The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	829400	935564	3965977	tail,head,holin,portal,terminase,protease,lysis,integrase,plate,capsid,tRNA	Proteus_phage(29.63%)	107	856458:856481	897451:897474
WP_075673315.1|829400_829880_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_075673316.1|829914_830724_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_159242310.1|830833_832303_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_159242311.1|832676_835619_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.7	5.9e-115
WP_075673930.1|835751_836165_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_075673931.1|836118_836607_-	NfeD family protein	NA	NA	NA	NA	NA
WP_075673932.1|836609_837533_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_075673933.1|837570_838428_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_159242312.1|838512_839298_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075673935.1|839348_839978_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_075673936.1|839948_840635_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	8.5e-09
WP_156733951.1|840631_843073_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_159242313.1|843161_845324_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_075673939.1|845500_846526_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_099660093.1|846593_847853_-	MFS transporter	NA	NA	NA	NA	NA
WP_075673941.1|847976_849044_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_075673942.1|849040_849562_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_075673943.1|849696_850419_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_036934689.1|850431_850926_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_075673944.1|851301_852693_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	4.7e-38
WP_075673945.1|852782_853226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075673946.1|853460_854402_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_075673947.1|855054_855267_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673948.1|855270_856143_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
856458:856481	attL	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
WP_099660096.1|856486_856675_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159242337.1|856728_857166_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	77.5	1.5e-62
WP_159242314.1|857185_857407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159242315.1|857409_857988_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	44.4	5.3e-36
WP_159242316.1|857989_858445_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	39.2	2.3e-26
WP_159242317.1|858453_858951_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	59.4	6.1e-49
WP_159242318.1|859009_859837_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	3.8e-80
WP_006533955.1|859902_860277_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_099660100.1|860687_861182_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	30.5	8.3e-14
WP_159242319.1|861393_861597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159242320.1|861949_862612_-	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	55.6	8.8e-19
WP_109395844.1|862652_862865_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	66.7	1.0e-21
WP_036900998.1|862934_863393_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_159242321.1|863481_863691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109391850.1|863680_863860_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	1.1e-11
WP_159242322.1|863869_864991_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	56.0	6.8e-48
WP_159242323.1|864987_865626_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	63.1	1.0e-80
WP_159242324.1|865622_866015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023582529.1|866014_866185_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_036904909.1|866648_867452_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	9.7e-89
WP_159242325.1|867448_868474_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.6	2.4e-84
WP_159242326.1|868501_868885_+	antitermination protein	NA	A0A088CD47	Shigella_phage	69.8	1.4e-48
WP_036934641.1|869125_870292_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	8.6e-86
WP_115370633.1|870411_870660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109373189.1|870988_871378_+	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.9	2.7e-12
WP_115065560.1|871374_871674_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	32.9	1.7e-06
WP_115065559.1|871651_872071_+	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.5	4.4e-24
WP_115065558.1|872270_872849_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	66.1	4.0e-68
WP_159242338.1|872919_873294_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.6	1.2e-17
WP_036904935.1|873540_873744_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_159242327.1|874684_875032_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	95.7	6.3e-61
WP_017827278.1|875237_875696_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	55.4	2.1e-27
WP_159242328.1|875698_877429_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	60.8	8.5e-207
WP_109372933.1|877438_877618_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	59.3	8.9e-11
WP_159242329.1|877617_878847_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.4	2.2e-177
WP_170832166.1|878824_879469_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.9	3.6e-94
WP_159242330.1|879482_880691_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	68.5	6.9e-155
WP_023582511.1|880786_881095_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	41.2	3.7e-12
WP_023582510.1|881091_881415_+|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	94.4	5.0e-52
