The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	283540	300957	4584794	plate,tail	Burkholderia_phage(41.18%)	23	NA	NA
WP_001122140.1|283540_284332_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	3.7e-48
WP_000471231.1|284360_285089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002431754.1|285302_285758_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	2.3e-26
WP_001091606.1|285754_286462_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000135570.1|286458_288039_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.7e-84
WP_000359521.1|288038_288758_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.9e-22
WP_000951746.1|288750_289866_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_001093497.1|289856_290216_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	63.3	1.1e-34
WP_000679402.1|290314_291016_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_000808050.1|291025_292066_-	phage late control D family protein	NA	K4HZC6	Acidithiobacillus_phage	25.2	2.6e-17
WP_001269712.1|292053_292263_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271436.1|292262_293216_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_105223383.1|293215_295591_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	27.7	1.9e-55
WP_015674804.1|295691_295820_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658217.1|295779_296097_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907501.1|296147_296672_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	5.6e-69
WP_171881960.1|296671_298096_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.0	1.7e-189
WP_000875309.1|298085_298283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404766.1|298279_298735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777271.1|298852_299167_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.2	7.1e-19
WP_000266449.1|299179_299785_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.6	7.4e-57
WP_000724378.1|299787_300075_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.0e-16
WP_000619863.1|300612_300957_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	47.6	6.3e-21
>prophage 2
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	600603	676530	4584794	tRNA,protease,integrase,terminase,tail,portal,holin	Enterobacteria_phage(37.04%)	89	599404:599418	634687:634701
599404:599418	attL	GCTGCCGCCATTGCC	NA	NA	NA	NA
WP_001218281.1|600603_601827_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
WP_001317460.1|602087_602420_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_071821821.1|602622_602898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008205.1|603132_603669_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	1.5e-98
WP_171881964.1|603796_604621_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.1e-148
WP_000135682.1|604686_605049_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|605517_605952_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|605923_606130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|606364_607039_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|607129_607330_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|607373_607925_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|608100_608280_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|608269_609211_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_171881965.1|609207_609702_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	96.3	2.8e-86
WP_001442792.1|609701_610355_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|610351_610678_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|610674_611064_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061379.1|611083_611893_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_130569203.1|611900_612890_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
WP_001047105.1|612903_613656_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000087756.1|614071_614284_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|614586_614802_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|615554_615770_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_104919930.1|615774_616326_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	2.5e-35
WP_001306174.1|616273_616534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101174.1|616647_617181_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	3.2e-96
WP_001071778.1|617177_617675_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|618038_618251_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|618261_618450_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|618597_618753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024256583.1|618925_619099_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|619394_619601_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349501.1|620153_620645_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_000934084.1|620644_622747_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_001072975.1|622743_622956_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_015953980.1|622883_624464_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_171881966.1|624408_626436_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_171881967.1|626522_626846_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	4.2e-51
WP_001283153.1|626838_627114_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|627125_627704_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|627700_628102_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|628113_628857_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|628917_629304_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|629312_629642_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_171881968.1|629613_632679_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|632678_633008_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_171881969.1|633017_633716_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	2.5e-133
WP_000194779.1|633721_634465_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090917.1|634401_635034_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
634687:634701	attR	GCTGCCGCCATTGCC	NA	NA	NA	NA
WP_171881970.1|635094_638571_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.7	0.0e+00
WP_001233057.1|638640_639240_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_171882159.1|641512_642427_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	90.2	4.4e-37
WP_148047361.1|642426_643002_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_109538372.1|643099_643690_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	4.3e-25
