The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	1229885	1243322	5495195	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229885_1230497_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230493_1231159_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231155_1231779_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232031_1232775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232860_1233028_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233435_1235289_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235438_1235654_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235658_1236003_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236359_1236740_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236736_1237084_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237701_1237971_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238131_1238554_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238683_1239742_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239820_1240471_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240653_1241244_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241745_1241994_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242839_1243322_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	1520903	1526329	5495195	integrase	Enterobacteria_phage(50.0%)	6	1509891:1509907	1528525:1528541
1509891:1509907	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1520903_1521473_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521472_1521940_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1521926_1522607_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522616_1523753_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1523927_1525085_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525396_1526329_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528525:1528541	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	1770610	1894063	5495195	head,holin,portal,terminase,tRNA,protease,transposase,tail,plate	Enterobacteria_phage(34.26%)	151	NA	NA
WP_000569336.1|1770610_1771537_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771541_1772273_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1772253_1772361_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772420_1773122_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1773142_1774429_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774462_1774717_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774735_1774870_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1774873_1775116_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1775203_1775566_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775562_1775919_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1776252_1776429_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776430_1777378_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777374_1777596_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777694_1777976_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1777986_1778178_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1778150_1778333_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1778332_1779010_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1779006_1779792_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779797_1780094_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1780169_1780460_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_171877920.1|1780963_1782571_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	5.3e-94
WP_000712399.1|1782677_1783370_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1783733_1784273_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1784269_1785289_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1785285_1785987_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1785983_1786268_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1786495_1786693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1786736_1787018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1787108_1787210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1787206_1787662_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1787661_1787832_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1787824_1788115_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1788111_1788474_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1788470_1788611_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1788696_1789131_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1789379_1789532_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1790335_1792282_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1792419_1792599_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1792639_1792885_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1792962_1793178_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1793182_1793716_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1793986_1794556_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1794555_1794702_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1794929_1795115_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1795632_1796109_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1796105_1798229_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1798225_1798438_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1798437_1799940_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1799884_1801909_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1801996_1802323_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802315_1802597_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802599_1803223_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803235_1803634_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1803641_1804394_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1804407_1804830_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1804856_1805165_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_115333668.1|1805208_1807854_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1807850_1808180_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808179_1808878_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1808888_1809632_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1809577_1810207_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171877921.1|1810447_1813927_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230508.1|1813993_1814593_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_088136427.1|1814657_1815827_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1815828_1816098_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1816258_1816675_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1816756_1817398_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1817559_1817808_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1818322_1820008_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1820004_1820724_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1820770_1821241_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1821282_1821744_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1821868_1823872_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1823868_1825005_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1824997_1825729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1825747_1827277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1827287_1828376_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1829616_1829934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1829995_1833625_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1840581_1842615_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1842746_1843856_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1844117_1844399_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1844690_1845233_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1845320_1845995_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_171877922.1|1846010_1848491_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1848501_1849536_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1849617_1849956_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1850173_1851025_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1851145_1851418_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1851527_1851842_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1851851_1852199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1853249_1853489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1853822_1854611_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1854607_1855408_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000528251.1|1855686_1856424_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|1856377_1856578_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|1856692_1857157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|1857195_1857441_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|1857476_1857659_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|1857805_1859845_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|1859944_1860505_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|1860726_1860930_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|1861009_1861531_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|1861565_1862477_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|1862476_1863037_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|1863027_1864110_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|1864109_1864547_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|1864539_1865154_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|1865143_1866268_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|1866251_1867601_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|1867587_1869663_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|1869789_1870266_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|1870280_1870646_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|1870654_1872157_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|1872153_1872399_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|1872399_1872960_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|1872956_1873376_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|1873372_1873759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|1873802_1874750_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|1874749_1875874_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|1876050_1876524_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|1876642_1877968_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|1877951_1879541_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|1879540_1881205_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|1881204_1881786_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|1881788_1882079_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|1882075_1882384_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|1882364_1882592_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|1882601_1882820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|1882803_1883232_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|1883266_1883767_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|1883838_1884264_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|1884333_1884843_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|1884839_1885136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1885125_1885323_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|1885315_1885648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|1885686_1885872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|1885868_1886420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|1886423_1886939_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564280.1|1886938_1887472_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
