The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	1176347	1245338	5542130	tail,tRNA,transposase,integrase,holin	Enterobacteria_phage(20.0%)	66	1176300:1176314	1235788:1235802
1176300:1176314	attL	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000047198.1|1176347_1178978_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1179212_1179398_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1180625_1181192_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287450.1|1181188_1181617_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611787.1|1181689_1183246_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130215.1|1183395_1183911_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1183974_1185513_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001302673.1|1185529_1186702_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1186828_1187359_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|1187449_1187785_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1187774_1188512_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165714.1|1188635_1189820_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1190011_1191004_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774978.1|1191060_1192125_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985501.1|1192117_1193320_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|1193675_1194635_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000080947.1|1196760_1197171_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1197167_1197413_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000209792.1|1197621_1198053_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001138451.1|1198140_1199475_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001295174.1|1199624_1199954_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1200105_1200450_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1200486_1200936_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1201603_1202008_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229446.1|1202060_1202579_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000138003.1|1202588_1202888_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1203070_1203229_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1203312_1203762_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1203762_1204425_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|1204445_1205846_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|1206083_1207364_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_000772884.1|1207377_1208826_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271966.1|1208848_1210117_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001301435.1|1210136_1211114_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000906745.1|1215090_1216440_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072145424.1|1216827_1217037_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
WP_001120794.1|1217191_1217311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526000.1|1217375_1221317_+	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_001071599.1|1221416_1221623_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1221945_1223151_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1223152_1224466_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1224462_1226094_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1226094_1226493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1226590_1227004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150588.1|1227399_1228578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1228653_1228989_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228991_1229747_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108083.1|1230046_1230613_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223948.1|1230587_1231199_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231195_1231861_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231857_1232481_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232733_1233477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1233562_1233730_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1234137_1235991_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
1235788:1235802	attR	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000284517.1|1236140_1236356_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1236360_1236705_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1237061_1237442_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1237438_1237786_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1238286_1239500_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1239717_1239987_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442136.1|1240147_1240570_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	96.3	1.7e-71
WP_001301665.1|1240699_1241758_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241836_1242487_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1242669_1243260_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1243761_1244010_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244855_1245338_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	1522918	1528344	5542130	integrase	Enterobacteria_phage(50.0%)	6	1511906:1511922	1530540:1530556
1511906:1511922	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522918_1523488_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1523487_1523955_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523941_1524622_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1524631_1525768_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525942_1527100_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1527411_1528344_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1530540:1530556	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	1772742	1876049	5542130	tail,tRNA,transposase,protease,terminase,portal,holin	Enterobacteria_phage(50.7%)	110	NA	NA
WP_000569336.1|1772742_1773669_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1773673_1774405_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774385_1774493_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774552_1775254_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1775274_1776561_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1776594_1776849_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1776867_1777002_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_032287390.1|1777005_1777248_-	hypothetical protein	NA	B6DZ51	Enterobacteria_phage	96.5	6.2e-23
WP_162829202.1|1777213_1778427_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000610375.1|1778648_1779011_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1779007_1779364_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1779697_1779874_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1779875_1780823_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1780819_1781041_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1781139_1781421_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1781431_1781623_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1781595_1781778_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1781777_1782455_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1782451_1783237_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1783242_1783539_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1783614_1783905_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1784408_1786016_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1786122_1786815_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182877.1|1787178_1787718_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147238.1|1787714_1788734_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_000788902.1|1788730_1789432_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000152742.1|1789636_1789984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|1790736_1791345_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|1791644_1792061_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|1792039_1792441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|1792564_1792666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|1792662_1793118_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|1793117_1793288_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|1793280_1793571_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|1793567_1793930_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1793926_1794067_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1794152_1794587_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1794835_1794988_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142933.1|1795791_1797738_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|1797874_1798054_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1798094_1798340_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|1798417_1798633_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|1798637_1799171_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1799441_1800011_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1800010_1800157_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1800384_1800570_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1800781_1801054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1801086_1801563_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1801559_1803683_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1803679_1803892_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1803891_1805394_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1805338_1807363_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1807450_1807777_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1807769_1808051_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1808053_1808677_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1808689_1809088_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1809095_1809848_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1809861_1810284_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1810310_1810619_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_171878324.1|1810662_1813308_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.3	0.0e+00