WP_000836769.1|644069_644303_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|644371_644485_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|644911_645160_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202560.1|645379_646966_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295410.1|647358_647964_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|648090_648252_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_002431697.1|648373_649447_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563097.1|649443_650226_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088436.1|650355_651219_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_171881971.1|651190_652741_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|652998_653778_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477829.1|653855_655178_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_000816462.1|655229_656453_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224875.1|656509_657229_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566247.1|657389_657653_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000105825.1|657684_658701_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124606.1|658728_659373_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132947.1|659478_660447_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|660495_661878_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093833.1|661899_663132_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000513551.1|663223_663556_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|663557_663842_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046749.1|663897_665565_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409432.1|665775_667713_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	1.8e-11
WP_000068676.1|667802_668129_+	trp operon repressor	NA	NA	NA	NA	NA
WP_024256797.1|668122_668638_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942356.1|668689_669337_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371663.1|669333_670203_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875492.1|670413_670887_+	protein CreA	NA	NA	NA	NA	NA
WP_001188059.1|670899_671589_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_001219550.1|671588_673013_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_000946445.1|673070_674429_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|674493_675210_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001541509.1|675305_675446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241205.1|675843_676530_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	1631607	1703491	4584794	transposase,protease,plate,lysis,integrase,capsid,terminase,tail,portal,head	Salmonella_phage(68.0%)	80	1627239:1627253	1652393:1652407
1627239:1627253	attL	GCTGTTGATGGTGAT	NA	NA	NA	NA
WP_001471277.1|1631607_1632639_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
WP_001321204.1|1632825_1633017_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_016245839.1|1633032_1633602_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001247707.1|1633727_1633949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1633981_1634491_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1634498_1634699_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|1634662_1635004_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244167.1|1635071_1635305_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000752613.1|1635304_1635532_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_171881995.1|1635528_1636386_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	4.6e-161
WP_149792048.1|1636382_1638797_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154434.1|1638950_1639139_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1639149_1639383_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001292590.1|1639602_1639803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094249479.1|1639806_1640589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023145585.1|1640972_1642730_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_094249480.1|1642779_1643811_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	2.2e-170
WP_171881996.1|1643810_1645577_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_094089135.1|1645719_1646532_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	2.0e-121
WP_000742510.1|1646548_1647607_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_171881997.1|1647610_1648261_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	2.5e-111
WP_171881998.1|1648356_1648821_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	5.5e-76
WP_000868175.1|1648820_1649024_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1649027_1649243_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|1649223_1649736_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727851.1|1649737_1650115_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_171881999.1|1650111_1650540_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	9.3e-46
WP_024201512.1|1650635_1651067_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
WP_171882000.1|1651059_1651506_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	5.6e-62
WP_097508461.1|1651574_1652153_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_171882001.1|1652149_1652509_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
1652393:1652407	attR	ATCACCATCAACAGC	NA	NA	NA	NA
WP_171882002.1|1652495_1653404_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_171882003.1|1653396_1654002_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	6.8e-111
WP_171882004.1|1653998_1655390_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	40.6	1.1e-90
WP_064670451.1|1655389_1655992_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	67.0	1.8e-71
WP_171882162.1|1655983_1657030_-	acyltransferase	NA	G9L6E5	Escherichia_phage	25.3	7.4e-12
WP_096167095.1|1657228_1658401_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|1658410_1658926_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_089565824.1|1658980_1659283_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	4.1e-40
WP_000763311.1|1659297_1659417_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_097765208.1|1659409_1662487_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_000980391.1|1662483_1662969_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_040091142.1|1662965_1664066_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