WP_000323222.1|1887475_1888018_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|1888115_1888646_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|1888657_1888951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|1888955_1889228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1889224_1889506_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|1889507_1889762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|1889774_1889996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|1889998_1890931_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|1891001_1893092_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|1893093_1893342_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|1893532_1894063_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
>prophage 4
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	1996330	2075083	5495195	lysis,head,holin,terminase,protease,transposase,integrase,tail,capsid	Stx2-converting_phage(58.54%)	96	1987281:1987295	2002704:2002718
1987281:1987295	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1996330_1997509_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1997489_1997681_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1997758_1998103_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1998290_1998641_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1999507_2000455_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2000451_2000673_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2000771_2001053_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2001063_2001255_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2001227_2001410_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2001406_2002087_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2002083_2002869_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2002704:2002718	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2002874_2003171_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2003245_2003389_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2003357_2003522_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2003594_2003963_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_162829202.1|2004337_2005551_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000088203.1|2005768_2006041_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2006018_2006201_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2006769_2007291_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2007792_2008488_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2008562_2008778_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2008919_2009216_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2009248_2009410_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2009396_2010218_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2010214_2011591_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|2011669_2012281_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_162829202.1|2012756_2013970_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000344569.1|2014057_2014390_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|2014522_2014738_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2014748_2014985_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2014941_2015388_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2015384_2015912_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2015908_2016091_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2016365_2017130_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2017204_2017927_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2017926_2018532_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2018528_2019200_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2019190_2019679_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2020328_2021288_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2021299_2021569_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2021865_2022189_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143115.1|2022432_2024370_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|2024506_2024686_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2024726_2024999_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2025075_2025291_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2025290_2025788_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2025784_2026222_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2026424_2026922_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2026918_2027176_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2027638_2027866_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2027907_2028273_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2028564_2029128_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|2029796_2031010_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|2032162_2034100_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2034144_2034366_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2036892_2037219_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2037228_2037579_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2037575_2038022_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2038018_2038363_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2038421_2039138_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2039143_2039518_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2039613_2039823_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2039874_2043117_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2043109_2043451_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2043450_2044149_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2044165_2044486_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2044593_2044767_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2044837_2045761_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2045814_2046552_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2046497_2047130_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2047389_2050869_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2050935_2051535_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2051599_2052913_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2052914_2053184_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2053324_2054200_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2054424_2055075_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2056398_2057565_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2057683_2058157_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2058355_2059414_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2059585_2059915_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2060015_2060198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2060686_2060800_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2060812_2061007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2061465_2061834_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2061907_2062129_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2062191_2062668_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2062682_2063162_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2063243_2064065_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2064285_2064696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2064711_2065395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2065530_2066601_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2066597_2067503_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2067499_2068381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2068364_2069578_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2069949_2072097_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2073544_2075083_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	2099468	2140618	5495195	head,holin,terminase,portal,transposase,integrase,tail,capsid	Escherichia_phage(35.0%)	50	2079739:2079753	2103593:2103607
2079739:2079753	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2099468_2100491_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2100490_2100694_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2100752_2103224_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2103319_2103508_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2103504_2103693_-	cell division inhibitor	NA	NA	NA	NA	NA
