The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	1250169	1342284	5485363	tRNA,tail,holin,terminase,capsid,integrase,protease,head	Stx2-converting_phage(32.86%)	103	1243808:1243823	1305569:1305584
1243808:1243823	attL	AATCAACTTATTGGTA	NA	NA	NA	NA
WP_000448924.1|1250169_1250586_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	98.6	1.1e-70
WP_001358980.1|1250624_1251854_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	4.9e-233
WP_000101041.1|1252144_1253068_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	87.4	6.9e-155
WP_000516609.1|1253560_1254745_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	87.4	3.4e-199
WP_001030150.1|1254917_1255064_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	89.6	1.6e-21
WP_000457735.1|1255067_1255310_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_000628781.1|1255397_1255901_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.6	4.7e-57
WP_001290004.1|1255897_1256716_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	57.9	6.7e-61
WP_000774248.1|1256712_1256934_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_013009268.1|1257032_1257314_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	97.8	4.6e-46
WP_000548523.1|1257324_1257516_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	1.8e-25
WP_000682317.1|1257488_1257671_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.8e-28
WP_000186825.1|1257667_1258348_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.3e-131
WP_000100845.1|1258344_1259130_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|1259135_1259432_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372923.1|1259507_1259651_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198854.1|1259619_1259784_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	4.0e-26
WP_000065374.1|1259856_1260225_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000392425.1|1260420_1260870_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000088205.1|1261154_1261427_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_100207026.1|1261404_1261536_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	95.3	2.1e-17
WP_000708836.1|1261869_1262727_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_096246228.1|1262854_1263550_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|1263623_1263839_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438489.1|1263980_1264277_+	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_000185493.1|1264309_1265209_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	9.3e-173
WP_000788871.1|1265205_1265907_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000145931.1|1265903_1266194_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1266267_1266708_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|1266704_1266887_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|1266883_1267054_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001108059.1|1267046_1267667_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_001028854.1|1267663_1268329_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001302581.1|1269200_1269944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1270029_1270197_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_112077126.1|1270604_1272458_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|1272607_1272823_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1272827_1273172_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992092.1|1273222_1273756_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_001056806.1|1274026_1274596_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1274595_1274742_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1274969_1275155_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1275579_1275807_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1275848_1276214_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|1276500_1277064_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1277060_1278722_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171877886.1|1278785_1280723_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.4	0.0e+00
WP_001063103.1|1280767_1280989_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	2.3e-32
WP_000125988.1|1283677_1284004_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1284013_1284364_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1284360_1284807_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1284803_1285148_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|1285215_1285932_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030063.1|1285937_1286312_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1286407_1286617_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212829.1|1286668_1289911_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	100.0	0.0e+00
WP_000807954.1|1289903_1290245_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_054485130.1|1291441_1292320_+	antirepressor	NA	I6R977	Salmonella_phage	76.8	3.5e-92
WP_001303040.1|1292373_1293111_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_123010591.1|1293056_1293686_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.3	1.3e-96
WP_171877887.1|1293926_1297403_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.3	0.0e+00
WP_001230428.1|1297469_1298069_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_024183342.1|1298133_1299447_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.5	6.9e-76
WP_001023396.1|1299448_1299718_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1299878_1300301_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1300430_1301489_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1301567_1302218_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1302400_1302991_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1303492_1303741_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1304586_1305069_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1305200_1305677_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
1305569:1305584	attR	TACCAATAAGTTGATT	NA	NA	NA	NA
WP_001117838.1|1305666_1305957_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1306018_1306360_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880923.1|1306508_1308170_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1308255_1309134_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1309256_1309850_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077626229.1|1309904_1311191_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1311212_1312004_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1312170_1313532_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1313668_1313917_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1313935_1314484_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1314514_1315282_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1315323_1315671_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1315747_1316230_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969027.1|1316245_1317472_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1317461_1317980_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001301878.1|1318129_1318495_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168032.1|1318704_1319775_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_000225204.1|1319785_1320907_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1320949_1322110_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1322208_1322256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1322359_1322701_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1322971_1323709_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079092.1|1323843_1324824_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040152.1|1324820_1325552_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1325681_1328255_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852126.1|1334028_1335327_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001322343.1|1335323_1335647_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1335692_1337048_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082974.1|1337161_1339822_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|1339853_1340552_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1340620_1341040_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1341246_1342284_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	1583894	1589320	5485363	integrase	Enterobacteria_phage(50.0%)	6	1572883:1572899	1591516:1591532
