B5CYN8	Listeria_phage	100.0	1.5e-19
WP_031642362.1|2416527_2416869_-	hypothetical protein	NA	A8ASL1	Listeria_phage	93.8	1.5e-54
WP_031642361.1|2416865_2417933_-|plate	BppU family phage baseplate upper protein	plate	A0A0B5CTW3	Listeria_phage	93.2	4.1e-183
WP_031642359.1|2417929_2418958_-	hypothetical protein	NA	A0A0B5D0C2	Listeria_phage	86.5	1.9e-166
WP_031642358.1|2418954_2419968_-|tail	phage tail protein	tail	A0A0B5CYL4	Listeria_phage	99.4	4.4e-187
WP_031642356.1|2419980_2420805_-|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	98.2	4.3e-156
WP_031642352.1|2420808_2425611_-|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	87.0	0.0e+00
WP_072215797.1|2425615_2425927_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	93.4	2.5e-40
WP_003725062.1|2425923_2426355_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	98.6	1.1e-73
WP_003725063.1|2426410_2427100_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	88.2	3.5e-103
WP_003725064.1|2427104_2427476_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_014601499.1|2427472_2427790_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	1.4e-51
WP_003725065.1|2427779_2428145_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	95.0	4.2e-63
WP_003725066.1|2428144_2428498_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	1.2e-59
WP_003725067.1|2428498_2428654_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2428667_2429540_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_031641740.1|2429562_2430117_-	hypothetical protein	NA	A0A0B5CTR8	Listeria_phage	100.0	2.6e-88
WP_003725070.1|2430211_2431255_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	98.0	4.8e-197
WP_003725071.1|2431259_2432819_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	97.7	2.6e-295
WP_003725072.1|2432833_2434180_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	94.1	2.7e-253
WP_003733714.1|2434145_2434886_-	hypothetical protein	NA	A8ATU5	Listeria_phage	98.8	7.0e-134
WP_003725074.1|2434925_2435153_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	1.8e-32
WP_003725075.1|2435413_2435986_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5CTZ3	Listeria_phage	83.2	5.5e-86
WP_003734997.1|2436073_2436229_-	hypothetical protein	NA	A0A0B5D186	Listeria_phage	96.1	7.5e-22
WP_003725077.1|2436369_2436774_-	hypothetical protein	NA	A8AU00	Listeria_phage	90.3	3.8e-65
WP_009930874.1|2436739_2436880_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	84.8	1.4e-14
WP_003725078.1|2436876_2437182_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	63.4	1.2e-26
WP_003725079.1|2437201_2437681_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	91.2	1.6e-75
WP_003725080.1|2437677_2438079_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	72.2	4.8e-44
WP_003725081.1|2438296_2438485_-	SAM--benzoic acid carboxyl methyltransferase	NA	D7RWG4	Brochothrix_phage	49.1	4.4e-08
WP_003725082.1|2438488_2438872_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	66.7	2.3e-19
WP_003725137.1|2438858_2439065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003725083.1|2439061_2439622_-	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	72.0	9.2e-70
WP_003725084.1|2439618_2439891_-	hypothetical protein	NA	A0A059T6G3	Listeria_phage	91.6	3.6e-35
WP_003725085.1|2439887_2440802_-	hypothetical protein	NA	I1W658	Staphylococcus_phage	40.2	8.7e-17
WP_003725086.1|2440831_2441647_-	recombinase RecT	NA	A8ATY6	Listeria_phage	97.4	4.2e-148
WP_003725087.1|2441649_2442609_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	98.1	8.7e-177
WP_003725088.1|2442841_2443030_-	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	6.9e-22
WP_031642351.1|2443137_2443353_-	hypothetical protein	NA	Q9T176	Listeria_phage	90.1	3.7e-27
WP_010991176.1|2443349_2443883_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	87.3	2.3e-78
WP_031642350.1|2444005_2444785_-	phage antirepressor KilAC domain-containing protein	NA	A0A059T6E7	Listeria_phage	98.5	1.1e-142
WP_003733684.1|2444848_2445046_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_031642348.1|2445047_2445329_-	hypothetical protein	NA	A8ATX8	Listeria_phage	94.6	1.5e-36
WP_003725139.1|2445340_2445535_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	85.9	2.7e-21
WP_003725143.1|2445708_2446011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003725096.1|2446027_2446204_-	hypothetical protein	NA	Q9T184	Listeria_phage	98.3	3.7e-09
WP_003741072.1|2446207_2446426_-	helix-turn-helix transcriptional regulator	NA	A0A1U9WQN6	Geobacillus_phage	44.0	1.2e-06
WP_003725140.1|2446572_2446806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020830686.1|2446820_2447084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725144.1|2447043_2447229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003725098.1|2447233_2447503_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	86.5	3.9e-34
WP_003725099.1|2447651_2447960_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	99.0	1.6e-47
WP_003725100.1|2447990_2448482_+	hypothetical protein	NA	A8ATX4	Listeria_phage	98.2	7.0e-90
WP_003725101.1|2448504_2448723_+	zinc ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	95.8	2.3e-32
WP_020830685.1|2448737_2449343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725102.1|2449404_2450112_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	93.6	4.8e-116
WP_031642347.1|2450176_2451535_+	recombinase family protein	NA	Q9T193	Listeria_phage	98.0	1.1e-254