WP_000847298.1|1813304_1813634_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|1813633_1814332_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|1814342_1815086_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|1815031_1815661_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514990.1|1815901_1819375_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_000268864.1|1820107_1821421_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_001023455.1|1821422_1821692_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001261937.1|1822059_1822308_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1822822_1824508_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1824504_1825224_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1825270_1825741_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1825782_1826244_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1826368_1828372_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1828368_1829505_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1829497_1830229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1830247_1831777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1831787_1832876_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1834116_1834434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1834495_1838125_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1845082_1847116_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1847247_1848357_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1848618_1848900_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1849191_1849734_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1849821_1850496_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1850511_1852992_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1853002_1854037_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1854118_1854457_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134630.1|1854674_1855520_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1855640_1855913_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1856022_1856337_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1856346_1856694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1857744_1857984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1858317_1859106_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1859102_1859903_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1859967_1860786_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1860837_1861584_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1861557_1862523_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1862519_1863524_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859149.1|1863520_1864798_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1865054_1866107_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1866405_1867260_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1867288_1868551_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1868560_1869013_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1869043_1869328_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1869331_1870687_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1870734_1871775_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1871874_1872654_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1872735_1873635_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1874040_1874358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1874687_1876049_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	1962066	2101797	5542130	tail,lysis,transposase,protease,head,integrase,terminase,capsid,portal,holin	Enterobacteria_phage(32.8%)	161	1958684:1958698	2061870:2061884
1958684:1958698	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1962066_1963245_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1963225_1963417_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1963494_1963839_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1964026_1964377_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289931.1|1965234_1966182_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	99.7	3.0e-182
WP_000763383.1|1966178_1966400_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1966498_1966780_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1966790_1966982_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1966954_1967137_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186807.1|1967133_1967814_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.5e-132
WP_001302855.1|1967810_1968596_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|1968601_1968898_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1968972_1969116_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1969084_1969249_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1969321_1969690_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1969872_1970124_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1970182_1970455_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1970432_1970615_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1971183_1971705_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1972206_1972902_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1972977_1973193_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1973334_1973631_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1973663_1973825_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1973811_1974633_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1974629_1976006_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1976076_1976355_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1976487_1976703_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1976713_1976950_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1976906_1977353_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1977349_1977877_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1977873_1978056_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|1978330_1979089_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_000849633.1|1979344_1980025_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|1980099_1980822_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1980821_1981427_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1981423_1982095_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1982085_1982574_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1983223_1984183_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1984194_1984464_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1984760_1985084_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143087.1|1985327_1987265_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_000143458.1|1987401_1987581_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1987621_1987894_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1987970_1988186_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1988185_1988683_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1988679_1989117_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1989319_1989817_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1989813_1990071_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1990533_1990761_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1990802_1991168_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958365.1|1991460_1992024_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_001301491.1|1992020_1993682_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1993745_1995683_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1995727_1995949_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1995894_1998396_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1998475_1998802_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1998811_1999162_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1999158_1999605_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1999601_1999946_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2000011_2000728_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2000742_2001117_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2001212_2001422_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_171878325.1|2001469_2004712_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.9	0.0e+00
WP_000807954.1|2004704_2005046_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878326.1|2005045_2005744_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	2.5e-133
WP_001302649.1|2005760_2006081_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2006188_2006362_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2006432_2007356_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|2007409_2008147_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|2008092_2008725_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_072608489.1|2008984_2012479_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.6	0.0e+00
WP_000268864.1|2013214_2014528_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_171878337.1|2014502_2014694_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6ETG7	Enterobacteria_phage	96.4	1.3e-23
WP_162829202.1|2014719_2015932_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_069192451.1|2015941_2016112_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	4.2e-18
WP_000491542.1|2016252_2017128_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2017352_2018003_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2019326_2020493_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2020611_2021085_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2021283_2022342_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2022513_2022843_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2022943_2023126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2023614_2023728_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2023740_2023935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2024393_2024762_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2024835_2025057_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2025119_2025596_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2025610_2026090_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2026171_2026993_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2027213_2027624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2027639_2028323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|2028458_2029529_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2029525_2030431_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2030427_2031225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2031288_2032502_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000998048.1|2034576_2036115_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2036164_2036512_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2036508_2036889_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973178.1|2037250_2037796_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2037792_2038536_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_171878327.1|2038547_2039627_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2039688_2040624_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2041080_2041998_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2042099_2043050_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2043167_2044811_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2045436_2046153_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2046495_2047950_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2048051_2049368_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2049681_2050734_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001356620.1|2050995_2058978_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2059467_2060265_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2060500_2061523_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2061522_2061726_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2061784_2064256_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2061870:2061884	