1572883:1572899	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1583894_1584464_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1584463_1584931_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1584917_1585598_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1585607_1586744_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1586918_1588076_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1588387_1589320_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1591516:1591532	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	1833716	1843162	5485363		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1833716_1834643_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1834647_1835379_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1835359_1835467_-	protein YohO	NA	NA	NA	NA	NA
WP_001240409.1|1835526_1836258_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_001358946.1|1836479_1838165_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1838161_1838881_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1838927_1839398_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1839439_1839901_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1840025_1842029_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1842025_1843162_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 4
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	2000272	2079205	5485363	tail,holin,terminase,capsid,transposase,integrase,portal,protease,head	Escherichia_phage(36.17%)	75	1987967:1987983	2033000:2033016
1987967:1987983	attL	CAGGTATTCACTGATAT	NA	NA	NA	NA
WP_001254932.1|2000272_2001424_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000502860.1|2002165_2002804_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_000966626.1|2003174_2005322_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|2006993_2007539_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2007535_2008279_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2008290_2009370_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2009431_2010367_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2010823_2011741_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2011842_2012793_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122995687.1|2012910_2014554_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2015179_2015896_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2016238_2017693_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2017794_2019111_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2019425_2020478_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2029212_2030010_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533610.1|2030245_2031271_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	3.2e-100
WP_000094838.1|2031270_2031474_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034453.1|2031532_2034004_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2033000:2033016	attR	CAGGTATTCACTGATAT	NA	NA	NA	NA
WP_000199485.1|2034099_2034288_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2034284_2034473_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2034953_2035106_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|2035380_2036025_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2036122_2036350_+	cell division protein	NA	NA	NA	NA	NA
WP_000693818.1|2036346_2036772_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|2036840_2037878_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|2037909_2038332_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2038366_2039065_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2039086_2039311_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2039307_2039664_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2039696_2039849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|2039845_2040157_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137955.1|2040283_2040847_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2040956_2041061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2041247_2041460_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2041627_2041906_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2041907_2042957_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2042969_2043329_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059362.1|2043325_2044015_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	7.6e-58
WP_000023279.1|2045555_2047040_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	77.4	3.0e-269
WP_024165672.1|2047332_2047548_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|2047552_2047897_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992126.1|2047947_2048481_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2048636_2048819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2048831_2048963_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2049190_2049376_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2049902_2050217_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444498.1|2050298_2050523_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_000235444.1|2050924_2051434_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.2e-12
WP_171877888.1|2051405_2053334_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.7e-261
WP_000259002.1|2053317_2053524_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001374583.1|2053520_2055113_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_001253987.1|2055102_2056608_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256726.1|2056644_2056992_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522579.1|2057049_2058078_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.5e-115
WP_000201524.1|2058129_2058504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|2058496_2058850_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975047.1|2058865_2059399_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.5e-56
WP_000683079.1|2059395_2059791_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2059798_2060551_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479117.1|2060564_2060996_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2061022_2061436_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082428.1|2061416_2063996_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000847304.1|2063992_2064322_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001152185.1|2064321_2065020_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000194760.1|2065030_2065774_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_151310946.1|2065719_2066352_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.7e-104
WP_000649829.1|2066542_2067070_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001230428.1|2070745_2071345_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268963.1|2071409_2072723_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	3.7e-77
WP_001023990.1|2072724_2072994_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	97.8	1.7e-45
WP_052912734.1|2073118_2073871_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001301613.1|2074986_2076105_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2076101_2077895_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2077913_2078621_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2078617_2079205_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	2257672	2434103	5485363	tRNA,tail,holin,terminase,capsid,integrase,portal,transposase,lysis,protease,head	Enterobacteria_phage(31.95%)	218	2376190:2376205	2410192:2410207
WP_000074985.1|2257672_2258791_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2258759_2259029_-	excisionase	NA	NA	NA	NA	NA
WP_000048539.1|2259090_2261562_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|2261654_2261846_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2261842_2262031_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000559928.1|2262572_2263088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2263202_2263355_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2263670_2264147_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2264271_2264595_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|2264578_2265004_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001414697.1|2265072_2266110_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	80.0	5.1e-90
WP_072143019.1|2266021_2266564_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451011.1|2266597_2267314_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.8e-71
WP_072141965.1|2267346_2267628_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	3.6e-30
