The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	131081	144428	5552787	transposase,integrase	Enterobacteria_phage(66.67%)	15	134095:134108	149200:149213
WP_000998051.1|131081_132620_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|132669_133017_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|133013_133394_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000783661.1|134037_136371_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
134095:134108	attL	CAGCGTCAGGTTGG	NA	NA	NA	NA
WP_000856729.1|136385_136706_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|136841_137297_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|137289_137577_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980233.1|137569_138169_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001149160.1|138165_138432_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283041.1|138982_139717_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_000638631.1|139713_140214_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446145.1|140287_140860_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000704989.1|141500_143021_+	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000021256.1|143022_143196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218978.1|143240_144428_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
149200:149213	attR	CAGCGTCAGGTTGG	NA	NA	NA	NA
>prophage 2
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	1234865	1250699	5552787	transposase,holin,tail	Enterobacteria_phage(33.33%)	19	NA	NA
WP_162829202.1|1234865_1236078_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001108081.1|1236721_1237288_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1237262_1237874_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1237870_1238536_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1238532_1239156_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1239408_1240152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1240237_1240405_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1240812_1242666_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1242815_1243031_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1243035_1243380_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1243736_1244117_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1244113_1244461_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1245078_1245348_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1245508_1245931_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1246060_1247119_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1247197_1247848_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1248030_1248621_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1249122_1249371_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1250216_1250699_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	1529596	1535022	5552787	integrase	Enterobacteria_phage(50.0%)	6	1518584:1518600	1537218:1537234
1518584:1518600	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1529596_1530166_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1530165_1530633_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1530619_1531300_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1531309_1532446_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1532620_1533778_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1534089_1535022_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1537218:1537234	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	1779303	1862863	5552787	capsid,transposase,portal,holin,tail,tRNA,protease,head,terminase	Enterobacteria_phage(46.07%)	97	NA	NA
WP_000569336.1|1779303_1780230_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1780234_1780966_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1780946_1781054_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1781113_1781815_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063643.1|1781835_1783122_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1783155_1783410_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1783428_1783563_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1783566_1783809_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1783896_1784259_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1784255_1784612_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1784945_1785122_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1785123_1786071_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1786067_1786289_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1786387_1786669_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1786679_1786871_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1786843_1787026_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186785.1|1787025_1787703_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
WP_000100847.1|1787699_1788485_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1788490_1788787_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|1788862_1789006_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|1788998_1789139_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|1789211_1789580_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|1789760_1790384_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|1790445_1790829_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000745483.1|1791317_1791482_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1791484_1792531_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1792524_1792986_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1793053_1793395_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1793455_1794163_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1794241_1794469_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438524.1|1794607_1794904_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	98.0	4.4e-47
WP_000166961.1|1794936_1795098_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539349.1|1795084_1795906_+	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
WP_001248388.1|1795902_1797279_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1797349_1797628_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103679.1|1797760_1797976_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1797986_1798223_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001310475.1|1798179_1798626_+	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_000153268.1|1798622_1799150_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1799146_1799329_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000290551.1|1799604_1800282_+	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001004018.1|1800356_1801079_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|1801078_1801684_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|1801680_1801875_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1801867_1802302_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1802808_1803756_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1803765_1804035_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064261944.1|1804534_1806385_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_024164617.1|1806823_1807039_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731259.1|1807043_1807388_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1807438_1807972_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1808242_1808812_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1808811_1808958_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1809185_1809371_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1809795_1810023_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1810064_1810430_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1810718_1811282_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1811278_1812940_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|1813003_1814941_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1814985_1815207_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_015994249.1|1815152_1817738_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	100.0	0.0e+00
WP_000125984.1|1817734_1818061_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1818071_1818422_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1818418_1818865_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1818861_1819206_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|1819271_1819988_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|1820002_1820377_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1820472_1820682_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1820729_1823972_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1823964_1824306_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1824305_1825004_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1825020_1825341_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1825448_1825622_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1825692_1826616_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1826669_1827407_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1827352_1827985_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_015994252.1|1828244_1831724_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_001230509.1|1831791_1832391_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268879.1|1832455_1833625_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001023396.1|1833626_1833896_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1834056_1834473_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1834554_1835196_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1835357_1835606_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1836120_1837806_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1837802_1838522_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1838568_1839039_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000998048.1|1839420_1840959_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1841008_1841356_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1841352_1841733_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001087225.1|1842116_1844120_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1844116_1845253_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1845245_1845977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1845995_1847525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1847535_1848624_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1849864_1850182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1850243_1853873_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1860829_1862863_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	1888494	1925745	5552787	plate,integrase,capsid,portal,holin,lysis,tail,tRNA,head,terminase	Escherichia_phage(40.82%)	52	1890275:1890302	1921419:1921446
WP_000807362.1|1888494_1889394_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1889799_1890117_+	hypothetical protein	NA	NA	NA	NA	NA
1890275:1890302	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1890381_1891395_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|1891510_1891810_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1891924_1892200_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005166.1|1892210_1892381_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	6.7e-24