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2064351_2064540_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2064536_2064725_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2065205_2065358_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2065632_2066277_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2066374_2066602_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2066598_2067024_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2067092_2068130_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2068041_2068584_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2068618_2069317_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2069338_2069563_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2069559_2069916_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2069948_2070101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2070097_2070409_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2070535_2071099_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2071208_2071313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2071499_2071712_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2071879_2072158_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2072159_2073209_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2073221_2073581_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2073577_2074267_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2074900_2075329_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2075806_2077657_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2077738_2078952_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2079262_2079478_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2079482_2079827_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2079877_2080411_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2080566_2080749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2080761_2080893_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2081120_2081306_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2081832_2082147_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2082228_2082453_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2082847_2083357_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2085241_2085448_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2085444_2087037_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2087026_2088532_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_001301534.1|2088973_2089240_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2089221_2089962_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2089975_2090407_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2090433_2090847_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082466.1|2090827_2093407_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2093403_2093733_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2093732_2094431_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_171878328.1|2094441_2095185_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	1.1e-150
WP_096851774.1|2095130_2095760_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_171878329.1|2096000_2099480_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_000268864.1|2100212_2101526_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_001023455.1|2101527_2101797_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 5
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	2157352	2178651	5542130	tail,integrase,transposase	Enterobacteria_phage(72.0%)	29	2171787:2171800	2181794:2181807
WP_050543672.1|2157352_2158432_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
WP_162829202.1|2158434_2159648_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132765.1|2159752_2160076_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2160233_2161418_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2161417_2161930_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2161984_2162350_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2162358_2162514_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2165316_2165805_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2165961_2166534_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2166577_2167108_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2168199_2168514_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2168518_2169478_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2169554_2172377_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2171787:2171800	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2172383_2172749_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2172745_2173363_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2173374_2173674_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2173670_2173937_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2173933_2174137_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2174160_2174577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2174669_2174783_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2174779_2175022_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2175033_2175312_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2175322_2175673_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2175694_2175898_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2175969_2176107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2176196_2176601_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2176616_2177267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2177296_2177644_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2177649_2178651_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2181794:2181807	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	2499198	2590973	5542130	tail,transposase,protease,head,terminase,capsid,portal,holin	Stx2-converting_phage(33.33%)	98	NA	NA
WP_001260835.1|2499198_2500020_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2500119_2500203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2500295_2500631_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2501027_2502281_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2502387_2503281_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2503415_2504636_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2504760_2505456_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2505408_2506701_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2506858_2507473_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2507515_2508370_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2508371_2508989_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2508999_2511423_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2511483_2513910_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2514108_2514414_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2514521_2515232_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2515234_2515795_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2515829_2516171_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2516305_2516632_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2517620_2517872_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2517944_2520416_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2520508_2520700_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2520696_2520885_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2521285_2521450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2521453_2521672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2521743_2522043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2522395_2522674_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2522675_2522867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2522887_2523259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2523356_2523659_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2523655_2524081_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095668.1|2524103_2525066_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.6	4.8e-82
WP_000788938.1|2525072_2525813_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2526623_2527019_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_001278450.1|2527774_2527879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2528067_2528280_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2528447_2528726_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2528727_2529777_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2529789_2530149_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2530145_2530835_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2531472_2531901_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2532379_2534230_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2534669_2534885_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2534889_2535234_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2535284_2535818_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2536088_2536658_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2536657_2536804_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2537031_2537217_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2537641_2537869_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2537910_2538276_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2538565_2539129_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2539125_2540787_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2540850_2542788_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2542832_2543054_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2542999_2545579_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000126003.1|2545581_2545908_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_001007905.1|2545917_2546268_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2546264_2546711_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2546707_2547052_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2547117_2547834_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2547848_2548223_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2548318_2548528_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|2548575_2551818_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|2551810_2552152_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2552151_2552850_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2552860_2553604_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2553549_2554182_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2554524_2555700_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_137325071.1|2555651_2557997_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.2	0.0e+00
