The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP023148	Klebsiella pneumoniae strain SMKP03	5155320	1681452	1691357	5155320		Enterobacteria_phage(25.0%)	9	NA	NA
WP_172879291.1|1681452_1682715_+	hypothetical protein	NA	B3VD19	Klebsiella_phage	26.0	2.5e-06
WP_014343305.1|1682981_1684388_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_014343304.1|1684610_1685675_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
WP_004175258.1|1685701_1686571_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_021313306.1|1686602_1687493_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175260.1|1687507_1688062_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1688241_1689408_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_022631332.1|1689830_1689953_-	small membrane protein	NA	NA	NA	NA	NA
WP_004175262.1|1690352_1691357_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 2
NZ_AP023148	Klebsiella pneumoniae strain SMKP03	5155320	2615139	2626026	5155320		Escherichia_phage(87.5%)	9	NA	NA
WP_004190234.1|2615139_2618247_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2618301_2619567_+	MFS transporter	NA	NA	NA	NA	NA
WP_032431771.1|2619597_2620686_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.2e-209
WP_004176262.1|2620772_2621033_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_023282555.1|2621330_2622191_+	class A extended-spectrum beta-lactamase SHV-27	NA	A0A077SL40	Escherichia_phage	99.3	2.9e-155
WP_002210513.1|2622211_2622973_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2623233_2624136_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2624147_2625413_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2625405_2626026_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_AP023148	Klebsiella pneumoniae strain SMKP03	5155320	3293050	3302524	5155320	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_117255209.1|3293050_3294772_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.8	7.6e-14
WP_002898014.1|3294816_3295518_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3295871_3296090_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3296220_3298500_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3298530_3298848_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3299173_3299395_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3299471_3301412_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_172879331.1|3301408_3302524_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_AP023149	Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03L, complete sequence	111317	0	110996	111317	terminase,portal,integrase,tail,transposase	Salmonella_phage(90.22%)	112	2452:2471	100258:100277
WP_014342074.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_032423093.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	4.7e-37
2452:2471	attL	GTATGTACTTACTTATTATT	NA	NA	NA	NA
WP_014342076.1|2459_2636_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_064185416.1|2806_5149_-	recombinase RecA	NA	J9Q736	Salmonella_phage	83.8	3.3e-28
WP_019704549.1|5151_5418_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_114071251.1|5417_6362_-	exonuclease	NA	J9Q7S6	Salmonella_phage	92.7	4.1e-171
WP_114071252.1|6422_7430_-	regulator	NA	J9Q7Z3	Salmonella_phage	87.6	3.9e-143
WP_064164595.1|7548_7980_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_021313787.1|8126_8426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313788.1|8436_8856_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_074425362.1|9056_9482_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	2.5e-59
WP_072196429.1|9496_10666_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.8	5.2e-208
WP_172879380.1|10687_11383_-	HNH endonuclease	NA	S5YLC4	Mycobacterium_phage	37.1	6.4e-20
WP_019704545.1|13929_15162_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_172879381.1|15258_17538_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	64.3	8.8e-244
WP_014342091.1|18140_18521_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_064279113.1|18515_19616_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.2e-17
WP_021313793.1|19965_20325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064317491.1|20388_20799_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_032440522.1|20808_21426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443559.1|21520_21766_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_021313797.1|21762_22149_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.2	1.4e-45
WP_032440524.1|22158_22935_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	1.7e-90
WP_064147380.1|24244_24544_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.3	4.6e-28
WP_021313107.1|24540_24693_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
WP_065801541.1|24937_25405_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	62.7	2.8e-48
WP_065801213.1|25484_26273_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	2.9e-69
WP_172879382.1|26393_27515_-	DNA primase	NA	J9Q720	Salmonella_phage	91.1	2.4e-202
WP_032440528.1|27661_29002_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_172879383.1|29066_29792_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	4.8e-127
WP_021313114.1|29985_30744_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
WP_014342115.1|30789_31146_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_021313115.1|31151_31817_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_021313116.1|31973_32762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052115713.1|32762_33104_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	41.8	2.6e-14
WP_040212606.1|33577_33829_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	1.3e-23