WP_159242331.1|881411_881852_+	HK97 gp10 family phage protein	NA	A0A1P8DTH7	Proteus_phage	99.3	1.1e-73
WP_159242332.1|881848_882184_+	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	96.4	7.7e-56
WP_159242333.1|882249_882717_+|tail	phage tail protein	tail	A0A1P8DTJ5	Proteus_phage	99.4	2.8e-80
WP_088495895.1|882719_883100_+|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	100.0	7.9e-65
WP_159242334.1|883123_883405_+	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	93.6	3.1e-42
WP_159242335.1|883424_886691_+|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	82.4	0.0e+00
WP_023582503.1|886693_887026_+|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	98.2	2.1e-61
WP_171729888.1|887019_887772_+|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	98.8	4.5e-144
WP_159242339.1|887777_888485_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	98.7	6.9e-139
WP_023582500.1|888575_889076_+	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	100.0	1.9e-87
WP_171880504.1|889132_889723_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	98.0	1.5e-102
WP_159287616.1|889742_893411_+	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	91.6	0.0e+00
WP_159242490.1|893424_894921_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	64.3	2.1e-153
WP_159242488.1|895758_896133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087803148.1|896198_897425_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.7	1.1e-35
WP_075674158.1|898122_898662_+	hypothetical protein	NA	NA	NA	NA	NA
897451:897474	attR	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
WP_075674159.1|898807_899116_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099659264.1|900188_900608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674162.1|901099_902515_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075674163.1|902783_903311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099659265.1|903830_904124_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171880505.1|904267_905005_-	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.1	1.9e-06
WP_075674115.1|905414_906035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159242466.1|906045_907428_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_075674113.1|907507_907942_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_099659268.1|907944_908508_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075674111.1|908482_909580_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_159242465.1|909543_911307_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_075674109.1|911339_912962_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_159242463.1|913007_916331_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_171880506.1|916330_917728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674106.1|917728_917983_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_159242460.1|918021_920160_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	30.1	1.4e-30
WP_099659274.1|920171_920909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674103.1|920962_923101_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	26.2	1.6e-45
WP_159287617.1|923179_923950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159287618.1|924108_924879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159287619.1|925040_925808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159242456.1|925807_928336_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.0	7.7e-15
WP_159242454.1|928332_931044_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	8.9e-94
WP_023583757.1|931329_931821_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_159242453.1|931843_933583_-	OmpA family protein	NA	NA	NA	NA	NA
WP_075674252.1|933561_934230_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075674251.1|934226_935564_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	1368301	1374695	3965977	holin,lysis	Enterobacteria_phage(25.0%)	9	NA	NA
WP_075674218.1|1368301_1369039_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	46.3	1.8e-57
WP_109849680.1|1369277_1370093_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.8	3.8e-56
WP_075674216.1|1370455_1370764_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	55.4	3.1e-27
WP_075674215.1|1370756_1371161_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	4.5e-26
WP_075674214.1|1371157_1371607_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	31.1	4.3e-09
WP_159241950.1|1371702_1372215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159241951.1|1372223_1373711_+	DUF3383 family protein	NA	Q6IWV2	Burkholderia_phage	30.8	7.4e-58
WP_075674211.1|1373721_1374174_+	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_075674210.1|1374236_1374695_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	7.4e-25
>prophage 3
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	1377873	1386636	3965977	plate	Pseudomonas_phage(14.29%)	10	NA	NA
WP_075674206.1|1377873_1378686_+	hypothetical protein	NA	W5S7J0	Pseudomonas_phage	29.0	1.5e-15
WP_075674205.1|1378688_1379381_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	35.6	8.2e-36
WP_075674204.1|1379377_1379722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674203.1|1379714_1380902_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.2	6.5e-73
WP_159241953.1|1380898_1381555_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	42.3	2.8e-41
WP_159241954.1|1381560_1383027_+	hypothetical protein	NA	A5X9J3	Aeromonas_virus	62.4	2.9e-22
WP_099660635.1|1383073_1383988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036912664.1|1384364_1384544_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_159241955.1|1385242_1385785_+	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	2.0e-21
WP_075674188.1|1385859_1386636_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	40.5	6.6e-42