WP_000972391.1|1664156_1664375_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024887.1|1664610_1666296_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000824135.1|1666564_1666954_+	membrane protein	NA	NA	NA	NA	NA
WP_000189184.1|1667118_1667841_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684353.1|1667890_1668793_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	35.7	3.0e-38
WP_000202971.1|1668881_1669358_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|1669709_1670822_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996012.1|1670916_1672050_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105437.1|1672059_1673013_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1673009_1673855_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389256.1|1673914_1674403_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149691.1|1674443_1675571_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	2.7e-28
WP_001354873.1|1675745_1676477_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000895400.1|1676767_1677436_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001698.1|1677435_1678152_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756580.1|1678158_1678890_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027200.1|1678907_1679636_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.7e-29
WP_001270745.1|1679853_1680369_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160731.1|1680494_1680818_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255173.1|1680814_1681645_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_024256718.1|1681641_1682655_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171882005.1|1682753_1684184_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_000566408.1|1684194_1685196_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815347.1|1685233_1686952_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	2.3e-31
WP_000226602.1|1687103_1687538_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000178687.1|1687595_1688564_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458814.1|1688575_1690228_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491143.1|1690371_1691271_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000868863.1|1691611_1692637_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000488716.1|1693153_1693849_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599778.1|1694270_1695929_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002431630.1|1695925_1696876_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_001242896.1|1697037_1698153_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188206.1|1698149_1700096_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.8	1.1e-40
WP_000410783.1|1700316_1700538_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	2.3e-16
WP_000047741.1|1700860_1701181_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_000934073.1|1701211_1703491_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	8.7e-167
>prophage 4
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	1780466	1825513	4584794	protease,coat	Bacillus_phage(33.33%)	46	NA	NA
WP_000156542.1|1780466_1782227_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877154.1|1782411_1782867_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_024256413.1|1782921_1783977_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288735.1|1784333_1784843_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000793790.1|1785059_1785689_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_032243386.1|1785651_1787805_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002431615.1|1787824_1788271_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_171882007.1|1788393_1790448_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.3e-20
WP_000424177.1|1790479_1790938_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000643580.1|1791033_1791696_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665266.1|1791868_1792282_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561985.1|1792328_1792646_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116320.1|1792703_1793894_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1793988_1794267_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904443.1|1794263_1794593_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1794683_1795343_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_171882008.1|1795930_1796686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002431613.1|1796995_1798114_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107367.1|1798110_1799904_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186414.1|1799922_1800630_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003633.1|1800626_1801214_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063963.1|1801210_1801609_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004888.1|1801605_1802460_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_001091689.1|1802553_1803219_+	YecA family protein	NA	NA	NA	NA	NA
WP_024256854.1|1803258_1804470_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000094892.1|1804664_1804904_+	YecH family protein	NA	NA	NA	NA	NA
WP_000909918.1|1804941_1805439_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_000706230.1|1805568_1805904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246691.1|1806049_1806553_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548664.1|1807510_1808500_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_002432082.1|1808594_1810109_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.1e-11
WP_000100214.1|1810123_1811110_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_000165652.1|1811263_1812067_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000089022.1|1812041_1813466_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000332011.1|1813472_1813901_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002431607.1|1814718_1815069_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291584.1|1815071_1815650_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000905460.1|1815774_1816662_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000796096.1|1816658_1817573_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_072274242.1|1817577_1819533_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_001098482.1|1819549_1820044_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001038662.1|1820313_1820883_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002432086.1|1820895_1821435_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_000836024.1|1821447_1822194_+	molecular chaperone	NA	NA	NA	NA	NA