WP_000217679.1|1892377_1892878_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557701.1|1892941_1893166_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277943.1|1893165_1893468_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_001113260.1|1893467_1893692_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_000027665.1|1893688_1893964_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_000268557.1|1893953_1896242_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_001302990.1|1896650_1896806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|1896842_1897151_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000746343.1|1897128_1898079_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|1898203_1898641_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_001177885.1|1898864_1899134_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000038195.1|1899346_1900381_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_000156861.1|1900380_1902153_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085969.1|1902326_1903181_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_001248573.1|1903235_1904309_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_000203439.1|1904312_1905056_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|1905155_1905665_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1905664_1905868_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123125.1|1905871_1906153_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_001144113.1|1906152_1906650_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000736588.1|1906664_1907090_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_000040660.1|1907077_1907503_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_001300730.1|1907474_1907648_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917172.1|1907610_1908078_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001001774.1|1908070_1908523_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_001093756.1|1908589_1909225_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_000127172.1|1909221_1909569_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121492.1|1909573_1910482_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_001285344.1|1910474_1911086_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_000216998.1|1911082_1912582_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	98.2	2.3e-272
WP_000368070.1|1912581_1913184_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001008242.1|1913155_1913599_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_001145597.1|1913619_1914030_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	87.1	4.5e-58
WP_000905091.1|1914060_1914654_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001286714.1|1914713_1915904_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_001251408.1|1915916_1916435_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|1916491_1916767_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1916799_1916919_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069920.1|1916911_1919359_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000978915.1|1919373_1919853_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000882987.1|1919852_1921016_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000468308.1|1921097_1921316_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1921590_1922952_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1921419:1921446	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1923099_1923432_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1923622_1924345_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1924341_1925745_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	2008969	2153089	5552787	integrase,capsid,transposase,lysis,holin,tail,protease,head,terminase	Stx2-converting_phage(46.4%)	162	2005587:2005601	2111996:2112010
2005587:2005601	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|2008969_2010148_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2010128_2010320_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2010397_2010742_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2010929_2011280_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2012146_2013094_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2013090_2013312_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2013410_2013692_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2013702_2013894_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2013866_2014049_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2014045_2014726_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2014722_2015508_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|2015513_2015810_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2015884_2016028_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2015996_2016161_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2016233_2016602_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394301.1|2016784_2017045_-	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000088203.1|2017103_2017376_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2017353_2017536_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2018104_2018626_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2019127_2019823_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2019897_2020113_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2020254_2020551_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2020583_2020745_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2020731_2021553_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2021549_2022926_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001171554.1|2023053_2023434_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2023430_2023778_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2023827_2025366_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001220560.1|2025454_2026066_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|2026529_2026862_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103679.1|2026994_2027210_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|2027220_2027457_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001310475.1|2027413_2027860_+	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_000153268.1|2027856_2028384_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2028380_2028563_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2028837_2029602_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2029676_2030399_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2030398_2031004_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2031000_2031672_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2031662_2032151_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2032800_2033760_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2033771_2034041_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2034337_2034661_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143113.1|2034904_2036842_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_000143458.1|2036978_2037158_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2037198_2037471_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2037547_2037763_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2037762_2038260_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2038256_2038694_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2038896_2039394_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2039390_2039648_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2040110_2040338_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2040379_2040745_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2041036_2041600_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_000173023.1|2043320_2045258_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	100.0	0.0e+00
WP_001063023.1|2045302_2045524_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2048050_2048377_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2048386_2048737_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2048733_2049180_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2049176_2049521_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2049579_2050296_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2050301_2050676_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2050771_2050981_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2051032_2054275_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2054267_2054609_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2054608_2055307_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2055323_2055644_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2055751_2055925_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2055995_2056919_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2056972_2057710_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2057655_2058288_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2058547_2062027_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2062093_2062693_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2062757_2064071_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2064072_2064342_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2064482_2065358_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2065582_2066233_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2067556_2068723_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2068841_2069315_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2069513_2070572_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2070743_2071073_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2071173_2071356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2071844_2071958_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2071970_2072165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2072623_2072992_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2073065_2073287_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2073349_2073826_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2073840_2074320_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2074401_2075223_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2075443_2075854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2075869_2076553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2076688_2077759_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2077755_2078661_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2078657_2079539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2079522_2080736_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2081107_2083255_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2084702_2086241_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2086290_2086638_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2086634_2087015_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2087376_2087922_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2087918_2088662_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2088673_2089753_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2089814_2090750_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2091206_2092124_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2092225_2093176_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2093293_2094937_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2095562_2096279_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2096621_2098076_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2098177_2099494_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2099807_2100860_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2101121_2109104_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2109593_2110391_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2110626_2111649_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2111648_2111852_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2111910_2114382_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2111996:2112010	