2103593:2103607	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2104173_2104326_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2104600_2105245_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2105342_2105570_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2105566_2105992_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2106060_2107098_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2107009_2107552_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2107586_2108285_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2108306_2108531_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2108527_2108884_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2108916_2109069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2109065_2109377_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2109503_2110067_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2110176_2110281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2110467_2110680_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2110847_2111126_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2111127_2112177_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2112189_2112549_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2112545_2113235_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2114774_2116625_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2116706_2117920_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2118230_2118446_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2118450_2118795_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2118845_2119379_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2119534_2119717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2119729_2119861_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2120088_2120274_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2120800_2121115_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2121196_2121421_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2121815_2122325_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2124209_2124416_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2124412_2126005_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2125994_2127500_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2127536_2127884_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2127941_2128208_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2128189_2128930_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2128943_2129375_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2129401_2129815_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2129795_2132375_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2132371_2132701_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2132700_2133399_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_001303043.1|2133409_2134153_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2134098_2134731_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001230509.1|2138513_2139113_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|2139177_2140347_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|2140348_2140618_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 6
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	2198202	2218188	5495195	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	2211324:2211337	2221330:2221343
WP_032161583.1|2198202_2199339_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2199289_2199613_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2199770_2200955_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2200954_2201467_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2201521_2201887_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2201895_2202051_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2204853_2205342_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2205498_2206071_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2206114_2206645_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2207736_2208051_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2208055_2209015_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_171877923.1|2209091_2211914_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
2211324:2211337	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2211920_2212286_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2212282_2212900_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2212911_2213211_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2213207_2213474_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2213470_2213674_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2213697_2214114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2214206_2214320_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2214316_2214559_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2214570_2214849_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2214859_2215210_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2215231_2215435_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2215506_2215644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2215733_2216138_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2216153_2216804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2216833_2217181_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2217186_2218188_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2221330:2221343	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	2537420	2619864	5495195	head,holin,terminase,protease,tail,capsid	Stx2-converting_phage(41.18%)	86	NA	NA
WP_001260835.1|2537420_2538242_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2538341_2538425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2538517_2538853_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2539249_2540503_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2540609_2541503_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2541637_2542858_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2542982_2543678_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2543630_2544923_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2545080_2545695_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2545737_2546592_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2546593_2547211_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2547221_2549645_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2549705_2552132_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2552330_2552636_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2552743_2553454_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2553456_2554017_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2554051_2554393_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2554527_2554854_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2555842_2556094_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2556166_2558638_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2558730_2558922_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2558918_2559107_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2559507_2559672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2559675_2559894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2559965_2560265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2560617_2560896_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2560897_2561089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2561109_2561481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2561578_2561881_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2561877_2562303_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2562325_2563288_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2563294_2564035_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2564845_2565241_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2565297_2565882_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2565997_2566102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2566290_2566503_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2566670_2566949_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2566950_2568000_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2568012_2568372_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2568368_2569058_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2569693_2570122_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2570600_2572451_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2572890_2573106_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2573110_2573455_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2573505_2574039_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2574309_2574879_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2574878_2575025_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2575252_2575438_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2575862_2576090_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2576131_2576497_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2576786_2577350_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2577346_2579008_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171877928.1|2579071_2581009_+|capsid	phage major capsid protein	capsid	A0A0P0ZE14	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2581053_2581275_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2583801_2584128_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2584137_2584488_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2584484_2584931_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2584927_2585272_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2585330_2586047_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2586052_2586427_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2586522_2586732_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2586783_2590026_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2590018_2590360_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2590359_2591058_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001303043.1|2591068_2591812_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2591757_2592390_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2592636_2596116_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230444.1|2596182_2596782_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_024748463.1|2596846_2598160_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2598161_2598431_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_001079499.1|2604513_2605020_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2605065_2605566_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2605651_2605831_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2606211_2607018_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2607017_2608211_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2608222_2609584_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2609584_2611180_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2611179_2612742_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2612833_2612878_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2613015_2613897_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2613893_2614514_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2614541_2616125_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2616337_2617210_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2617249_2617840_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2617836_2618595_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2618814_2619864_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	2890138	3048144	5495195	head,holin,terminase,portal,transposase,integrase,tail,capsid	Stx2-converting_phage(29.38%)	190	3001597:3001611	3049356:3049370