WP_024256856.1|1822169_1824557_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000638294.1|1824553_1825513_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2572706	2582308	4584794		Enterobacteria_phage(33.33%)	11	NA	NA
WP_171882041.1|2572706_2573144_-	hypothetical protein	NA	E5EYN6	Acinetobacter_phage	32.0	9.6e-06
WP_171882042.1|2573184_2573637_+	glycoside hydrolase family protein	NA	H6X3N0	Enterobacteria_phage	44.0	3.6e-24
WP_152064256.1|2573664_2573931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038994387.1|2573996_2574644_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	45.8	1.3e-46
WP_152064255.1|2574653_2574950_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	38.4	2.1e-12
WP_152064254.1|2574949_2575135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171882043.1|2575191_2578494_-	fibronectin type III domain-containing protein	NA	A0A192Y7S7	Enterobacteria_phage	73.3	1.5e-10
WP_171882044.1|2578493_2578886_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_171882045.1|2578885_2579521_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_171882046.1|2579520_2580075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171882047.1|2580142_2582308_-	hypothetical protein	NA	M4MA23	Vibrio_phage	24.6	3.4e-11
>prophage 6
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2700517	2720848	4584794	transposase,plate	uncultured_Caudovirales_phage(50.0%)	16	NA	NA
WP_000201156.1|2700517_2701873_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_123057263.1|2701875_2702379_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000829651.1|2702405_2703686_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000907477.1|2703709_2704747_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000895890.1|2704710_2706543_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000877049.1|2706548_2706986_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000058009.1|2706988_2708470_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000098291.1|2708484_2708985_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2709676_2710195_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001114046.1|2710404_2712351_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	39.4	5.4e-24
WP_001106815.1|2712372_2712792_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_171882167.1|2717057_2717387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002432282.1|2717428_2717710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171882058.1|2718148_2719285_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000911009.1|2719395_2719830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105223492.1|2720153_2720848_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	90.9	2.8e-124
>prophage 7
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2732907	2788915	4584794	protease,plate,portal,integrase,terminase,tail,capsid,holin,head	Shigella_phage(60.38%)	73	2738195:2738211	2791549:2791565
WP_000035049.1|2732907_2736294_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_105223493.1|2736345_2737293_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_001086627.1|2737304_2737787_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000564323.1|2737783_2738404_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
2738195:2738211	attL	CATATTCATATGTCTCC	NA	NA	NA	NA
WP_000139440.1|2738415_2739081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095891.1|2739113_2739515_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000481836.1|2739530_2739860_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000621208.1|2739926_2740853_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_105223494.1|2741079_2741565_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_000622360.1|2742063_2742981_-	regulatory protein PocR	NA	NA	NA	NA	NA
WP_024256672.1|2743175_2743967_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.0	1.9e-12
WP_001183612.1|2744470_2744755_+	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_000097503.1|2744751_2745561_+	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_171882059.1|2745579_2747244_+	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
WP_000405059.1|2747254_2747917_+	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
WP_001090594.1|2747931_2748456_+	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
WP_151044300.1|2749420_2750578_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	1.8e-221
WP_063117636.1|2750716_2751079_+	GtrA family protein	NA	U5P0S6	Shigella_phage	89.2	6.0e-54
WP_151044136.1|2751075_2752008_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	90.7	1.4e-160
WP_151044138.1|2752000_2753329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171882060.1|2753384_2753549_-	hypothetical protein	NA	A0A077KCA4	Edwardsiella_phage	64.5	2.1e-06
WP_171882061.1|2753559_2753976_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
WP_063073959.1|2754994_2755579_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	5.9e-112
WP_095462907.1|2755569_2756628_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	4.3e-201
WP_141035408.1|2756614_2757040_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	5.7e-80
WP_001259084.1|2757039_2757588_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_171882062.1|2757587_2758667_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	3.8e-205
WP_171882063.1|2758663_2759992_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	3.5e-245
WP_171882064.1|2760052_2761888_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.5e-307
WP_000661054.1|2762029_2762299_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_024235248.1|2762298_2762655_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	3.4e-62
WP_171882065.1|2762654_2764151_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.0	3.5e-273
WP_000497751.1|2764134_2764305_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|2764313_2764874_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_050902006.1|2764870_2765377_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	3.8e-83
WP_077861943.1|2765351_2765762_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	2.6e-69