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2114477_2114666_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2114662_2114851_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2115331_2115484_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2115758_2116403_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2116500_2116728_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2116724_2117150_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2117218_2118256_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2118167_2118710_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2118744_2119443_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2119464_2119689_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2119685_2120042_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2120074_2120227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2120223_2120535_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2120661_2121225_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2121334_2121439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2121625_2121838_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2122005_2122284_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2122285_2123335_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2123347_2123707_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2123703_2124393_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2125932_2127783_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2127864_2129078_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2129388_2129604_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2129608_2129953_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2130003_2130537_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2130692_2130875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2130887_2131019_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2131246_2131432_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2131958_2132273_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2132354_2132579_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2132973_2133483_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2135367_2135574_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_162829202.1|2136458_2137672_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001254002.1|2138465_2139971_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_079448602.1|2140007_2140355_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	9.9e-22
WP_001301534.1|2140412_2140679_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2140660_2141401_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2141414_2141846_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2141872_2142286_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|2142266_2144846_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2144842_2145172_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2145171_2145870_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|2145880_2146624_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_140408398.1|2146569_2147202_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	4.9e-104
WP_001230509.1|2150984_2151584_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|2151648_2152818_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|2152819_2153089_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 7
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	2210673	2230659	5552787	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2223795:2223808	2233801:2233814
WP_032161583.1|2210673_2211810_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2211760_2212084_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2212241_2213426_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2213425_2213938_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2213992_2214358_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2214366_2214522_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2217324_2217813_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2217969_2218542_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2218585_2219116_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2220207_2220522_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2220526_2221486_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2221562_2224385_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2223795:2223808	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2224391_2224757_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2224753_2225371_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2225382_2225682_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2225678_2225945_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2225941_2226145_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2226168_2226585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2226677_2226791_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2226787_2227030_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2227041_2227320_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2227330_2227681_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2227702_2227906_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2227977_2228115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2228204_2228609_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2228624_2229275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2229304_2229652_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2229657_2230659_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2233801:2233814	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	2551205	2643744	5552787	capsid,transposase,holin,tail,protease,head,terminase	Stx2-converting_phage(37.7%)	99	NA	NA
WP_001260835.1|2551205_2552027_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2552126_2552210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2552302_2552638_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2553034_2554288_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2554394_2555288_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2555422_2556643_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2556767_2557463_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2557415_2558708_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2558865_2559480_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2559522_2560377_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2560378_2560996_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2561006_2563430_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2563490_2565917_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2566115_2566421_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2566528_2567239_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2567241_2567802_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2567836_2568178_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2568312_2568639_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2569627_2569879_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2569951_2572423_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2572515_2572707_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2572703_2572892_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2573292_2573457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2573460_2573679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2573750_2574050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2574402_2574681_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2574682_2574874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2574894_2575266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2575363_2575666_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2575662_2576088_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2576110_2577073_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2577079_2577820_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2578630_2579026_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2579082_2579667_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2579782_2579887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2580075_2580288_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2580455_2580734_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2580735_2581785_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2581797_2582157_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2582153_2582843_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2583479_2583908_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2584386_2586237_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2586676_2586892_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731257.1|2586896_2587190_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_001171554.1|2587265_2587646_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2587642_2587990_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2588039_2589578_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000992137.1|2589741_2590275_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2590545_2591115_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2591114_2591261_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2591488_2591674_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2592098_2592326_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2592367_2592733_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2593021_2593585_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2593581_2595243_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2595306_2597244_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2597288_2597510_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2600036_2600363_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2600372_2600723_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2600719_2601166_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2601162_2601507_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2601565_2602282_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2602287_2602662_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2602757_2602967_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2603019_2606262_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2606254_2606596_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2606595_2607294_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|2607304_2608048_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2607993_2608626_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2608968_2610144_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2610095_2612441_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2612508_2613108_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2613259_2614573_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2614574_2614844_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2615870_2617196_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2619860_2621399_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2621448_2621796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2621792_2622173_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2622512_2622791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2623218_2623365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2623501_2624149_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2624332_2624923_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2626429_2627080_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2628393_2628900_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2628945_2629446_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2629531_2629711_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2630091_2630898_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2630897_2632091_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2632102_2633464_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2633464_2635060_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2635059_2636622_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2636713_2636758_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2636895_2637777_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2637773_2638394_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2638421_2640005_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2640217_2641090_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2641129_2641720_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2641716_2642475_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2642694_2643744_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	2914017	2988281	5552787	capsid,portal,holin,tail,head,terminase	Escherichia_phage(37.04%)	93	NA	NA