WP_001228304.1|2558064_2558664_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2558815_2560129_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2560130_2560400_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2561426_2562752_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2564349_2564472_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2564578_2565490_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000998048.1|2567089_2568628_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2568677_2569025_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2569021_2569402_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2569741_2570020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2570447_2570594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2570730_2571378_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2571561_2572152_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2573658_2574309_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2575622_2576129_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2576174_2576675_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2576760_2576940_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2577320_2578127_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2578126_2579320_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2579331_2580693_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2580693_2582289_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2582288_2583851_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2583942_2583987_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2584124_2585006_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2585002_2585623_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2585650_2587234_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2587446_2588319_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2588358_2588949_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2588945_2589704_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2589923_2590973_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	2674594	2725944	5542130	tail,tRNA,protease,terminase,portal,holin	Escherichia_phage(39.66%)	63	NA	NA
WP_000628061.1|2674594_2675827_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2676081_2677065_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2677339_2677510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2677542_2678916_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|2679044_2679980_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000040845.1|2680031_2681267_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_000079604.1|2681268_2681484_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|2681583_2681772_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2681764_2681959_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|2682015_2682825_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|2682817_2685487_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000245534.1|2685567_2685744_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000560226.1|2685737_2685959_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|2686005_2686854_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|2687265_2687418_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2687724_2688144_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2688240_2688483_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|2688479_2688902_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|2688979_2689768_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|2689774_2690521_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|2690543_2691305_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|2691320_2691743_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|2691739_2691970_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|2692124_2692775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|2692761_2693883_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|2694005_2694218_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000940305.1|2694777_2695377_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|2695376_2695667_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|2695663_2696206_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_171878330.1|2696907_2698854_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000143458.1|2698990_2699170_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2699210_2699456_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2699533_2699749_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|2699753_2700287_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|2700557_2701127_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2701126_2701273_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2701500_2701686_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|2701897_2702170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2702202_2702679_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|2702675_2704799_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|2704795_2705008_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2705007_2706510_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2706454_2708479_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2708566_2708893_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2708885_2709167_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2709169_2709793_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2709805_2710204_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2710211_2710964_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2710977_2711400_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2711426_2711735_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_171878331.1|2711778_2714424_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.2	0.0e+00
WP_000847298.1|2714420_2714750_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2714749_2715448_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|2715458_2716202_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2716147_2716777_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514990.1|2717017_2720491_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|2720558_2721158_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|2721222_2722545_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|2722546_2722816_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|2722928_2723504_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2723576_2724206_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2724287_2724929_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2725509_2725944_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	2868907	2960936	5542130	tail,lysis,tRNA,transposase,head,integrase,terminase,capsid,portal,holin	Enterobacteria_phage(44.64%)	100	2898965:2898982	2953995:2954012
WP_000998048.1|2868907_2870446_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001083593.1|2871685_2873086_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.5	1.8e-106
WP_071525996.1|2873082_2877114_-	autotransporter barrel domain-containing lipoprotein	NA	NA	NA	NA	NA
WP_000113137.1|2877644_2879237_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|2879315_2880269_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194917.1|2880517_2882053_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911140.1|2882046_2883075_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222737.1|2883074_2884067_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|2884078_2885101_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774161.1|2885127_2886003_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|2886026_2886317_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286577.1|2886373_2887132_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001302151.1|2887135_2888050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|2888246_2889698_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558063.1|2889924_2891343_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191021.1|2891481_2891841_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2891840_2892767_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156618.1|2892830_2894219_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366470.1|2894319_2895201_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258595.1|2895278_2896067_+	putative protein YneK	NA	NA	NA	NA	NA
WP_094364431.1|2896073_2896394_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210801.1|2896544_2897735_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885016.1|2897759_2898425_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|2898636_2899071_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
2898965:2898982	attL	AATGCCATCAATTAGTTG	NA	NA	NA	NA
WP_000091199.1|2899090_2899474_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803524.1|2899505_2899724_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087233.1|2899754_2900654_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054199.1|2900848_2902036_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_001271101.1|2902076_2902472_-	rhodanese	NA	NA	NA	NA	NA
WP_001310251.1|2902566_2903538_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_000901365.1|2903645_2903741_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592852.1|2903959_2904850_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-19
WP_000671724.1|2905104_2905497_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024796.1|2905772_2906291_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001302117.1|2906335_2908381_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636568.1|2908517_2909264_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2909352_2910039_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|2910215_2910419_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2910454_2911915_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2912003_2913287_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2913418_2913661_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2913822_2914464_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2914545_2915175_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2915247_2915823_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2915936_2916206_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268860.1|2916207_2917431_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2917495_2918095_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878332.1|2918162_2921642_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_071601640.1|2921882_2922512_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_087674353.1|2922457_2923201_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	5.6e-147
WP_171878333.1|2923211_2923910_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	3.8e-129