WP_000927711.1|2765758_2766082_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2766084_2766285_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257507.1|2766334_2767540_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|2767554_2768205_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_171882066.1|2768182_2769424_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_000605606.1|2769423_2769606_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_065312442.1|2769617_2771114_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929175.1|2771347_2771842_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001583200.1|2771967_2772318_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
WP_001089763.1|2772468_2772804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613842.1|2772904_2773474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986267.1|2773495_2773753_-	peptidase	NA	Q8SBD8	Shigella_phage	75.6	3.7e-26
WP_001356320.1|2773637_2774030_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	9.3e-53
WP_027661775.1|2774013_2774490_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	2.3e-85
WP_027661774.1|2774493_2774829_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_151044165.1|2774906_2775959_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.4	2.0e-203
WP_001317671.1|2776108_2776303_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000966854.1|2776483_2777014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089600866.1|2777168_2777921_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
WP_089600864.1|2777934_2778924_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	4.0e-193
WP_113416285.1|2778931_2779729_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	97.7	1.3e-146
WP_000767096.1|2779748_2780138_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_000210164.1|2780134_2780461_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001355692.1|2780457_2781111_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_151044168.1|2781110_2781605_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	3.6e-86
WP_088224518.1|2781601_2782543_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.7	6.2e-143
WP_001250269.1|2782532_2782712_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_151044171.1|2782887_2783439_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	7.6e-101
WP_000205494.1|2783476_2783677_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|2783774_2784401_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000159356.1|2784826_2785018_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_028985421.1|2785456_2785819_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_151044174.1|2785884_2786709_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_001371719.1|2786836_2787373_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_000335007.1|2787363_2788242_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	6.3e-166
WP_151044177.1|2788238_2788583_+	DNA-binding protein	NA	U5P0J0	Shigella_phage	79.5	9.7e-30
WP_001163428.1|2788714_2788915_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2791549:2791565	attR	CATATTCATATGTCTCC	NA	NA	NA	NA
>prophage 8
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2802863	2842633	4584794	protease,lysis,integrase,terminase,portal,holin,head	Enterobacteria_phage(57.89%)	58	2814234:2814248	2843146:2843160
WP_171882074.1|2802863_2803253_-	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	88.3	5.4e-61
WP_104726698.1|2803356_2804388_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.9	9.1e-23
WP_171882075.1|2804448_2806491_-|head	phage head-binding domain-containing protein	head	S4TU85	Salmonella_phage	53.6	2.0e-162
WP_050008021.1|2806762_2807206_-	hypothetical protein	NA	I6S1K6	Salmonella_phage	99.3	3.2e-81
WP_032219532.1|2807186_2807630_-	SocA family protein	NA	I6R0L8	Salmonella_phage	100.0	9.8e-83
WP_016231948.1|2808008_2808494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074480950.1|2808512_2808665_+	hypothetical protein	NA	A0A088CPT2	Enterobacteria_phage	55.6	2.1e-05
WP_171882168.1|2808682_2810656_-	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	98.6	0.0e+00
WP_171882076.1|2810910_2812323_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	57.6	6.6e-133
WP_001544386.1|2812332_2813013_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	73.7	1.5e-53
WP_046082882.1|2812999_2813467_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	2.2e-64
WP_171882077.1|2813466_2814315_-	hypothetical protein	NA	Q716G6	Shigella_phage	93.6	1.4e-93
2814234:2814248	attL	AGAAGATATTGCGTG	NA	NA	NA	NA
WP_171882078.1|2814314_2815733_-	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.8	2.4e-276
WP_001140510.1|2815742_2816204_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_069905690.1|2816184_2816373_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	96.8	9.4e-27
WP_016248918.1|2816414_2817668_-	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	99.8	4.4e-237
WP_021560734.1|2817686_2818580_-	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.0	9.1e-128
WP_171882079.1|2818670_2820869_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.2	0.0e+00
WP_171882080.1|2820870_2822286_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	1.2e-278
WP_000113732.1|2822282_2822723_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|2822725_2822968_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999679.1|2823071_2823443_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	2.0e-57
WP_001058931.1|2823621_2824107_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_001139680.1|2824308_2824461_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_171882081.1|2824448_2824886_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	3.2e-70
WP_000229392.1|2824882_2825359_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2825342_2825666_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000512806.1|2826155_2826644_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_171882082.1|2826634_2827306_-	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	98.7	4.6e-132
WP_000144614.1|2827283_2827490_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_171882083.1|2827486_2828098_-	recombination protein NinG	NA	K7P6N9	Enterobacteria_phage	97.0	1.5e-97
WP_113415686.1|2828097_2828367_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	6.0e-43
WP_171882084.1|2828359_2828569_-	protein ninF	NA	G9L691	Escherichia_phage	94.2	4.5e-30
WP_023486201.1|2828528_2828930_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	85.7	5.2e-59
WP_052938503.1|2829104_2829950_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	57.0	1.1e-90
WP_052938504.1|2829946_2830387_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	98.6	1.3e-79
WP_171882085.1|2830611_2830932_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	75.5	4.5e-37