WP_000214712.1|2914017_2914221_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2914256_2915717_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2915805_2917089_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2917220_2917463_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2917624_2918266_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2918347_2918977_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2919049_2919625_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2919738_2920008_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2920009_2921323_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230509.1|2921387_2921987_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000514788.1|2922054_2925534_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|2925780_2926413_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2926358_2927102_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2927112_2927811_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2927810_2928140_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2930729_2931143_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2931169_2931592_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2931605_2932358_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2932365_2932761_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2932757_2933291_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2933305_2933659_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2933670_2934069_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2934110_2935136_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2935191_2935524_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2935533_2936853_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2936833_2938435_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2938431_2938638_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2938634_2940560_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2940534_2941080_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2941466_2941691_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2941772_2942087_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2942612_2942798_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2943020_2943167_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2943166_2943736_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000731259.1|2944589_2944934_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000023184.1|2945592_2947443_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2947920_2948352_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2948802_2949516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2949651_2949849_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2950073_2950628_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2950690_2950996_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2951008_2952058_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2952059_2952332_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2952453_2952798_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2952917_2953130_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2953363_2953921_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2953922_2954141_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2954268_2954580_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2954572_2954800_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2954796_2955078_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2955110_2955827_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2955860_2956322_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2956314_2957358_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2957426_2957852_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2957835_2958078_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2958469_2958808_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2959100_2959253_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2959264_2959903_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2959903_2960113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2960677_2960866_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2960862_2961051_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2961143_2962388_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2963098_2963341_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|2964252_2964549_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_001063099.1|2967074_2967296_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2967340_2969278_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2969341_2971003_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2970999_2971563_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2971852_2972218_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2972259_2972487_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2972911_2973097_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2973324_2973471_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2973470_2974040_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2974310_2974844_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2974894_2975239_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2975243_2975459_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2975608_2977462_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2978258_2979317_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2979467_2979665_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2979906_2980437_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2980445_2980805_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2980817_2981864_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2981865_2982144_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2982213_2982471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2982691_2982904_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2983182_2983941_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2984639_2984804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2984800_2985382_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2985568_2986111_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2986022_2987063_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2987034_2987586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2987569_2987797_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2987873_2988281_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
>prophage 10
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3041392	3135074	5552787	integrase,capsid,transposase,portal,lysis,holin,tail,tRNA,protease,head,terminase	Enterobacteria_phage(49.06%)	99	3064580:3064595	3128977:3128992
WP_001299679.1|3041392_3042649_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3042862_3043486_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3043485_3044337_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3044487_3045435_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3045559_3047239_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3047293_3047572_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3047849_3048434_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3048550_3049642_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001310261.1|3053460_3055380_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3056086_3056698_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3056797_3057712_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3057807_3059544_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_171876993.1|3059701_3060915_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	8.4e-169
WP_000197865.1|3061252_3062323_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3062332_3063631_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3063993_3065526_+	SpoVR family protein	NA	NA	NA	NA	NA
3064580:3064595	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3065577_3066297_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3066518_3068060_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3068205_3068736_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3068781_3070050_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3070049_3070469_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3070841_3071753_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3071959_3072421_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3072497_3073157_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3073228_3073522_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3073533_3073692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3073762_3074164_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3074266_3074635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3075154_3075850_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3075873_3076686_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3076689_3076956_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3078187_3078772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3079270_3080224_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3080410_3081895_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3082197_3083736_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3083785_3084133_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3084129_3084510_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3084585_3084834_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3084890_3085559_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3086056_3086239_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3086317_3086818_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3086854_3087361_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3087379_3088270_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3088389_3088971_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3088970_3091886_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3091950_3092550_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3092616_3096015_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3096075_3096708_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3096644_3097388_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_112046107.1|3097393_3098092_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000847331.1|3098091_3098421_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3098417_3100967_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3100959_3101394_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3101375_3101798_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3101813_3102554_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3102561_3102957_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3102953_3103532_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3103543_3103897_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3103908_3104307_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3104348_3105374_