WP_031642346.1|2451525_2452002_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2452056_2452404_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 7
NZ_CP053628	Listeria monocytogenes strain OB030029 chromosome, complete genome	2994628	2595462	2603307	2994628		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2595462_2596434_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003725408.1|2596441_2597410_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	3.9e-68
WP_003722606.1|2597411_2598287_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2598394_2600125_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_003741152.1|2600166_2601228_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003725411.1|2601244_2602228_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.0e-52
WP_003722610.1|2602347_2603307_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP053629	Listeria monocytogenes strain OB030029 plasmid pOB030029, complete sequence	55801	2583	50900	55801	integrase,transposase	Streptococcus_phage(21.74%)	53	27239:27252	47174:47187
WP_023558793.1|2583_3171_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	1.9e-33
WP_013315180.1|3262_4018_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	2.4e-81
WP_003755396.1|4028_5255_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	6.2e-135
WP_013315183.1|5466_5583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171878362.1|5763_6189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558800.1|6191_7109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728492.1|7473_7713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952171.1|7724_8165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558802.1|8157_9498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558804.1|9508_9871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558806.1|9890_10655_+	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
WP_003728487.1|10768_11299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558808.1|11335_11671_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_011011011.1|11844_12243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952173.1|12955_13300_+	TnpV protein	NA	NA	NA	NA	NA
WP_072235488.1|13341_13749_+	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	1.4e-11
WP_013315180.1|15068_15824_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	2.4e-81
WP_011011055.1|15901_16195_-	DUF3116 family protein	NA	NA	NA	NA	NA
WP_011011054.1|16211_17366_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_023558820.1|17512_18751_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	55.5	2.3e-121
WP_031642122.1|18772_19132_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	31.7	1.7e-08
WP_023558824.1|19131_19518_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	34.4	6.2e-09
WP_023558827.1|19529_20165_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011011045.1|21238_21919_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.5	5.5e-93
WP_023558833.1|22196_23480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325573.1|24080_24260_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_002307648.1|24262_24487_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_007208418.1|24470_25274_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002405071.1|25429_26044_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002307652.1|26059_26425_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_002405069.1|26408_26840_+	cation transporter	NA	NA	NA	NA	NA
WP_023558840.1|26850_28437_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
27239:27252	attL	AAAAAACTGAAACA	NA	NA	NA	NA
WP_023558842.1|28464_29145_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	4.0e-35
WP_023558844.1|29144_30539_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	9.4e-39
WP_002307659.1|30553_30760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023558846.1|30780_31377_+	YdhK family protein	NA	NA	NA	NA	NA
WP_023558753.1|33156_35118_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.1	4.6e-92
WP_023558755.1|35156_35429_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023558757.1|35471_35843_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023558759.1|35857_36352_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_031642114.1|37112_38423_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011011045.1|38551_39232_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.5	5.5e-93
WP_023558764.1|39291_39795_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.9	6.6e-19
WP_003726382.1|39826_40207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726381.1|40439_42557_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	62.6	5.3e-235
WP_003726380.1|42553_42913_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	48.2	5.4e-23
WP_003725299.1|43186_43786_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	31.8	1.8e-15
WP_003725298.1|43944_45381_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	24.8	9.4e-18
WP_023558766.1|45373_45754_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023558770.1|46857_47781_+	EamA family transporter	NA	NA	NA	NA	NA
47174:47187	attR	TGTTTCAGTTTTTT	NA	NA	NA	NA
WP_023558772.1|48300_49449_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	24.6	3.1e-11
WP_106490519.1|49761_50649_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.6	1.9e-69
WP_023558776.1|50645_50900_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	47.6	9.4e-14