WP_000214712.1|2890138_2890342_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2890377_2891838_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2891926_2893210_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2893341_2893584_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2893745_2894387_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2894468_2895098_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2895170_2895746_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2895859_2896129_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2896130_2897444_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230508.1|2897508_2898108_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000514788.1|2898175_2901655_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|2901901_2902534_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2902479_2903223_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2903233_2903932_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2903931_2904261_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2904257_2906870_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2906850_2907264_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2907290_2907713_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2907726_2908479_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2908486_2908882_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2908878_2909412_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2909426_2909780_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2909791_2910190_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2910231_2911257_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2911312_2911645_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2911654_2912974_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2912954_2914556_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2914552_2914759_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2914755_2916681_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2916655_2917201_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2917587_2917812_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2917893_2918208_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2918733_2918919_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2919141_2919288_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2919287_2919857_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2920127_2920661_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2920711_2921056_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2921060_2921276_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_128484575.1|2921715_2923566_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001302123.1|2924043_2924475_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2924925_2925639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2925774_2925972_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2926196_2926751_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2926813_2927119_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2927131_2928181_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2928182_2928455_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2928576_2928921_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2929040_2929253_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2929486_2930044_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2930045_2930264_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2930391_2930703_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2930695_2930923_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2930919_2931201_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2931233_2931950_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2931983_2932445_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2932437_2933481_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2933549_2933975_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2933958_2934201_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2934592_2934931_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2935223_2935376_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2935387_2936026_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2936026_2936236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2936800_2936989_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2936985_2937174_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2937266_2938511_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2939221_2939464_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2940426_2940807_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2940803_2941151_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2941200_2942739_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2943321_2943972_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023426.1|2945375_2945645_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_000268860.1|2945646_2946870_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2946934_2947534_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2947601_2947817_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|2947819_2951080_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_162829348.1|2951245_2952458_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_001152128.1|2952580_2953018_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2953017_2953359_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2953351_2956594_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2956646_2956856_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2956951_2957326_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2957331_2958048_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2958106_2958451_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2958447_2958894_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2958890_2959241_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2959250_2959577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2959656_2962158_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2962103_2962325_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2962369_2964307_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2964370_2966032_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2966028_2966592_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|2966880_2967246_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2967287_2967512_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2967593_2967908_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2968435_2968621_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|2968837_2969335_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_024164617.1|2969334_2969550_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_024748518.1|2969988_2971839_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|2972330_2973389_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|2973539_2973737_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|2973963_2974785_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|2974781_2975156_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|2976219_2976498_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|2976563_2976731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2977027_2977240_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2977428_2977533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2977648_2978011_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2978007_2978379_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2978414_2978627_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2978675_2979032_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2979088_2979484_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|2979499_2980270_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|2980299_2981040_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2981046_2982000_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2982022_2982448_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2982431_2982707_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2982809_2983199_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|2983368_2983521_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|2984008_2984197_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2984193_2984382_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|2984474_2986919_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|2986983_2987232_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|2987209_2988340_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_001345079.1|2989639_2990290_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2991796_2992387_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2992570_2993218_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2993354_2993501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2993928_2994207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2994546_2994927_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2994923_2995271_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2995320_2996859_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2999523_3000849_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
3001597:3001611	attL	CCCACTACTGCCGCT	NA	NA	NA	NA
WP_001023474.1|3001875_3002145_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|3002146_3003460_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001228304.1|3003611_3004211_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_162829348.1|3006460_3007673_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_128484559.1|3007676_3007937_-	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	98.6	8.1e-37