WP_001036029.1|2831620_2831890_-	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_171882086.1|2831889_2833326_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.6	2.3e-274
WP_057697610.1|2833315_2834215_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	99.7	2.3e-163
WP_000166207.1|2834207_2834354_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438527.1|2834386_2834683_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000067727.1|2834824_2835040_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_016242500.1|2835115_2835811_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000088201.1|2836156_2836429_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000167595.1|2836487_2836958_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_072971834.1|2837140_2838109_+	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_000638547.1|2838132_2838264_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2838248_2838401_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2838476_2838647_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000365280.1|2838655_2839363_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_000168274.1|2839363_2839870_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_001111303.1|2839883_2840177_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_001459566.1|2840187_2840352_+	DUF2737 family protein	NA	K7PLP7	Enterobacteria_phage	100.0	9.3e-23
WP_171882087.1|2840348_2840867_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	94.8	4.5e-87
WP_171882088.1|2840863_2841133_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	52.9	5.7e-17
WP_000132739.1|2841282_2841474_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007947.1|2841454_2842633_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
2843146:2843160	attR	CACGCAATATCTTCT	NA	NA	NA	NA
>prophage 9
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2867215	2875171	4584794		Bathycoccus_sp._RCC1105_virus(16.67%)	8	NA	NA
WP_000564888.1|2867215_2868319_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
WP_000971201.1|2868315_2868783_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001025599.1|2868779_2869175_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676087.1|2869178_2870042_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.7	9.7e-111
WP_000699410.1|2870041_2871127_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	5.2e-101
WP_000183060.1|2871487_2872381_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999473.1|2872623_2873619_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001116024.1|2873776_2875171_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	1.8e-18
>prophage 10
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	2974649	2984107	4584794		Enterobacteria_phage(85.71%)	10	NA	NA
WP_002432370.1|2974649_2975786_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.7	1.2e-164
WP_001087217.1|2975782_2977798_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	88.2	0.0e+00
WP_000643202.1|2977924_2978383_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	3.2e-52
WP_002431448.1|2978425_2978896_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	4.0e-82
WP_000598631.1|2978942_2979662_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002431447.1|2979658_2981344_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	93.8	3.3e-288
WP_001240384.1|2981565_2982297_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.0	2.0e-109
WP_001216963.1|2982356_2982464_+	protein YohO	NA	NA	NA	NA	NA
WP_171882102.1|2982444_2983176_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569380.1|2983180_2984107_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	5.7e-08
>prophage 11
NZ_CP053045	Escherichia fergusonii strain HNCF11W chromosome, complete genome	4584794	3462837	3514041	4584794	lysis,portal,integrase,terminase,tail,capsid,head	Enterobacteria_phage(58.93%)	64	3510292:3510343	3523299:3523350
WP_002432462.1|3462837_3463422_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.8	1.2e-101
WP_000609073.1|3463430_3464333_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	66.1	1.1e-96
WP_171882122.1|3464329_3467080_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	58.6	1.1e-59
WP_001233057.1|3467144_3467744_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_171882123.1|3467813_3471290_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_000090917.1|3471350_3471983_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000194779.1|3471919_3472663_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152616.1|3472668_3473367_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847332.1|3473366_3473696_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_171882124.1|3473692_3476254_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.7	0.0e+00
WP_000459462.1|3476246_3476681_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
WP_000479193.1|3476662_3477085_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_002432346.1|3477100_3477841_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_046081336.1|3477848_3478244_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	98.5	5.5e-69
WP_171882125.1|3478240_3478819_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752972.1|3478830_3479184_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	98.3	1.7e-61
WP_000158924.1|3479195_3479594_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.2e-57
WP_000063221.1|3479635_3480661_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_024256905.1|3480716_3481049_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	1.6e-53
WP_000123209.1|3481058_3482378_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.8e-233
WP_002431458.1|3482358_3483960_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000198149.1|3483956_3484163_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_171882126.1|3484159_3486085_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.8	0.0e+00
WP_000867489.1|3486059_3486605_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001663509.1|3486991_3487225_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3487281_3487692_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|3488041_3488563_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_001082734.1|3488767_3489226_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	3.6e-72
WP_046080618.1|3489222_3489720_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	2.1e-89