WP_000847298.1|2923909_2924239_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2924235_2926848_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2926828_2927242_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2927268_2927691_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2927704_2928457_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2928464_2928860_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2928856_2929390_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2929404_2929758_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2929769_2930168_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2930209_2931235_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2931290_2931623_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2931632_2932952_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2932932_2934534_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2934530_2934737_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|2934733_2936659_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|2936633_2937179_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|2937567_2937762_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2937926_2938133_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2938418_2938829_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2939120_2939414_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|2939504_2939687_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|2939903_2940380_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|2940366_2940672_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|2940993_2941683_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|2941679_2941820_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|2941816_2942179_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|2942175_2942466_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2942458_2942629_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|2942628_2943084_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|2943585_2945112_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|2945169_2945292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|2945356_2945689_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2945756_2946059_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|2946055_2946757_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|2947681_2947918_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|2947907_2949050_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|2949163_2950414_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|2950585_2951239_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2951248_2951710_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|2951763_2952870_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|2952905_2953547_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2953550_2954921_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
2953995:2954012	attR	CAACTAATTGATGGCATT	NA	NA	NA	NA
WP_001265474.1|2955089_2955761_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|2955760_2957221_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2957821_2958103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2958358_2958901_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|2959106_2959520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|2959532_2959868_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|2959880_2960936_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 9
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	2967028	3023760	5542130	tail,transposase,head,integrase,terminase,capsid,portal,holin	Stx2-converting_phage(36.96%)	64	2966892:2966906	3023749:3023763
2966892:2966906	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|2967028_2968258_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|2968506_2969628_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2969676_2970903_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2971152_2972289_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|2972272_2973136_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|2973499_2974861_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|2974921_2975197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|2977505_2980907_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001356663.1|2981497_2983846_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2983865_2983955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|2983967_2984204_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|2984149_2984887_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|2984940_2985819_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|2986121_2986232_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|2986341_2986596_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179479.1|2986612_2987311_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.0e-130
WP_000807950.1|2987310_2987652_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212814.1|2987644_2990725_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.6	0.0e+00
WP_001453746.1|2990772_2990982_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2991077_2991452_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2991466_2992183_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2992248_2992593_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2992589_2993036_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2993032_2993383_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000126003.1|2993392_2993719_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_000267295.1|2993721_2996301_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2996246_2996468_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2996512_2998450_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2998513_3000175_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|3000171_3000735_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000279786.1|3001024_3001390_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3001431_3001659_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3002083_3002269_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3002496_3002643_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3002642_3003212_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_171878338.1|3003482_3003632_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.6e-13
WP_162829202.1|3003628_3004842_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000731259.1|3005379_3005724_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3005728_3005944_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3006093_3007947_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3008743_3009802_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3009952_3010150_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3010391_3010922_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3010930_3011290_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3011302_3012349_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3012350_3012629_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3012698_3012956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3013176_3013389_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3013667_3014426_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3015124_3015289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3015285_3015867_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3016053_3016596_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3016507_3017548_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3017519_3018071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3018054_3018282_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3018358_3018766_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3019029_3019329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3019401_3019620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3019642_3020050_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3020027_3020261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3020254_3020422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3020819_3021008_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3021004_3021196_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3021288_3023760_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
3023749:3023763	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 10
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	3071877	3224220	5542130	tail,tRNA,transposase,protease,head,integrase,terminase,capsid,portal,holin	Escherichia_phage(29.75%)	177	3209787:3209807	3230877:3230897
WP_001299679.1|3071877_3073134_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3073347_3073971_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3073970_3074822_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3074972_3075920_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3076044_3077724_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3077778_3078057_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3078334_3078919_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3079035_3080127_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3082948_3084019_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3084029_3084662_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3084672_3086091_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3088122_3088323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3088430_3089453_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3089452_3090433_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3090429_3091188_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3092006_3092861_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3092886_3094857_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3094906_3095161_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001295616.1|3096093_3096705_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3096804_3097719_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3097814_3099551_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3099708_3100922_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3101259_3102330_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3102339_3103638_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3104000_3105533_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3105584_3106304_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3106525_3108067_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3108212_3108743_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3108788_3110057_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3110056_3110476_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3110848_3111760_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3111966_3112428_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3112504_3113164_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3113235_3113529_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3113540_3113699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3113769_3114171_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3114273_3114642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3115161_3115857_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3115880_3116693_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3116696_3116963_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3118128_3119342_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3119515_3120100_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3120598_3121552_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3121738_3123223_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3123525_3125064_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3125113_3125461_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3125457_3125838_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3125913_3126162_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3126218_3126887_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3127384_3127567_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3127645_3128146_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3128182_3128689_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3128707_3129598_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3129717_3130299_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000268883.1|3130298_3133214_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3133278_3133878_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3133944_3137343_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3137403_3138036_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3137972_3138716_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3138721_3139420_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847334.1|3139419_3139749_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	6.2e-58