WP_001304109.1|3007888_3009064_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3009406_3010039_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|3009984_3010728_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|3010738_3011437_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|3011436_3011778_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3011770_3015013_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3015065_3015275_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3015370_3015745_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3015750_3016467_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3016525_3016870_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3016866_3017313_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3017309_3017660_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3017669_3017996_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3018075_3020577_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3020522_3020744_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3020788_3022726_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3022789_3024451_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3024447_3025011_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3025300_3025666_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3025707_3025935_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3026359_3026545_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3026772_3026919_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3026918_3027488_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3027758_3028292_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3028342_3028687_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3028691_3028907_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3029056_3030910_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3031706_3032765_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3032915_3033113_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3033354_3033885_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3033893_3034253_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3034265_3035312_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3035313_3035592_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3035661_3035919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069192683.1|3036139_3036352_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	2.4e-15
WP_001449026.1|3036630_3037389_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3038087_3038252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3038248_3038830_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3039016_3039559_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3039470_3040511_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3040482_3041034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3041017_3041245_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3041321_3041729_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3041992_3042292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3042364_3042583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3042605_3043013_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3042990_3043224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3043217_3043385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3043782_3043971_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3043967_3044159_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3044251_3046723_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3046787_3047036_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3047013_3048144_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3049356:3049370	attR	AGCGGCAGTAGTGGG	NA	NA	NA	NA
>prophage 9
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	3094840	3187182	5495195	lysis,head,holin,portal,terminase,tRNA,protease,transposase,integrase,tail,capsid	Enterobacteria_phage(50.0%)	99	3116688:3116703	3181085:3181100
WP_001299679.1|3094840_3096097_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3096310_3096934_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3096933_3097785_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3097935_3098883_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3099007_3100687_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3100741_3101020_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3101297_3101882_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3101998_3103090_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3103933_3106819_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3106918_3108838_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3109544_3110156_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3110255_3111170_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3111265_3113002_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3113393_3114464_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3114473_3115772_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3116101_3117634_+	SpoVR family protein	NA	NA	NA	NA	NA
3116688:3116703	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3117685_3118405_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3118626_3120168_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3120313_3120844_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3120889_3122158_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3122157_3122577_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3122949_3123861_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3124067_3124529_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3124605_3125265_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3125336_3125630_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3125641_3125800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3125870_3126272_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3126374_3126743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3127262_3127958_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3127981_3128794_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3128797_3129064_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3130295_3130880_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3131378_3132332_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3132518_3134003_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3134305_3135844_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3135893_3136241_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3136237_3136618_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_171877932.1|3136693_3136942_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3136998_3137667_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3138164_3138347_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3138425_3138926_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3138962_3139469_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3139487_3140378_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3140497_3141079_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3141078_3143994_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3144058_3144658_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3144724_3148123_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3148183_3148816_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3148752_3149496_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3149501_3150200_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3150199_3150529_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3150525_3153075_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3153067_3153502_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3153483_3153906_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3153921_3154662_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3154669_3155065_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3155061_3155640_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3155651_3156005_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3156016_3156415_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3156456_3157482_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3157536_3157869_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3157878_3159198_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3159178_3160780_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3160776_3160983_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3160979_3162905_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3162879_3163425_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3163813_3164008_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3164172_3164379_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3164664_3165075_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3165366_3165660_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3165750_3165933_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3166149_3166626_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3166612_3166918_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3167239_3167929_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3167925_3168066_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3168062_3168425_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3168421_3168712_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3168704_3168875_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3168874_3169330_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3169831_3171358_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3171415_3171538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3171602_3171935_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3172002_3172305_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3172301_3173003_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3173927_3174164_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3174153_3175296_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3175409_3176660_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3176831_3177485_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3177494_3177956_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3178009_3179116_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3179151_3179793_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3179796_3181167_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3181085:3181100	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3181335_3182007_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3182006_3183467_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3184067_3184349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3184604_3185147_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3185352_3185766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3185778_3186114_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3186126_3187182_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	3193274	3251928	5495195	head,holin,portal,terminase,transposase,integrase,tail,capsid	Enterobacteria_phage(26.32%)	72	3237495:3237515	3258585:3258605