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3105428_3105761_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3105770_3107090_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3107070_3108672_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3108668_3108875_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3108871_3110797_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3110771_3111317_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3111705_3111900_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3112064_3112271_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3112556_3112967_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3113258_3113552_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3113642_3113825_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3114041_3114518_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3114504_3114810_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3115131_3115821_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3115817_3115958_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3115954_3116317_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3116313_3116604_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3116596_3116767_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3116766_3117222_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3117723_3119250_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3119307_3119430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3119494_3119827_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3119894_3120197_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3120193_3120895_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3121819_3122056_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3122045_3123188_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3123301_3124552_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3124723_3125377_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3125386_3125848_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3125901_3127008_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3127043_3127685_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3127688_3129059_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3128977:3128992	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3129227_3129899_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3129898_3131359_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3131959_3132241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3132496_3133039_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3133244_3133658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3133670_3134006_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3134018_3135074_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3141166	3199816	5552787	integrase,capsid,transposase,portal,holin,tail,head,terminase	Enterobacteria_phage(26.79%)	71	3185383:3185403	3206473:3206493
WP_032174463.1|3141166_3142384_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3142382_3143595_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3143957_3145079_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3145127_3146354_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3146603_3147740_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3147723_3148587_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3148950_3150312_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3150372_3150648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|3156947_3159296_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3159315_3159405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3159417_3159654_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3159599_3160337_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3160390_3161269_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3161571_3161682_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3161791_3162046_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3162062_3162761_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3162760_3163102_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212915.1|3163094_3166337_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3166389_3166599_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3166694_3167069_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3167074_3167791_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3167849_3168194_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3168190_3168637_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3168633_3168984_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3168993_3169320_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3169399_3171901_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3171846_3172068_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3172112_3174050_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3174113_3175775_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3175771_3176335_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3176627_3176993_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3177034_3177220_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3177349_3177490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3177846_3178071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3178135_3178342_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3178569_3178716_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3178715_3179285_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3179555_3180089_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3180139_3180484_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3180488_3180704_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3180779_3181049_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3181086_3181269_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023147.1|3181416_3183354_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_000216629.1|3183668_3183836_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3184432_3185254_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3185250_3185625_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3185383:3185403	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3185637_3186687_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3186688_3186967_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3187134_3187347_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3187535_3187640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079448564.1|3187755_3188343_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.3	1.7e-37
WP_001014296.1|3188345_3188537_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3188538_3188976_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3188962_3189280_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3189233_3189551_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3189540_3189843_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3189839_3190121_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3190153_3190870_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3190903_3191446_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3191357_3192395_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3192463_3192889_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3192872_3193196_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3193320_3193797_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3194112_3194265_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3194379_3194895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3195027_3195417_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3195478_3195748_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3195716_3196835_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3197001_3197796_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3197792_3198839_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3198994_3199816_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3206473:3206493	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3254705	3293615	5552787	plate,transposase,tail,protease,head	Shigella_phage(56.41%)	58	NA	NA
WP_000528254.1|3254705_3255443_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|3255396_3255597_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3255711_3256176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3256214_3256460_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3256495_3256678_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3256824_3258864_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3258963_3259524_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_000729807.1|3259649_3259973_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	56.5	3.5e-21
WP_000420351.1|3260007_3260529_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|3260608_3260812_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000301577.1|3261495_3262056_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3262046_3263129_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|3263128_3263566_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3263558_3264173_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3264162_3265287_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|3265270_3266620_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|3266606_3268682_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|3268808_3269285_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3269299_3269665_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|3269673_3271176_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3271172_3271418_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3271418_3271979_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3271975_3272395_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002053.1|3272391_3272802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3272845_3273793_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|3273792_3274917_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|3275093_3275567_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|3275688_3277020_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|3277003_3278593_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|3278592_3280257_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|3280256_3280838_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|3280840_3281131_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|3281127_3281436_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|3281416_3281644_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3281653_3281872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3281855_3282284_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3282318_3282819_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3282890_3283316_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|3283385_3283895_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|3283891_3284188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|3284177_3284375_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|3284367_3284700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|3284715_3285066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|3285080_3285392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|3285388_3285940_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|3285943_3286459_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|3286458_3286992_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000323221.1|3286995_3287538_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|3287635_3288166_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|3288177_3288471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3288475_3288748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3288744_3289026_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3289027_3289282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|3289294_3289516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3289518_3290451_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|3290522_3292613_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|3292614_3292863_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|3293030_3293615_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