>prophage 4
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	1568850	1621757	3965977	integrase,protease,transposase	Escherichia_phage(33.33%)	45	1588135:1588149	1605779:1605793
WP_159241988.1|1568850_1570323_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_075671888.1|1570477_1571554_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_075671886.1|1571639_1572110_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_036912784.1|1572127_1572685_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_023581903.1|1572900_1573800_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_075671884.1|1573816_1574863_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_075671882.1|1575150_1575741_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_075671880.1|1576263_1576977_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	37.0	4.1e-38
WP_075671878.1|1577133_1577745_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_075671876.1|1577837_1578536_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.7	6.0e-10
WP_075671874.1|1578760_1579645_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_006533030.1|1579706_1580159_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_159241989.1|1580161_1582210_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075671870.1|1582172_1582382_-	YpfN family protein	NA	NA	NA	NA	NA
WP_098942505.1|1582480_1582864_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_075671866.1|1582866_1583535_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_109418869.1|1583531_1584662_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075671864.1|1584667_1585039_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_075671863.1|1585245_1585806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075671862.1|1585885_1586509_-	response regulator	NA	NA	NA	NA	NA
WP_075671861.1|1587065_1589348_+	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
1588135:1588149	attL	CAGAACAAAACGAAG	NA	NA	NA	NA
WP_075671859.1|1589530_1590400_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_159241990.1|1590418_1591228_+	TonB family protein	NA	NA	NA	NA	NA
WP_159241991.1|1591256_1593425_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_159241992.1|1593588_1595832_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_098942515.1|1595939_1597322_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.2	7.1e-39
WP_075671849.1|1597491_1598958_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	2.3e-88
WP_098942517.1|1599059_1600637_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_159241993.1|1600943_1602152_+|integrase	tyrosine-type recombinase/integrase	integrase	G9L697	Escherichia_phage	53.9	1.0e-121
WP_159241994.1|1602433_1602664_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159241995.1|1602667_1603546_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159241996.1|1605052_1605427_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_159241997.1|1605865_1606444_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	61.6	4.0e-52
1605779:1605793	attR	CAGAACAAAACGAAG	NA	NA	NA	NA
WP_001067856.1|1606928_1607633_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001199192.1|1607746_1608523_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|1608751_1609777_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|1610198_1610951_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_044502095.1|1612919_1613297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159242446.1|1613293_1614457_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_077782102.1|1614474_1615335_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001120888.1|1615979_1617473_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|1617503_1618388_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|1618604_1619819_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|1619846_1620152_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|1620263_1621757_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	2193306	2252693	3965977	tail,holin,terminase,lysis,integrase,capsid,tRNA	Morganella_phage(20.0%)	87	2206899:2206958	2252864:2252965
WP_159242171.1|2193306_2195289_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.5	8.7e-22
WP_075673352.1|2195288_2196269_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	1.1e-38
WP_099659662.1|2196269_2197415_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	3.5e-39
WP_075673354.1|2197548_2198298_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L090	Tupanvirus	28.1	7.1e-09
WP_099659661.1|2198299_2199310_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_023582381.1|2199689_2199986_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_075673356.1|2199990_2202378_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582383.1|2202392_2203376_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_120655563.1|2203551_2203599_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006537111.1|2203707_2204064_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004263702.1|2204106_2204304_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_036937410.1|2204398_2204938_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_075673357.1|2204941_2206870_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
2206899:2206958	attL	ATACGCAAGATCACTTGTAAGCTTTTTATTTCATATATATTCAGTACGTTACGACAAGTT	NA	NA	NA	NA
WP_159242439.1|2207552_2207840_-	hypothetical protein	NA	Q8H9M8	Vibrio_phage	96.7	7.6e-44
WP_171880527.1|2207898_2208039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880597.1|2208112_2209315_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	D4HTV7	Vibrio_phage	92.4	2.0e-210
WP_171880528.1|2209682_2213306_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	63.8	0.0e+00
WP_171880529.1|2213305_2213872_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	78.2	3.1e-49