WP_032174463.1|3193274_3194492_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3194490_3195703_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3196065_3197187_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3197235_3198462_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3198711_3199848_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3199831_3200695_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3201058_3202420_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3202480_3202756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3205064_3208466_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3209056_3211405_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3211424_3211514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3211526_3211763_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3211708_3212446_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3212499_3213378_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3213680_3213791_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3213900_3214155_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3214171_3214870_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3214869_3215211_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3215203_3218446_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3218493_3218703_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3218798_3219173_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3219187_3219904_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3219962_3220307_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_171877933.1|3220303_3220750_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
WP_001007901.1|3220746_3221097_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3221106_3221433_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3221512_3224014_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3223959_3224181_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3224225_3226163_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3226226_3227888_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171877934.1|3227884_3228448_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279796.1|3228739_3229105_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3229146_3229332_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3229461_3229602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3229958_3230183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3230247_3230454_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3230681_3230828_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3230827_3231397_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3231667_3232201_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3232251_3232596_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3232600_3232816_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3232891_3233161_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3233198_3233381_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3233528_3235466_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3235780_3235948_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3236544_3237366_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3237362_3237737_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3237495:3237515	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3237749_3238799_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3238800_3239079_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3239246_3239459_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3239647_3239752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3239867_3240455_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3240457_3240649_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3240650_3241088_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3241074_3241392_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3241345_3241663_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3241652_3241955_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3241951_3242233_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3242265_3242982_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3243015_3243558_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3243469_3244507_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3244575_3245001_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3244984_3245308_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3245432_3245909_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3246224_3246377_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3246491_3247007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3247139_3247529_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3247590_3247860_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3247828_3248947_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3249113_3249908_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3249904_3250951_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3251106_3251928_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3258585:3258605	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	3502958	3558303	5495195	head,holin,portal,protease,transposase,integrase,tail,capsid	Escherichia_phage(27.91%)	62	3504893:3504908	3560068:3560083
WP_000003653.1|3502958_3503546_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3503542_3504250_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3504268_3506062_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3504893:3504908	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3506058_3507177_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3509169_3509439_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3509440_3510754_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3510818_3511418_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3511485_3514959_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3515092_3515620_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3515810_3516443_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3516388_3517132_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3517142_3517841_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3517840_3518170_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3518166_3520746_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3520726_3521140_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3521166_3521598_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3521611_3522352_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3522333_3522600_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3522657_3523005_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3523041_3524547_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3524536_3526129_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3526125_3526332_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3528508_3530047_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3530096_3530444_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3530440_3530821_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3530896_3531172_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3531922_3532129_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3532384_3532657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3532816_3533350_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3533570_3533684_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3533905_3534091_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3534618_3534933_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_171877939.1|3535137_3536351_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_000874392.1|3536526_3538377_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3539143_3539857_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3540477_3541296_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3541447_3541819_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3541808_3542180_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3542192_3543242_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3543243_3543522_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3543689_3543845_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3543946_3544084_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3544449_3545223_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3545574_3545988_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3546003_3546774_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3546795_3547542_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3547548_3548640_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3548718_3549174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3549380_3549806_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3549789_3550062_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3550170_3550572_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3550599_3550791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3550790_3551078_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3551355_3551511_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3551652_3552042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3552228_3552414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3552987_3553176_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3553172_3553364_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3553457_3555929_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3555996_3556239_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3556216_3557236_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3557643_3558303_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3560068:3560083	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	3789231	3827326	5495195	lysis,holin,terminase,portal,protease,integrase,tail	Enterobacteria_phage(51.22%)	48	3788816:3788830	3827400:3827414