>prophage 13
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3490113	3545458	5552787	integrase,capsid,transposase,portal,holin,tail,protease,head	Escherichia_phage(27.91%)	62	3492048:3492063	3547223:3547238
WP_000003653.1|3490113_3490701_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3490697_3491405_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3491423_3493217_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3492048:3492063	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3493213_3494332_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3496324_3496594_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3496595_3497909_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3497973_3498573_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3498640_3502114_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3502247_3502775_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3502965_3503598_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3503543_3504287_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3504297_3504996_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3504995_3505325_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3505321_3507901_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3507881_3508295_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3508321_3508753_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3508766_3509507_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3509488_3509755_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3509812_3510160_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3510196_3511702_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3511691_3513284_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3513280_3513487_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3515663_3517202_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3517251_3517599_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3517595_3517976_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3518051_3518327_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3519077_3519284_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3519539_3519812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3519971_3520505_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3520725_3520839_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3521060_3521246_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3521773_3522088_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3522292_3523506_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3523681_3525532_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3526298_3527012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3527632_3528451_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3528602_3528974_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3528963_3529335_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3529347_3530397_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3530398_3530677_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3530844_3531000_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3531101_3531239_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3531604_3532378_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3532729_3533143_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3533158_3533929_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3533950_3534697_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3534703_3535795_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3535873_3536329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3536535_3536961_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3536944_3537217_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3537325_3537727_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3537754_3537946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3537945_3538233_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3538510_3538666_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3538807_3539197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3539383_3539569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3540142_3540331_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3540327_3540519_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3540612_3543084_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3543151_3543394_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3543371_3544391_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3544798_3545458_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3547223:3547238	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 14
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3664666	3724478	5552787	transposase,integrase,protease	Moraxella_phage(20.0%)	49	3670453:3670468	3722724:3722739
WP_000998072.1|3664666_3666205_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	2.7e-297
WP_000885242.1|3666972_3667476_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000017595.1|3668643_3669165_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000767171.1|3669428_3669704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410312.1|3669672_3670281_-	hypothetical protein	NA	NA	NA	NA	NA
3670453:3670468	attL	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000792318.1|3670511_3670766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|3672628_3673444_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3673530_3673833_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3673726_3673978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|3674216_3675053_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3675052_3675856_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_032324762.1|3676141_3677350_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.3	5.7e-234
WP_000599533.1|3677715_3678921_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3679364_3679685_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460649.1|3679677_3680064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3680071_3680758_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3680735_3681359_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|3681440_3682646_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3682758_3683352_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001303003.1|3683865_3685074_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	2.0e-234
WP_000015617.1|3685177_3685315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765181.1|3685353_3685584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266539.1|3685580_3686069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990243.1|3686300_3686756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303001.1|3686760_3687270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877779.1|3687292_3687550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118523.1|3688927_3689191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258566.1|3689187_3690042_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000832132.1|3690111_3690525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912479.1|3690534_3690984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003689.1|3691166_3691544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001477171.1|3691595_3692249_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_001449592.1|3692758_3693202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310368.1|3693614_3694472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001449593.1|3694468_3694669_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000779468.1|3694901_3695441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075571.1|3695440_3705070_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.8	3.2e-29
WP_001200020.1|3705082_3706849_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_000090034.1|3707309_3708239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081278.1|3708228_3708969_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000273844.1|3710375_3712796_+	NTPase	NA	NA	NA	NA	NA
WP_000282071.1|3713100_3713664_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335694.1|3714638_3716072_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3716290_3716488_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_014639577.1|3716714_3717011_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000271854.1|3718123_3719941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|3720128_3721331_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|3721850_3724127_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
3722724:3722739	attR	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000520781.1|3724157_3724478_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 15
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	3849163	3887258	5552787	integrase,portal,holin,lysis,tail,protease	Enterobacteria_phage(52.5%)	47	3848748:3848762	3887332:3887346
3848748:3848762	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3849163_3849862_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3850092_3850974_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3851142_3851304_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3851800_3852820_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3852853_3853834_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024011.1|3854010_3854280_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	3.2e-44
WP_000741874.1|3854281_3855598_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3855657_3856257_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3859801_3860410_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3860346_3861090_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3861095_3861794_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3861803_3862133_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3862132_3865198_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3865169_3865499_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3865507_3865894_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3865954_3866698_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3866708_3867110_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3867106_3867685_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3867696_3867972_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3867964_3868288_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3868374_3870402_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3870346_3870682_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3870803_3871928_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3871855_3872068_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001139679.1|3875331_3875484_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3875471_3875939_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3875935_3876433_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3876432_3876648_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3876790_3877189_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3877269_3877428_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3877513_3878257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3878440_3879130_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3879144_3879267_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3879604_3880564_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3880775_3881441_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3881437_3882058_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3882050_3882221_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3882217_3882400_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3883097_3883778_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3883774_3883957_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3883929_3884121_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3884131_3884413_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3884511_3884733_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3884943_3885546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3885788_3885956_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3885995_3886214_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3886487_3887258_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3887332:3887346	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 16