WP_171880530.1|2213808_2214528_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	9.0e-110
WP_171880531.1|2214531_2215230_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	5.3e-115
WP_171880532.1|2215226_2215556_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	73.4	3.3e-43
WP_103004656.1|2215702_2215960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127646.1|2215956_2216163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880533.1|2216178_2219547_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	46.8	4.5e-212
WP_171880534.1|2219613_2219916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880598.1|2219953_2220256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880535.1|2220355_2220700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880536.1|2220824_2221607_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	45.3	3.2e-44
WP_171880537.1|2221683_2222256_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	71.7	1.8e-41
WP_171880538.1|2222328_2222499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880539.1|2222596_2222920_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_171880540.1|2222992_2223685_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.2	1.9e-88
WP_171880541.1|2223734_2224490_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	76.9	2.1e-101
WP_171880542.1|2224554_2224923_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_171880543.1|2224919_2225288_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	69.7	2.4e-42
WP_171880544.1|2225289_2225631_-	hypothetical protein	NA	R9TRK0	Aeromonas_phage	43.4	5.9e-19
WP_171880545.1|2225630_2226029_-	hypothetical protein	NA	I6S619	Salmonella_phage	77.3	1.7e-54
WP_004247764.1|2226085_2226259_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_171880546.1|2226268_2227363_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	67.8	1.4e-143
WP_171880547.1|2227379_2227817_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	69.9	3.8e-47
WP_171880548.1|2227816_2229091_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.4	2.9e-151
WP_171880549.1|2229094_2230024_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.6	8.3e-92
WP_171880550.1|2229974_2231330_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.7	2.0e-163
WP_171880551.1|2231329_2232574_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	74.0	4.6e-186
WP_171880552.1|2232554_2232977_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	61.4	1.7e-31
WP_004247755.1|2232993_2233176_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	6.3e-20
WP_171880553.1|2233168_2233327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880554.1|2233357_2233888_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	56.4	2.6e-50
WP_171880599.1|2234258_2234627_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	91.0	1.1e-52
WP_094960058.1|2234707_2235112_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	2.0e-26
WP_170833859.1|2235104_2235413_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	61.8	6.0e-31
WP_161681235.1|2235583_2235829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880555.1|2236140_2236644_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	93.4	6.3e-86
WP_171880556.1|2236845_2237211_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	63.2	3.9e-37
WP_161769587.1|2237207_2237498_-	DUF1364 family protein	NA	A0A220NQY2	Salmonella_phage	78.9	1.3e-38
WP_159262704.1|2237490_2237643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880557.1|2237735_2238176_-	DUF1828 domain-containing protein	NA	A0A1P8DTF9	Proteus_phage	52.3	3.5e-32
WP_171880558.1|2238297_2238522_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	1.0e-24
WP_171880559.1|2238527_2238974_-	recombination protein NinB	NA	E5AGF7	Erwinia_phage	55.2	4.1e-36
WP_171880560.1|2239185_2239440_-	Lar family restriction alleviation protein	NA	A0A1P8DTF4	Proteus_phage	95.2	6.7e-44
WP_171880561.1|2239436_2239610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880562.1|2239796_2240078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880600.1|2240097_2241465_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.0	9.5e-161
WP_171880601.1|2241467_2242334_-	replication protein	NA	G9L680	Escherichia_phage	43.2	1.3e-57
WP_164484703.1|2242380_2242557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880563.1|2242653_2242995_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.0	7.9e-48
WP_049257589.1|2243158_2243368_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	94.2	1.8e-31
WP_161706179.1|2243450_2244134_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	95.6	1.2e-127
WP_154640079.1|2244186_2245032_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	45.8	1.4e-58
WP_171880564.1|2245056_2245488_+	biopolymer transporter ExbB	NA	M1FPN8	Enterobacteria_phage	57.2	3.4e-32
WP_171880565.1|2245911_2246229_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	50.5	8.7e-17
WP_171880566.1|2246249_2246621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880567.1|2246643_2246808_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	59.3	1.0e-13
WP_171880568.1|2247028_2247304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880569.1|2247300_2247453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880570.1|2247449_2247770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880571.1|2247771_2248386_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	77.9	5.9e-86
WP_171880572.1|2248385_2248868_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	81.7	2.6e-52
WP_171880573.1|2248900_2249062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123822252.1|2249102_2249438_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	1.1e-25