WP_072141964.1|2267624_2267927_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	6.5e-46
WP_001017965.1|2267916_2268234_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2268187_2268505_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2268491_2268929_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2268930_2269122_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2269124_2269712_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278453.1|2269827_2269932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2270120_2270333_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2270500_2270779_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265167.1|2270780_2271830_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_001217410.1|2271842_2272217_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762928.1|2272213_2273035_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000216629.1|2273631_2273799_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2274113_2276051_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2276198_2276381_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2276418_2276688_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284515.1|2276763_2276979_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000731241.1|2276983_2277328_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992092.1|2277378_2277912_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_001056806.1|2278182_2278752_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2278751_2278898_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2279125_2279332_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2279396_2279621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2279977_2280118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2280247_2280433_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279786.1|2280474_2280840_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958366.1|2281129_2281693_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_096911981.1|2281689_2283351_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.4	0.0e+00
WP_113560761.1|2283414_2285340_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	96.7	0.0e+00
WP_001063108.1|2285384_2285606_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	5.1e-32
WP_171877889.1|2285551_2287813_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	82.8	0.0e+00
WP_000125990.1|2287809_2288136_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2288145_2288496_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2288492_2288939_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133391.1|2288935_2289280_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275508.1|2289338_2290055_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2290060_2290435_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_122993099.1|2290530_2290740_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000807954.1|2294015_2294357_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152180.1|2294356_2294794_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_171877890.1|2294982_2298459_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	88.7	0.0e+00
WP_001228242.1|2298526_2299126_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	6.3e-101
WP_000268812.1|2299190_2300399_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	93.4	1.9e-75
WP_001023414.1|2300400_2300670_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_001131642.1|2300783_2301359_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2302069_2302720_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000343700.1|2302869_2304078_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001120551.1|2304127_2304370_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001206149.1|2304547_2305843_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|2305862_2306114_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000102122.1|2306186_2308649_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|2308741_2308930_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2308926_2309115_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133035.1|2309679_2309889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2309889_2310528_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2310539_2310692_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2310984_2311323_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2311714_2311957_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2311940_2312366_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2312434_2313478_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_072130322.1|2313389_2313932_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450627.1|2313965_2314682_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2314714_2314996_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2314992_2315220_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2315212_2315524_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2315651_2315870_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2315871_2316429_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2316662_2316875_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2316994_2317339_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2317460_2317733_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2317734_2318784_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|2318796_2319156_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|2319164_2319719_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2319943_2320141_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2320277_2320991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001358977.1|2321441_2321873_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.9	8.7e-68
WP_171877891.1|2322351_2324202_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024164617.1|2324640_2324856_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731241.1|2324860_2325205_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992092.1|2325255_2325789_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_001056806.1|2326059_2326629_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2326628_2326775_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2327002_2327188_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2327612_2327840_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2327881_2328247_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958422.1|2328538_2329102_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_171877892.1|2329098_2330778_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	96.8	0.0e+00
WP_053905489.1|2330841_2332767_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	97.2	0.0e+00
WP_001063099.1|2332811_2333033_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171877893.1|2332978_2335558_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|2335560_2335887_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2335896_2336247_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2336243_2336690_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2336686_2337031_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2337096_2337813_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2337827_2338202_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|2338297_2338507_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807954.1|2341786_2342128_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001358317.1|2342127_2342826_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000170104.1|2342842_2343097_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000410309.1|2343206_2343359_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_053902141.1|2343622_2344501_+	antirepressor	NA	I6R977	Salmonella_phage	76.3	2.1e-92
WP_069198099.1|2344554_2345292_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	99.2	4.5e-149
WP_122995769.1|2345237_2345867_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	2.1e-102
WP_171877894.1|2346107_2349584_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.6	0.0e+00
WP_001230444.1|2349650_2350250_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_001454396.1|2350314_2351628_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.1e-76