WP_000840323.1|3139745_3142295_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3142287_3142722_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3142703_3143126_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3143141_3143882_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3143889_3144285_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3144281_3144860_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3144871_3145225_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3145236_3145635_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3145676_3146702_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3146757_3147090_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123253.1|3147099_3148419_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.2e-231
WP_001301524.1|3148399_3150001_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3149997_3150204_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|3150200_3152126_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3152100_3152646_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3153032_3153257_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3153338_3153653_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3154178_3154364_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3154586_3154733_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3154732_3155302_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3155573_3156107_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_137330385.1|3156157_3156502_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	2.2e-58
WP_024180155.1|3156506_3156722_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|3157160_3159011_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3159488_3159920_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3160370_3161084_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3161219_3161417_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3161641_3162196_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3162258_3162564_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3162576_3163626_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3163627_3163900_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3164021_3164366_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3164485_3164698_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3164931_3165489_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3165490_3165709_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3165836_3166148_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3166140_3166368_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3166364_3166646_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3166678_3167395_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3167428_3167890_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000693878.1|3169004_3169430_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3169413_3169656_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3170047_3170386_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3170678_3170831_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3170842_3171481_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3171481_3171691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3172255_3172444_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3172440_3172629_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3172721_3173966_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3174676_3174919_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3175881_3176262_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3176258_3176606_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3176655_3178194_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121229.1|3178776_3179427_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	2.1e-121
WP_001131642.1|3180137_3180713_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3180826_3181096_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|3181097_3182321_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230509.1|3182385_3182985_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_001304111.1|3183052_3183268_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001356568.1|3183270_3186531_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001152128.1|3186718_3187156_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|3187155_3187497_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3187489_3190732_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3190779_3190989_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3191084_3191459_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3191473_3192190_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3192255_3192600_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3192596_3193043_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3193039_3193390_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000126003.1|3193399_3193726_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_000267295.1|3193728_3196308_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3196253_3196475_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3196519_3198457_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3198520_3200182_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3200178_3200742_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3201031_3201397_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3201438_3201624_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3201753_3201894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3202250_3202475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3202539_3202746_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3202973_3203120_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3203119_3203689_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3203959_3204493_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3204543_3204888_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3204892_3205108_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001289717.1|3205183_3205453_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3205490_3205673_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3205820_3207758_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3208072_3208240_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3208836_3209658_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3209654_3210029_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3209787:3209807	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265167.1|3210041_3211091_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_001341388.1|3211092_3211371_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3211538_3211751_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3211939_3212044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3212159_3212747_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3212749_3212941_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3212942_3213380_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3213366_3213684_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3213637_3213955_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3213944_3214247_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3214243_3214525_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3214557_3215274_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3215307_3215850_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3215761_3216799_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3216867_3217293_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3217276_3217600_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3217724_3218201_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3218516_3218669_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3218783_3219299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3219431_3219821_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3219882_3220152_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3220120_3221239_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3221405_3222200_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3222196_3223243_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3223398_3224220_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3230877:3230897	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	3329706	3387250	5542130	protease,transposase	Escherichia_phage(27.78%)	56	NA	NA
WP_162829242.1|3329706_3330919_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001287881.1|3331513_3331705_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3331757_3331991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3332086_3332710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3332798_3333308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3333765_3334224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3335577_3336702_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3337431_3337629_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3337694_3337910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3338269_3338458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3338554_3338734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3338785_3338980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3339760_3340096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3340728_3340947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3342399_3344490_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3345003_3345390_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3345812_3346388_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3346456_3347035_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3347083_3348124_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3348146_3348602_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3348624_3349782_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3349781_3350363_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3350685_3351744_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3351753_3352896_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3352888_3353662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3353663_3354743_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3354742_3355699_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3355709_3356918_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3356935_3357403_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3357663_3357993_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3357979_3358321_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3359263_3360877_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3360907_3361258_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3361254_3361680_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3364017_3364689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3365560_3365701_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3366002_3366266_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3367477_3368095_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3368106_3368781_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3368781_3369246_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3369255_3370959_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3370951_3371272_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3371280_3371583_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3371673_3372372_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3372752_3373028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591988.1|3373252_3374872_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3374964_3375324_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_162829202.1|3376505_3377718_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_028913479.1|3377935_3378541_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3379932_3380313_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3380309_3380657_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3380706_3382245_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000136079.1|3382663_3382840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3383001_3385362_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_001453921.1|3385516_3385903_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_162829202.1|3386037_3387250_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 12