WP_171880574.1|2249524_2249713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880575.1|2249705_2250068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880576.1|2250067_2250295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171880577.1|2250281_2250884_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.6	4.2e-60
WP_171880578.1|2250891_2251098_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_109372516.1|2251302_2251536_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	100.0	8.3e-41
WP_171880579.1|2251511_2252693_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	98.0	6.8e-224
2252864:2252965	attR	ATACGCAAGATCACTTGTAAGCTTTTTATTTCATATATATTCAGTACGTTACGACAAGTTCTCACTTTACCTCGCGAGGTTTGCACACAGTTATGTACACAT	NA	NA	NA	NA
>prophage 6
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	2314165	2331818	3965977	tail,head,portal,terminase,protease,capsid	Yersinia_phage(15.38%)	19	NA	NA
WP_109418983.1|2314165_2317924_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.6	3.7e-199
WP_159242473.1|2317923_2318322_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.0	2.1e-31
WP_012367795.1|2318378_2318960_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	4.0e-52
WP_109418985.1|2318959_2319556_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	2.1e-51
WP_109418986.1|2319556_2322832_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	4.9e-54
WP_004242485.1|2322958_2323150_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_041701216.1|2323174_2323453_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_109418987.1|2323449_2323866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109418988.1|2323930_2324596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109372567.1|2324605_2324947_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159242472.1|2324952_2325426_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	3.3e-12
WP_012367787.1|2325415_2325745_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_109418990.1|2325744_2326044_-|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	7.4e-34
WP_012367785.1|2326082_2327249_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	9.6e-170
WP_020946083.1|2327252_2327921_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.9e-82
WP_109418991.1|2327938_2329207_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.0	1.9e-200
WP_109418992.1|2329206_2330940_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.8e-147
WP_017628364.1|2330893_2331361_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_004242468.1|2331479_2331818_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	5.4e-41
>prophage 7
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	2335755	2350524	3965977	integrase,lysis	Morganella_phage(53.33%)	21	2334070:2334084	2357838:2357852
2334070:2334084	attL	TTAAATCATCAATAC	NA	NA	NA	NA
WP_109418994.1|2335755_2336220_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	49.0	7.5e-25
WP_171880580.1|2336222_2336381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109418995.1|2336362_2336833_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	64.5	1.2e-51
WP_109418996.1|2336832_2337102_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.3	2.7e-19
WP_109418997.1|2337167_2337590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109372591.1|2338048_2338723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109418998.1|2338811_2339984_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	23.0	4.8e-12
WP_098943205.1|2340327_2340786_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004244726.1|2341117_2341330_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_049219743.1|2341669_2342068_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_171880581.1|2342095_2343121_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.2	1.6e-83
WP_109419000.1|2343117_2343924_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.5	3.0e-90
WP_049219770.1|2343945_2344461_-	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	2.0e-23
WP_017628377.1|2345018_2345198_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_072062657.1|2345459_2345936_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_109419001.1|2345973_2346180_-	cell division protein	NA	NA	NA	NA	NA
WP_109419002.1|2346280_2346913_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_100157866.1|2347191_2347716_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
WP_017628380.1|2347801_2348053_+	excisionase	NA	NA	NA	NA	NA
WP_109419003.1|2348027_2349161_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	5.0e-155
WP_006537208.1|2349270_2350524_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
2357838:2357852	attR	GTATTGATGATTTAA	NA	NA	NA	NA
>prophage 8
NZ_CP053044	Proteus cibarius strain HNCF43W chromosome, complete genome	3965977	2800856	2811697	3965977		Mycobacterium_phage(22.22%)	12	NA	NA
WP_159241856.1|2800856_2802068_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	3.1e-102
WP_036912266.1|2802268_2802532_+	YbeD family protein	NA	NA	NA	NA	NA
WP_075671560.1|2802692_2803337_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_075671558.1|2803438_2804404_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_023581134.1|2804417_2804792_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_023581133.1|2804929_2805139_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_075671556.1|2805336_2805810_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	35.8	5.0e-16
WP_075671554.1|2806093_2806318_+	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_075671552.1|2806329_2806749_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.6	8.0e-10
WP_099660164.1|2806754_2808881_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	1.2e-202
WP_075671548.1|2808905_2809874_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.8	7.5e-136
WP_075671546.1|2810497_2811697_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