WP_172879384.1|33831_34524_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	88.3	1.0e-118
WP_004109805.1|34537_34861_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032422978.1|34956_36402_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
WP_172879385.1|36454_48625_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
WP_021313122.1|48641_49253_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
WP_004109817.1|49240_50038_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|50030_50729_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|50815_51151_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_172879386.1|51194_55754_-	tape measure protein	NA	J9Q712	Salmonella_phage	68.7	0.0e+00
WP_014342129.1|55761_55986_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|56111_56429_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|56490_57237_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_117027810.1|57304_57697_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_021313126.1|57698_58172_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_021313127.1|58162_58507_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	2.2e-53
WP_172879387.1|58604_59438_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.0	4.1e-130
WP_023279433.1|59437_59872_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_148678805.1|59919_60291_-	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.5e-28
WP_004109857.1|60426_61305_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|61331_62231_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_040212596.1|62253_63828_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.5	6.7e-275
WP_004109863.1|63860_65117_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|65119_65761_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|65936_66203_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|66212_67103_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_117027812.1|67099_67651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032423019.1|67640_68282_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.7	6.8e-109
WP_023279438.1|68278_68947_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_172879388.1|68946_69651_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.7	5.7e-109
WP_172879389.1|69710_71270_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	5.8e-279
WP_021313134.1|71272_71551_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
WP_125116973.1|71612_72152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142777354.1|72304_72523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117027815.1|72555_73590_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_117027816.1|73714_74341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117027824.1|74508_75027_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	72.3	5.4e-56
WP_032440491.1|75350_76001_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	1.9e-106
WP_172879390.1|76048_76270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108993090.1|76907_77390_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.4	7.2e-63
WP_080828587.1|77607_78108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129490138.1|78258_78519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313141.1|78533_78815_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
WP_032440494.1|78941_79349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074460517.1|79468_79768_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	69.7	6.5e-30
WP_004109924.1|79916_80276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704576.1|81818_83045_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
WP_019704575.1|83215_83533_-	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
WP_019704574.1|84147_84894_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_071786700.1|85038_85467_-	GFA family protein	NA	NA	NA	NA	NA
WP_019704573.1|85740_86100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704572.1|86281_86545_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
WP_052449548.1|86696_87398_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.2	1.5e-77
WP_004109939.1|87486_89172_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.0	0.0e+00
WP_032443587.1|89561_91631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172879391.1|91799_92294_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.6	4.6e-81
WP_019704565.1|92451_93039_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_032423059.1|93617_93845_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.6e-31
WP_023279507.1|94042_94636_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_172879392.1|94820_95654_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	54.2	3.3e-63
WP_032423056.1|95779_96328_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
WP_050485941.1|96324_96906_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
WP_023279504.1|97128_97548_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_040177340.1|97611_98256_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	6.2e-94
WP_032440507.1|98255_98732_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
WP_072196937.1|98728_99124_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	75.6	5.2e-51
WP_172879393.1|99143_100247_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.6	5.7e-180
WP_172879394.1|100440_101316_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
100258:100277	attR	AATAATAAGTAAGTACATAC	NA	NA	NA	NA
WP_119062670.1|101394_102537_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	2.2e-211
WP_119062669.1|102667_104971_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	91.1	0.0e+00
WP_021313773.1|105046_105616_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_072196935.1|105625_106336_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	6.6e-73