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	4429117	4508343	5552787	plate,integrase,capsid,transposase,portal,lysis,holin,tail,protease,head,terminase	Shigella_phage(42.37%)	95	4466235:4466281	4504441:4504487
WP_000998048.1|4429117_4430656_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4430705_4431053_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4431049_4431430_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4431693_4431957_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4431956_4432097_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4432166_4432358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4433182_4433725_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4433799_4434387_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4434444_4435113_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4435138_4437664_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4437653_4439297_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4439265_4439976_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4440288_4440618_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4440865_4441480_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4441897_4442587_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4442583_4443540_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4443536_4445735_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4445744_4446701_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4446879_4448007_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4448148_4449207_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4449452_4450355_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4451057_4451336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4451502_4452225_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4452323_4453223_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4453898_4454855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4454987_4457321_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4457334_4457658_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4457657_4457879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4457875_4458433_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4458429_4458690_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4459623_4460376_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4460372_4460924_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4460929_4461202_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4461611_4462178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4462177_4462768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4462798_4463431_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4463423_4463882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4463881_4464499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4464471_4464888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4464891_4466073_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4466235:4466281	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4467035_4467779_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4468603_4469377_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4469437_4469992_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4470022_4470541_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4470540_4471143_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4471114_4471558_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4471578_4471974_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4472244_4472829_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4472819_4473878_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4473864_4474290_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4474289_4474838_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000219910.1|4475897_4477226_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_171880035.1|4477286_4479122_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.0e-306
WP_000661054.1|4479263_4479533_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4479532_4479889_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4479888_4481385_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4481368_4481539_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4481547_4482108_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4482104_4482611_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4482585_4482996_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4482992_4483316_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4483394_4484624_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4484634_4485237_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4485229_4486456_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4486445_4486607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4486603_4488100_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929189.1|4488333_4488828_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_001135207.1|4488953_4489304_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4489829_4490123_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4490213_4490396_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4490612_4491089_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4491092_4491428_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4491564_4491858_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4492136_4492370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4492513_4493053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4493266_4494019_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4494032_4495022_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4495029_4495839_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4495858_4496248_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4496244_4496571_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4496567_4497221_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4497220_4497715_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4497711_4498653_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4498642_4498822_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4498997_4499549_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4499541_4499802_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4499899_4500592_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4500869_4501166_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4501842_4502379_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4502369_4502732_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4502731_4503037_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4503263_4504427_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4504631_4505885_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4504441:4504487	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4505896_4507000_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4507287_4508343_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 17
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	4527129	4600379	5552787	transposase,plate,tRNA,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_000027427.1|4527129_4528302_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4528382_4528568_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4528482_4528746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509142.1|4528947_4533171_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4533246_4535388_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4535597_4536116_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4536812_4537313_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4537347_4537572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4537622_4539014_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4539104_4539518_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4539521_4541372_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4541335_4542418_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4542442_4543723_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4543719_4544244_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246433.1|4544246_4545578_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4545582_4546344_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614378.1|4546352_4549142_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000088854.1|4549138_4549882_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4549886_4551299_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001310198.1|4551435_4554870_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4554880_4556290_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4556255_4556735_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4556755_4556977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4557055_4557652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4557654_4558104_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001301976.1|4559918_4560650_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4560714_4561182_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4561178_4561901_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4561934_4562690_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4562761_4564120_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4564167_4564938_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4565015_4565816_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4566056_4566971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4566967_4567771_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4573530_4574106_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4574293_4575325_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4575317_4575971_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4576010_4576826_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4576943_4577348_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4577344_4578052_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4578162_4579881_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4579933_4580758_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4580957_4581668_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4581681_4582092_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4582088_4582634_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4582799_4583000_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4582986_4583247_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4583299_4584595_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4584659_4585049_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020954.1|4585105_4587247_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4587345_4588305_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294772.1|4588317_4591800_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|4591836_4592433_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_000139661.1|4592429_4593578_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565963.1|4593577_4594366_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4594369_4594825_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4594929_4595955_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4595958_4596444_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4596564_4598997_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4599026_4600379_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 18