3788816:3788830	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3789231_3789930_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3790160_3791042_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3791210_3791372_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3791868_3792888_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3792921_3793902_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3794078_3794348_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3794349_3795666_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3795725_3796325_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3799869_3800478_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3800414_3801158_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3801163_3801862_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3801871_3802201_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3802200_3805266_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3805237_3805567_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3805575_3805962_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3806022_3806766_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3806776_3807178_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3807174_3807753_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3807764_3808040_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3808032_3808356_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3808442_3810470_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3810414_3810750_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3810871_3811996_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3811923_3812136_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3812132_3814235_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3815399_3815552_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3815539_3816007_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3816003_3816501_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3816500_3816716_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3816858_3817257_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3817337_3817496_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3817581_3818325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3818508_3819198_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3819212_3819335_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3819672_3820632_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3820843_3821509_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3821505_3822126_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3822118_3822289_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3822285_3822468_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3823165_3823846_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3823842_3824025_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3823997_3824189_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3824199_3824481_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3824579_3824801_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3825011_3825614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3825856_3826024_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3826063_3826282_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3826555_3827326_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3827400:3827414	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	4370490	4450719	5495195	lysis,head,holin,portal,terminase,protease,transposase,capsid,integrase,tail,plate	Shigella_phage(45.0%)	96	4407608:4407654	4446817:4446863
WP_000998048.1|4370490_4372029_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4372078_4372426_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4372422_4372803_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4373066_4373330_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4373329_4373470_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4373539_4373731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484533.1|4374555_4375098_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4375172_4375760_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4375817_4376486_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4376511_4379037_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4379026_4380670_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4380638_4381349_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4381661_4381991_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4382238_4382853_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4383270_4383960_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4383956_4384913_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4384909_4387108_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4387117_4388074_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4388252_4389380_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4389521_4390580_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4390825_4391728_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4392430_4392709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4392875_4393598_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4393696_4394596_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4395271_4396228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4396360_4398694_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4398707_4399031_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4399030_4399252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4399248_4399806_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4399802_4400063_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4400996_4401749_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4401745_4402297_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4402302_4402575_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4402984_4403551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4403550_4404141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4404171_4404804_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4404796_4405255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4405254_4405872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4405844_4406261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4406264_4407446_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4407608:4407654	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4408408_4409152_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4409976_4410750_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4410810_4411365_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4411395_4411806_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4411826_4412270_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4412241_4412844_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4412843_4413614_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4413617_4414202_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4414192_4415251_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4415237_4415663_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_171877948.1|4415662_4416211_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	2.4e-94
WP_000999513.1|4416210_4417290_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4417286_4418615_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4418675_4420511_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4420652_4420922_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4420921_4421278_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4421277_4422774_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4422757_4422928_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4422936_4423497_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4423493_4424000_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4423974_4424385_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4424381_4424705_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4424783_4426013_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4426023_4426626_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4426618_4427845_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4427834_4427996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4427992_4429489_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4429722_4430217_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4430619_4431832_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4432204_4432498_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4432588_4432771_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4432987_4433464_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4433467_4433803_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4433939_4434233_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4434511_4434745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4434888_4435428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4435642_4436395_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4436408_4437398_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4437405_4438215_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4438234_4438624_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4438620_4438947_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4438943_4439597_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4439596_4440091_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4440087_4441029_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4441018_4441198_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4441373_4441925_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4441917_4442178_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4442275_4442968_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4443245_4443542_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4444218_4444755_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4444745_4445108_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4445107_4445413_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_128484509.1|4445639_4446803_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	1.0e-227
WP_000893282.1|4447007_4448261_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4446817:4446863	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4448272_4449376_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4449663_4450719_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	4882732	4895308	5495195	integrase	Enterobacteria_phage(81.82%)	15	4881766:4881781	4900261:4900276