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	3487300	3542690	5542130	tail,transposase,protease,head,integrase,capsid,portal,holin	Escherichia_phage(29.27%)	60	3489235:3489250	3544455:3544470
WP_000003653.1|3487300_3487888_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3487884_3488592_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3488610_3490404_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3489235:3489250	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3490400_3491519_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3493792_3494062_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3494063_3495377_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230371.1|3495441_3496041_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	5.5e-105
WP_000515110.1|3496108_3499582_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3499715_3500243_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3500433_3501066_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3501011_3501755_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151108.1|3501765_3502464_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.2e-130
WP_000847298.1|3502463_3502793_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082466.1|3502789_3505369_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3505349_3505763_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3505789_3506221_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3506234_3506975_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3506956_3507223_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001254002.1|3507664_3509170_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3509159_3510752_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3510748_3510955_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3513131_3514670_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3514719_3515067_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3515063_3515444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3515519_3515795_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3516545_3516752_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3517007_3517280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3517439_3517973_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3518193_3518307_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3518528_3518714_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3519241_3519556_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3520912_3522763_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3523530_3524244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3524864_3525683_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3525834_3526206_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3526195_3526567_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3526579_3527629_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3527630_3527909_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3528076_3528232_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3528333_3528471_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3528836_3529610_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3529961_3530375_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3530390_3531161_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3531182_3531929_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3531935_3533027_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3533105_3533561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3533767_3534193_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3534176_3534449_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3534557_3534959_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3534986_3535178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3535177_3535465_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3535742_3535898_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3536039_3536429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3536615_3536801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3537374_3537563_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3537559_3537751_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3537844_3540316_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3540383_3540626_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3540603_3541623_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3542030_3542690_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3544455:3544470	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	3830725	3868822	5542130	tail,lysis,protease,integrase,terminase,portal,holin	Enterobacteria_phage(51.16%)	50	3830310:3830324	3868896:3868910
3830310:3830324	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3830725_3831424_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3831654_3832536_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3832705_3832867_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3833363_3834383_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3834416_3835397_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3835573_3835843_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741876.1|3835844_3837161_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.4	7.7e-67
WP_001233141.1|3837220_3837820_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3837890_3841304_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3841364_3841973_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3841909_3842653_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3842658_3843357_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3843366_3843696_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3843695_3846761_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3846732_3847062_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3847070_3847457_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3847517_3848261_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3848271_3848673_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3848669_3849248_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3849259_3849535_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3849527_3849851_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136595.1|3849937_3851965_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3851909_3852245_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3852366_3853491_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3853418_3853631_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3853627_3855730_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3855729_3856221_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3856895_3857048_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3857035_3857503_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3857499_3857997_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3857996_3858212_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3858354_3858753_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3858833_3858992_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3859077_3859821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3860004_3860694_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3860708_3860831_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3861168_3862128_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3862339_3863005_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3863001_3863622_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3863614_3863785_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3863781_3863964_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3864661_3865342_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3865338_3865521_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3865493_3865685_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3865695_3865977_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3866075_3866297_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3866507_3867110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3867352_3867520_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3867559_3867778_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3868051_3868822_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3868896:3868910	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	4411762	4491001	5542130	tail,lysis,transposase,protease,head,plate,integrase,terminase,capsid,portal,holin	Shigella_phage(43.33%)	95	4448879:4448925	4487099:4487145
WP_000998048.1|4411762_4413301_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4413350_4413698_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4413694_4414075_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4414338_4414602_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4414601_4414742_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4414811_4415003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4415827_4416370_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4416444_4417032_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4417089_4417758_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131062.1|4417783_4420309_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4420298_4421942_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4421910_4422621_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4422933_4423263_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4423510_4424125_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4424542_4425232_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4425228_4426185_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667049.1|4426181_4428380_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.9	2.7e-40