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	4940331	4952907	5552787	integrase	Enterobacteria_phage(81.82%)	15	4939365:4939380	4957860:4957875
4939365:4939380	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4940331_4941159_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4941376_4941571_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4941926_4944260_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4944274_4944595_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4944730_4945186_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4945178_4945466_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4945458_4946049_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4946045_4946312_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4946863_4947598_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4947594_4948095_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4948168_4948741_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4949066_4950311_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4950348_4951083_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4951159_4951465_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4951632_4952907_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4957860:4957875	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 19
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	4985327	5044355	5552787	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4985327_4986680_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4986773_4987325_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4987480_4988854_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4989029_4990028_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4990060_4991056_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4991042_4992065_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4992078_4993581_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4993720_4994677_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4994986_4995517_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4995596_4995947_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4995940_4996192_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4996403_4996745_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4996747_5000527_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5000523_5002257_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5002462_5003101_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5003423_5004767_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5004862_5005069_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|5005393_5005948_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937657.1|5006010_5006949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5007160_5007901_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|5008090_5010034_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|5010151_5010532_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5010620_5011481_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5011588_5012554_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5012661_5013324_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5013368_5014781_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5015089_5015710_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5015927_5016566_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5016700_5017909_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5017916_5018348_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5018970_5019765_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5019835_5020285_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5020326_5020554_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5020558_5020873_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5020879_5021275_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5021601_5021877_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5022005_5022692_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5022691_5023546_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5023555_5024206_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5024219_5024684_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5024693_5024999_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5025014_5026412_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5027938_5028694_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5028690_5029440_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5029621_5029951_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5030099_5030375_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5030491_5032117_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5032200_5033364_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5033366_5034005_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5034014_5034413_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5034430_5035090_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5035140_5035839_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5035857_5036259_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5036385_5037117_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5037297_5039739_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5039777_5040203_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5040407_5041706_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5041809_5042007_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5042088_5043093_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5043095_5044355_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 20
NZ_CP038419	Escherichia coli O157:H7 strain 2-6-2 chromosome, complete genome	5552787	5181235	5195900	5552787	tRNA,integrase,tail	Enterobacteria_phage(43.75%)	19	5177076:5177091	5194605:5194620
5177076:5177091	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5181235_5182651_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5182733_5183717_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5183882_5184125_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5184258_5185296_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5185384_5186482_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5186543_5186792_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5186952_5187594_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5187675_5188305_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5188377_5188950_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5189061_5189331_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5189332_5190646_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5190710_5191310_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5192631_5193168_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5193158_5193509_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5193505_5193790_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5194125_5194323_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5194667_5194949_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5194605:5194620	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5194996_5195170_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5195366_5195900_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038420	Escherichia coli O157:H7 strain 2-6-2 plasmid pEX262-1, complete sequence	98042	24314	89506	98042	protease,transposase,integrase	Stx2-converting_phage(28.57%)	58	11888:11903	53410:53425
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24314_25055_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25339_26317_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29206_30013_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30735_31949_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32024_32780_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|33367_34534_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34533_35505_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|36113_37016_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|37019_37325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|37401_38085_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|38085_38307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|38200_38755_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|39449_40022_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|40117_40420_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|40466_40889_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40885_41077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212978.1|41195_41579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|42066_42297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|42348_43710_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43756_44320_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001492078.1|44405_44849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44918_45125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|45150_45603_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45659_45893_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45958_47917_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47971_48406_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|48402_49164_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|49395_49554_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51776_52208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581718.1|53959_63469_+	toxin B	NA	NA	NA	NA	NA
53410:53425	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_001171554.1|64463_64844_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|64840_65188_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|65413_66952_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|67001_67349_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|67345_67726_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000205762.1|70627_71374_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|71432_72293_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|72395_72956_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|73088_73301_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|73545_74007_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|74052_74262_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|74299_74638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|74877_75132_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|75367_75442_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|75434_76292_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|77203_77488_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|77487_77763_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|77857_78064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|79404_79590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|79766_81977_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|82020_82410_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|83635_87538_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_000998048.1|87967_89506_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