4881766:4881781	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4882732_4883560_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4883777_4883972_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_171877953.1|4884327_4886661_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|4886675_4886996_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4887131_4887587_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4887579_4887867_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4887859_4888450_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4888446_4888713_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4889264_4889999_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4889995_4890496_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4890569_4891142_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4891467_4892712_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4892749_4893484_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4893560_4893866_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4894033_4895308_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4900261:4900276	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 15
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	4927746	4986773	5495195	protease,transposase	Klosneuvirus(11.11%)	59	NA	NA
WP_001162171.1|4927746_4929099_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4929192_4929744_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4929899_4931273_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4931448_4932447_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4932479_4933475_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4933461_4934484_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171877954.1|4934497_4936000_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4936139_4937096_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4937405_4937936_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4938015_4938366_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4938359_4938611_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4938822_4939164_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4939166_4942946_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4942942_4944676_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4944881_4945520_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4945842_4947186_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4947281_4947488_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4947812_4948367_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4948429_4949368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4949579_4950320_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4950509_4952453_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000560631.1|4953038_4953899_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4954006_4954972_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4955079_4955742_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4955786_4957199_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4957507_4958128_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4958345_4958984_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4959118_4960327_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4960334_4960766_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4961388_4962183_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4962253_4962703_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4962744_4962972_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4962976_4963291_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4963297_4963693_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4964019_4964295_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4964423_4965110_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4965109_4965964_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4965973_4966624_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4966637_4967102_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4967111_4967417_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4967432_4968830_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4970356_4971112_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4971108_4971858_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4972039_4972369_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4972517_4972793_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4972909_4974535_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4974618_4975782_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4975784_4976423_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4976432_4976831_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4976848_4977508_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4977558_4978257_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4978275_4978677_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4978803_4979535_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4979715_4982157_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4982195_4982621_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4982825_4984124_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4984227_4984425_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4984506_4985511_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4985513_4986773_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038423	Escherichia coli O157:H7 strain 7409 chromosome, complete genome	5495195	5123652	5138317	5495195	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5119493:5119508	5137022:5137037
5119493:5119508	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5123652_5125068_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5125150_5126134_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5126299_5126542_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5126675_5127713_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5127801_5128899_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5128960_5129209_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5129369_5130011_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5130092_5130722_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5130794_5131367_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5131478_5131748_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5131749_5133063_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5133127_5133727_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5135048_5135585_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5135575_5135926_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5135922_5136207_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5136542_5136740_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5137084_5137366_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5137022:5137037	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5137413_5137587_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_171877957.1|5137783_5138317_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	1.1e-99
>prophage 1
NZ_CP038424	Escherichia coli O157:H7 strain 7409 plasmid p7409-1, complete sequence	96931	0	54771	96931	transposase,integrase	Macacine_betaherpesvirus(31.25%)	55	8752:8770	69143:69161
WP_001302175.1|2588_3464_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|3464_5432_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|5431_6937_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|6938_8162_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|8192_8627_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|8623_9178_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
8752:8770	attL	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
WP_000173396.1|9192_9540_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|9536_10136_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|10132_11110_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|11148_12321_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|12307_12820_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|12877_13711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|13802_14204_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000998048.1|15812_17351_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|17400_17748_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|17744_18125_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000839950.1|18544_19060_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|19061_22058_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|22107_24228_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|24231_25671_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|26414_26645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|26765_27506_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|27790_28768_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|29175_29376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|29372_29993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|29989_30673_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|31131_31350_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|31351_31657_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|31657_32464_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|33186_34400_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|34475_35231_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|35818_36985_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|36984_37956_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|38564_39467_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|39470_39776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|39852_40536_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|40536_40758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|40651_41206_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|41900_42473_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|42568_42871_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|42917_43340_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|43336_43528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|43646_44036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|44523_44754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|44805_46167_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|46213_46777_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001358896.1|46862_47318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|47387_47594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|47619_48072_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|48128_48362_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|48427_50386_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|50440_50875_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|50871_51633_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|51864_52023_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_162829200.1|53557_54771_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
69143:69161	attR	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