WP_001023356.1|2351629_2351899_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|2352005_2352095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2352114_2354463_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001303921.1|2360763_2361039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2361099_2362461_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799400.1|2362824_2363688_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2363671_2364808_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2365057_2366284_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2366332_2367454_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|2367703_2368933_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2369297_2369486_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2370290_2370488_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2370480_2370693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2370682_2371147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2371139_2371373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770173.1|2371378_2371678_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833529.1|2371674_2373075_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|2373275_2373527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|2373523_2373934_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2373944_2374217_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2374343_2374568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2374819_2375026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2375025_2376081_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2376093_2376429_+|head	head decoration protein	head	NA	NA	NA	NA
2376190:2376205	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224606.1|2376441_2376855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2377060_2377603_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2377858_2378140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2378741_2380202_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2380201_2380873_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2381041_2382412_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2382415_2383057_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2383092_2384199_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2384252_2384714_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2384723_2385377_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2385548_2386799_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741342.1|2386912_2388055_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	99.7	1.8e-205
WP_000088653.1|2388044_2388281_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|2388420_2388660_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763385.1|2388707_2388926_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|2389024_2389306_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548522.1|2389316_2389508_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_000149538.1|2389480_2389663_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000186792.1|2389659_2390340_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_001414600.1|2390336_2391122_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	5.3e-148
WP_000995400.1|2391127_2391424_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	2.6e-47
WP_000233576.1|2391499_2391706_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|2392306_2392996_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|2393100_2393331_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|2393400_2393940_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147891.1|2393936_2394956_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_000788869.1|2394952_2395654_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2395650_2395953_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2396020_2396353_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2396417_2396540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2396597_2398124_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2398625_2399081_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2399080_2399251_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2399243_2399534_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2399530_2399893_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2399889_2400030_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2400026_2400716_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2401037_2401343_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2401329_2401806_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_001228695.1|2402022_2402205_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738495.1|2402295_2402589_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2402880_2403291_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2403576_2403783_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2403947_2404142_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2404530_2405076_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027311.1|2405050_2406976_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|2406972_2407179_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000123330.1|2408757_2410077_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	5.3e-233
WP_001295978.1|2410086_2410419_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2410192:2410207	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063276.1|2410474_2411500_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158906.1|2411541_2411940_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2411951_2412305_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2412316_2412895_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2412891_2413287_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2413294_2414035_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2414050_2414473_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2414454_2414889_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2414881_2417431_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2417427_2417757_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2417756_2418455_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_001317470.1|2418460_2419204_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_077630658.1|2419101_2419749_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	5.6e-111
WP_171877895.1|2419808_2423207_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_001230336.1|2423273_2423873_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_024217611.1|2423937_2426853_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2426852_2427434_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488334.1|2427553_2428444_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2428462_2428969_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2429005_2429506_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2429584_2429767_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2430264_2430933_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226373.1|2431478_2432963_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2433149_2434103_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 6
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	2547209	2620768	5485363	tail,holin,terminase,capsid,integrase,portal,protease,head	Stx2-converting_phage(29.41%)	81	2547046:2547073	2605240:2605267
2547046:2547073	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2547209_2548340_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2548317_2548566_-	excisionase	NA	NA	NA	NA	NA
WP_000048414.1|2548630_2551102_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2551194_2551386_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2551382_2551571_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2551968_2552136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2552129_2552363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2552340_2552748_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2552770_2552989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2553061_2553361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2553624_2554032_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2554108_2554336_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|2554319_2554871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|2555793_2556336_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2556523_2557105_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2557101_2557266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2557964_2558723_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2559001_2559214_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2559434_2559692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2559761_2560040_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_024183341.1|2560041_2561088_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2561100_2561460_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2561468_2561999_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2562240_2562438_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935547.1|2562588_2563647_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.6	4.7e-200