WP_172879395.1|106361_108278_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.5	2.1e-299
WP_072196416.1|108274_108508_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_021313776.1|108507_109593_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_021313777.1|109781_110276_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_064152227.1|110351_110996_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	4.9e-99
>prophage 1
NZ_AP023150	Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence	86902	2939	52380	86902	integrase,transposase	Escherichia_phage(40.0%)	54	23812:23871	51765:52586
WP_004197635.1|2939_3734_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|3931_4948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|4958_5273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899885.1|5299_5695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|5863_6169_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|6170_6389_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_013023783.1|7206_7497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023782.1|7493_8621_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015344964.1|8654_10247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023780.1|10453_11233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023779.1|11245_11746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023778.1|12020_12284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023777.1|12280_12847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|12877_13372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337418.1|13415_13784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|13817_14021_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_017899889.1|14069_14327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653916.1|14402_14657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013609504.1|14792_15569_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|15809_16133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023770.1|17371_18553_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_013023768.1|19744_20602_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|20594_20672_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_172879396.1|20903_21173_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014343478.1|21290_21770_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
WP_001323889.1|21973_23551_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
23812:23871	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|23874_24579_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|25334_26186_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|26493_27309_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|27369_28173_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|28172_29009_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|29069_29774_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|29924_30740_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|30929_31634_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|32420_33281_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_172879397.1|33513_34218_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000845048.1|34688_35702_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_064765190.1|35993_36548_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001749986.1|36644_37097_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|37229_37703_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|37883_38729_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|38845_39193_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|39186_40026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|40430_41972_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|43350_43803_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_065908739.1|43844_44489_-	quinolone resistance pentapeptide repeat protein QnrB91	NA	NA	NA	NA	NA
WP_000259031.1|44979_45819_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|45946_46447_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|46953_47718_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|48210_48795_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|48794_50033_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|50029_50935_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|51056_51761_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|52137_52380_+|transposase	transposase	transposase	NA	NA	NA	NA
51765:52586	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTCGAGCAGCAGCGCTACCGGGCCAGCGGCCTCAACCTGGTGACGGCGGCTATCGTGCTGTGGAACACGGTGTACCTGGAACGCGCCACCCAGGGGTTGGTCGAGGCCGGCAAGCCGGTGGACGGCGAGCTGCTGCAATTCCTGTCGCCGCTGGGCTGGGAGCACATCAACCTAACCGGCGATTACGTCTGGCGGCAGAGCCGCAGACTGGAAGACGGGAAGTTTCGGCCCTTACGGATGCCCGGAAAACCTTAGCGTACGATTTTTTCCGAATTCTGCGGGCTCCCCTATCTCATCTGCGCAAGGCAGAACGTGAAGACGGCCGCCCTGGACCTCGCCCGCGAGCGCCAGGCGCACGAGGCCGGCGCGCGGACCCGCGCCACGGCCCACGAGCGGACGCCGCAGCAGGAGCGCCAGAAGGCCGCCAGAGAGGCCGAGCGCGGCCGTGAGGCTTGGACGCTAGGGCAGGGCATGAAAAAGCCCGTAGCGGGCTGCTACGGGCGTCTGACGCGGTGGAAAGGGGGAGGGGATGTTGTCTACATGGCTCTGCTGTAGTGAGTGGGTTGCGCTCCGGCAGCGGTCCTGATCAATCGTCACCCTTTCTCGGTCCTTCAACGTTCCTGACAACGAGCCTCCTTTTCGCCAATCCATCGACAATCACCGCGAGTCCCTGCTCGAACGCTGCGTCCGGACCGGCTTCGTCGAAGGCGTCTATCGCGGCCCGCAACAGCGGCGAGAGCGGAGCCTGTTCAACGGTGCCG	NA	NA	NA	NA
>prophage 2
NZ_AP023150	Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence	86902	69884	76964	86902	transposase	Escherichia_phage(28.57%)	13	NA	NA