WP_000121344.1|4428389_4429346_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4429524_4430652_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4430793_4431852_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4432097_4433000_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4433702_4433981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4434147_4434870_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4434968_4435868_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4436543_4437500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4437632_4439966_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4439979_4440303_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4440302_4440524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4440520_4441078_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4441074_4441335_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4442268_4443021_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4443017_4443569_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4443574_4443847_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4444256_4444823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4444822_4445413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4445443_4446076_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4446068_4446527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4446526_4447144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4447535_4448717_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4448879:4448925	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4449679_4450423_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4451247_4452021_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4452081_4452636_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4452666_4453185_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4453184_4453787_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4453758_4454202_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4454222_4454618_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4454888_4455473_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4455463_4456522_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4456508_4456934_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4456933_4457482_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4457481_4458561_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4458557_4459886_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4459946_4461782_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4461923_4462193_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4462192_4462549_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155726.1|4462548_4464045_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	4.2e-271
WP_000497751.1|4464028_4464199_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4464207_4464768_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4464764_4465271_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4465245_4465656_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4465652_4465976_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4466054_4467284_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4467294_4467897_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4467889_4469116_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4469105_4469267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4469263_4470760_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4470993_4471488_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135207.1|4471613_4471964_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4472489_4472783_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4472873_4473056_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4473269_4473746_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4473749_4474085_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4474221_4474515_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4474793_4475027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4475170_4475710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4475924_4476677_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4476690_4477680_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4477687_4478497_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4478516_4478906_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|4478902_4479229_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001303054.1|4479225_4479879_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072131649.1|4479878_4480373_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104949.1|4480369_4481311_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4481300_4481480_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4481655_4482207_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4482199_4482460_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4482557_4483250_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4483527_4483824_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4484500_4485037_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4485027_4485390_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4485389_4485695_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4485921_4487085_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4487289_4488543_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4487099:4487145	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4488554_4489658_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4489945_4491001_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	4509787	4574035	5542130	plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	52	NA	NA
WP_000027432.1|4509787_4510960_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4511040_4511226_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4511140_4511404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4511605_4513366_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4513368_4514505_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001475373.1|4515251_4515773_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4515841_4517350_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_001456283.1|4517531_4518248_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000103125.1|4522695_4524837_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4525046_4525565_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4526260_4526761_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4526795_4527020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4527070_4528462_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4528552_4528966_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393849.1|4528969_4530820_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4530783_4531866_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4531890_4533171_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080155.1|4533167_4533692_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4533694_4535026_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4535030_4535792_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614377.1|4535800_4538584_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000088854.1|4538580_4539324_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001303798.1|4540876_4544311_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4544321_4545731_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4545696_4546176_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4546196_4546418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4546496_4547093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4547095_4547545_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4548022_4548823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4549360_4550092_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4550156_4550624_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4550620_4551343_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4551376_4552132_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4552203_4553562_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4553609_4554380_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4554457_4555258_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4555498_4556413_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4556409_4557213_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4562970_4563546_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4563733_4564765_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4564757_4565411_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4565450_4566266_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4566383_4566788_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4566784_4567492_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4567602_4569321_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4569373_4570198_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4570397_4571108_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4571121_4571532_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4571528_4572074_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4572239_4572440_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4572426_4572687_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4572739_4574035_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP038414	Escherichia coli O157:H7 strain 17B6-2 chromosome, complete genome	5542130	5169251	5185228	5542130	tail,integrase,tRNA,transposase	Enterobacteria_phage(41.18%)	20	5165092:5165107	5183933:5183948
5165092:5165107	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5169251_5170667_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5170749_5171733_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5171898_5172141_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5172274_5173312_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5173400_5174498_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5174559_5174808_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5174968_5175610_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5175691_5176321_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5176393_5176966_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5177077_5177347_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5177348_5178662_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5178726_5179326_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_148717698.1|5179393_5179906_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.2	1.7e-91
WP_162829202.1|5180790_5182003_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001242740.1|5182486_5182837_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5182833_5183118_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5183453_5183651_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5183995_5184277_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5183933:5183948	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5184324_5184498_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5184694_5185228_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