WP_000839582.1|3489719_3489935_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146305.1|3490123_3490855_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|3491204_3492164_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3492356_3492881_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3493035_3493413_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|3493498_3493639_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099515.1|3493635_3493998_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	2.8e-59
WP_000774490.1|3493994_3494285_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_000224916.1|3494277_3494448_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_171882127.1|3494447_3494903_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.9	1.7e-61
WP_001309322.1|3494899_3495001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171882170.1|3495097_3495349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211451.1|3495842_3496451_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_000195116.1|3497263_3498766_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.8e-62
WP_171882128.1|3499014_3499317_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	2.3e-43
WP_112794017.1|3499313_3500015_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_171882129.1|3500011_3501031_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	65.4	3.6e-112
WP_148047522.1|3501027_3501567_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_001067459.1|3501636_3501867_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_000858975.1|3501971_3502661_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3502783_3503533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032176957.1|3503529_3504357_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3504865_3505072_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3505148_3505445_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3505450_3506236_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186812.1|3506232_3506913_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_072274178.1|3506909_3507068_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	4.2e-20
WP_021557045.1|3507064_3508129_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_000763364.1|3508282_3508501_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488407.1|3508548_3508827_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000023575.1|3509119_3510280_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	100.0	1.2e-228
3510292:3510343	attL	AGATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_000201382.1|3510431_3511505_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.9	3.8e-48
WP_086512686.1|3511514_3512405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086512687.1|3512391_3512619_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_032305528.1|3512820_3514041_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	60.3	5.1e-105
3523299:3523350	attR	AGATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
>prophage 1
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	0	6637	130643		Escherichia_phage(75.0%)	5	NA	NA
WP_000224045.1|3680_4121_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.3	1.9e-78
WP_000747846.1|4117_4366_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_064670748.1|4427_5378_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_171882172.1|5420_6062_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	92.0	8.3e-107
WP_171882173.1|6250_6637_-	Ref family protein	NA	Q71TG3	Escherichia_phage	94.6	6.2e-57
>prophage 2
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	10136	48853	130643	transposase,terminase,integrase	Escherichia_phage(59.09%)	38	7265:7282	45413:45430
7265:7282	attL	AACTCGCAGCAATTCTTG	NA	NA	NA	NA
WP_001067855.1|10136_10841_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001366550.1|11472_12210_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|12206_12431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|12641_14135_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012728215.1|14165_15050_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|15266_16481_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|16508_16814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|18600_19305_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|19551_20025_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001209508.1|20099_20891_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|20907_21708_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_012300772.1|21972_23232_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|23552_24005_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_001067855.1|25235_25940_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|27017_27674_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|28453_29845_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|29881_30454_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|30590_31181_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000844627.1|31298_31541_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039045916.1|31572_32208_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|32313_33513_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|33544_34429_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|34566_34974_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_071595431.1|36961_37069_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
WP_171882174.1|37261_37573_-	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	95.1	2.0e-45
WP_097333846.1|37623_38655_-|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.4	8.4e-194
WP_171882175.1|38662_38884_-	creatininase	NA	Q38403	Escherichia_phage	98.6	7.6e-36
WP_000874152.1|39488_39698_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	97.1	2.0e-30
WP_000611653.1|39808_40660_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	98.9	6.8e-157
WP_171882176.1|40692_41748_-	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	75.3	1.3e-141
WP_000124157.1|42325_43810_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.6	1.3e-291
WP_171882177.1|43809_45003_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	95.7	5.9e-199
WP_001312282.1|45089_45542_-	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
45413:45430	attR	CAAGAATTGCTGCGAGTT	NA	NA	NA	NA
WP_000648827.1|45630_46674_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	100.0	1.0e-207
WP_039022005.1|46701_46881_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	1.0e-22
WP_001216046.1|46885_47266_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	98.4	3.1e-61