WP_001493762.1|69884_70457_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|70593_71184_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_077256884.1|71234_71810_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_000780222.1|71956_72238_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|72218_72548_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_048337415.1|72783_73041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|73074_73779_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001568051.1|74197_74428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|74519_74747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|75426_75747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|75781_76036_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|76223_76415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|76457_76964_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
>prophage 1
NZ_AP023151	Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03S, complete sequence	54548	12403	54475	54548	tail,head,terminase,capsid,portal	Klebsiella_phage(86.0%)	55	NA	NA
WP_117034393.1|12403_13534_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	44.9	2.0e-23
WP_172879399.1|13537_13846_+	hypothetical protein	NA	A0A248SL87	Klebsiella_phage	53.5	4.8e-28
WP_060577940.1|13848_14496_+	hypothetical protein	NA	A0A248SKJ6	Klebsiella_phage	58.8	1.9e-74
WP_117022625.1|14599_14833_+	cor protein	NA	Q38624	Escherichia_phage	59.2	5.1e-22
WP_117022626.1|14910_16059_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.9	2.5e-37
WP_087749700.1|16131_17109_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	90.0	3.4e-160
WP_023339381.1|17111_18275_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_060577966.1|18907_20830_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
WP_065519960.1|20884_21664_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	80.5	9.1e-116
WP_040108080.1|21660_21891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413547.1|21887_22052_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_100097910.1|22580_23714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117022623.1|23740_24265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048290287.1|24364_24697_-	hypothetical protein	NA	O64344	Escherichia_phage	86.2	2.5e-46
WP_094642885.1|24699_25026_-	hypothetical protein	NA	O64345	Escherichia_phage	70.1	8.9e-41
WP_048290289.1|25012_25219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100097911.1|25211_29216_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.4	0.0e+00
WP_172879400.1|29466_30075_-	helix-turn-helix domain-containing protein	NA	Q6UAU6	Klebsiella_phage	90.6	3.8e-101
WP_032408972.1|30155_30365_+	Cro/Cl family transcriptional regulator	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_110924981.1|30354_31092_+	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.8e-119
WP_172879401.1|31503_32112_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	87.5	1.9e-97
WP_096913198.1|32239_32572_+	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	80.9	3.3e-43
WP_064148019.1|32572_32866_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	84.5	4.7e-41
WP_071067636.1|32862_33204_+	hypothetical protein	NA	Q6UAT8	Klebsiella_phage	81.2	7.2e-25
WP_048292306.1|33196_33523_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
WP_023339395.1|33543_33771_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|34122_34410_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|34409_34718_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_064388657.1|34888_35110_+	hypothetical protein	NA	O64358	Escherichia_phage	89.0	5.1e-32
WP_100097915.1|35121_35349_+	winged helix-turn-helix domain-containing protein	NA	Q6UAT1	Klebsiella_phage	85.3	4.9e-30
WP_100097916.1|35619_36681_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.0	1.1e-169
WP_100097917.1|36739_37051_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	90.1	4.3e-45
WP_057172008.1|37047_37539_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	89.6	1.2e-81
WP_100097918.1|37555_38026_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.5	1.9e-60
WP_172879398.1|38115_38271_+	hypothetical protein	NA	Q6UAS5	Klebsiella_phage	93.9	2.0e-11
WP_100097919.1|38279_38579_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	93.9	1.1e-50
WP_100097920.1|38958_39321_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	1.3e-61
WP_071557828.1|39317_39641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172879402.1|39637_40069_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.0	1.8e-36
WP_032408957.1|40485_40920_+|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_032413534.1|40954_42664_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.3	0.0e+00
WP_032413533.1|42836_44096_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	8.9e-222
WP_032413532.1|44132_45053_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.6	4.3e-149
WP_032413531.1|45130_46417_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	83.9	1.3e-204
WP_032413530.1|46476_46764_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_020317538.1|46744_47062_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|47058_47397_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|47377_47767_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_169534379.1|47772_48165_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.8	1.1e-61
WP_039814684.1|48196_48658_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	1.0e-66
WP_014228914.1|48715_49081_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_057222645.1|49313_52673_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
WP_017880254.1|52672_53011_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_048290175.1|53007_53763_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	1.6e-125
WP_117022629.1|53764_54475_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	3.9e-134