WP_001190712.1|47265_47487_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000019445.1|47872_48853_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 3
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	54335	55880	130643		Escherichia_phage(100.0%)	1	NA	NA
WP_000702558.1|54335_55880_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 4
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	59584	71508	130643	transposase,plate	Escherichia_phage(78.57%)	14	NA	NA
WP_000107683.1|59584_60847_-	hypothetical protein	NA	A0A077SL55	Escherichia_phage	99.0	2.3e-233
WP_000684875.1|61148_61850_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	3.6e-140
WP_089573037.1|61846_62524_-	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.1	2.4e-133
WP_171882178.1|62520_63147_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	3.6e-123
WP_000095380.1|63648_63804_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_000943604.1|63885_64449_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	98.9	2.4e-102
WP_000840931.1|64451_64697_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|64843_65221_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141916.1|65230_66448_+	hypothetical protein	NA	Q71T88	Escherichia_phage	99.8	5.4e-224
WP_000896801.1|66451_67180_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602709.1|67166_67952_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	2.1e-144
WP_000212026.1|67953_68970_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.4	1.0e-191
WP_171865307.1|68962_69595_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_149006549.1|70280_71508_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	4.5e-170
>prophage 5
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	75970	93534	130643		Escherichia_phage(52.63%)	19	NA	NA
WP_061355005.1|75970_76876_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	1.3e-158
WP_001177860.1|76868_77153_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_171882179.1|77615_78404_+	hypothetical protein	NA	A0A077SK48	Escherichia_phage	97.7	3.7e-117
WP_171882180.1|78443_78866_+	ppfA	NA	Q71TL5	Escherichia_phage	87.1	6.7e-57
WP_001113737.1|79770_80655_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
WP_104920433.1|80947_81757_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	99.3	9.9e-158
WP_001285362.1|81925_83122_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038869.1|83138_84140_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_009446764.1|84373_86080_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	100.0	0.0e+00
WP_171882181.1|86140_87730_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	98.5	4.5e-303
WP_171882182.1|87739_88555_+	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	98.9	5.8e-113
WP_171882183.1|88590_89172_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	6.1e-101
WP_000509938.1|89183_89693_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	3.0e-91
WP_001313475.1|89809_89965_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_171882184.1|90146_90392_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	43.8	1.7e-12
WP_171882185.1|90472_91288_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.9	1.4e-143
WP_171882186.1|91317_92118_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	4.6e-147
WP_171882187.1|92282_93317_-	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	98.5	1.1e-185
WP_171882188.1|93291_93534_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	2.6e-37
>prophage 6
NZ_CP053046	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence	130643	99296	127447	130643	head,tail,portal,holin	Escherichia_phage(75.0%)	25	NA	NA
WP_000188924.1|99296_99863_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000523978.1|99873_100485_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_171882190.1|100499_101381_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	99.0	5.4e-173
WP_171882191.1|101462_104855_+	transglycosylase SLT domain-containing protein	NA	Q71TP0	Escherichia_phage	93.6	0.0e+00
WP_000002800.1|104854_105211_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_171882192.1|105207_106641_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.6	6.9e-271
WP_001189838.1|106640_107477_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_001286326.1|107555_107990_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_171882193.1|108001_110425_+|tail	tail fiber protein	tail	Q71TD5	Escherichia_phage	67.4	0.0e+00
WP_171882194.1|110435_110960_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	59.2	5.8e-58
WP_171882195.1|111000_111426_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	72.5	3.0e-20
WP_032243068.1|111941_112484_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_130261310.1|113088_113352_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.5e-22
WP_000887652.1|113426_113756_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580772.1|113752_114196_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	98.0	7.0e-81
WP_000164724.1|114182_114785_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_171882196.1|114786_116706_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.1	0.0e+00
WP_000175486.1|116702_117068_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
WP_171882197.1|117080_120068_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.7	0.0e+00
WP_001165936.1|120057_120366_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_171882198.1|121718_122831_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	95.4	1.7e-195
WP_171882199.1|123219_123708_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	75.3	3.4e-60
WP_001345478.1|123876_124434_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000132937.1|124725_125745_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_171882200.1|125737_127447_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
>prophage 1
NZ_CP053047	Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence	57105	37709	46646	57105	transposase	Escherichia_phage(66.67%)	8	NA	NA
WP_001389365.1|37709_38474_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001323889.1|38810_40388_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_002210513.1|40715_41477_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|41497_42358_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|42494_43199_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000059893.1|43393_43798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282381.1|43860_44310_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_025755768.1|44321_46646_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	27.9	7.8e-38