WP_171877896.1|2564443_2566297_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|2566446_2566662_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|2566666_2567011_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992125.1|2567061_2567595_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.2	2.4e-99
WP_001056806.1|2567865_2568435_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2568434_2568581_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2568808_2569015_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2569079_2569304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2569660_2569801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2569930_2570116_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279786.1|2570157_2570523_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958366.1|2570812_2571376_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_171877897.1|2571372_2573034_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000173031.1|2573097_2575035_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|2575079_2575301_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171877898.1|2575246_2577748_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.6	0.0e+00
WP_000125976.1|2577827_2578154_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	1.7e-52
WP_001007905.1|2578163_2578514_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2578510_2578957_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2578953_2579298_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275505.1|2579364_2580081_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001030047.1|2580086_2580461_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453746.1|2580556_2580766_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000807954.1|2584041_2584383_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072619016.1|2584382_2585081_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194761.1|2585091_2585835_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.0e-148
WP_050439450.1|2585780_2586413_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_171877899.1|2586755_2590229_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_001228290.1|2590296_2590896_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_171877900.1|2591047_2592361_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001023414.1|2592362_2592632_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_001025672.1|2593659_2594985_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2596581_2596704_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2596810_2597722_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2597787_2598357_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2599524_2599803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2600230_2600377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2600513_2601161_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2601344_2601935_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2603441_2604092_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2605417_2605924_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2605240:2605267	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2605969_2606470_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2606555_2606735_-	general stress protein	NA	NA	NA	NA	NA
WP_000443070.1|2607115_2607922_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2607921_2609115_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2609126_2610488_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2610488_2612084_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2612083_2613646_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2613737_2613782_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2613919_2614801_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2614797_2615418_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001359112.1|2615445_2617029_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2617241_2618114_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278896.1|2618153_2618744_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2618740_2619499_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2619718_2620768_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	2704391	2758246	5485363	tRNA,tail,holin,terminase,capsid,head	Escherichia_phage(34.48%)	61	NA	NA
WP_000628061.1|2704391_2705624_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2705878_2706862_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2707136_2707307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123747.1|2707339_2708713_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2708841_2709777_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2709828_2711064_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2711065_2711281_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2711359_2711569_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2711561_2711756_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595430.1|2711812_2712622_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000105108.1|2712614_2715290_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	81.2	0.0e+00
WP_000245528.1|2715742_2715919_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560227.1|2715912_2716134_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_000379547.1|2716542_2716695_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2717001_2717421_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2717517_2717760_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|2717756_2718179_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001359125.1|2718256_2719045_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_000789007.1|2719051_2719792_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	84.6	1.4e-118
WP_000450849.1|2719817_2720588_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.1e-84
WP_001141093.1|2720603_2720996_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_000206794.1|2721052_2721637_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278447.1|2721752_2721857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2722045_2722258_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000940343.1|2722817_2723417_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000228025.1|2723416_2723707_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2723703_2724258_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2724818_2725250_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_171877901.1|2725820_2727671_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024164617.1|2728109_2728325_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731241.1|2728329_2728674_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992092.1|2728724_2729258_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_001056806.1|2729528_2730098_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2730097_2730244_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2730471_2730657_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2731081_2731309_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2731350_2731716_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958422.1|2732008_2732572_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_171877902.1|2732568_2734239_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_126446139.1|2734302_2736240_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_069197361.1|2736284_2736506_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	94.5	2.7e-33
WP_000125976.1|2738869_2739196_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	1.7e-52
WP_001007905.1|2739205_2739556_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2739552_2739999_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2739995_2740340_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275505.1|2740406_2741123_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001030047.1|2741128_2741503_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453746.1|2741598_2741808_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000807954.1|2745083_2745425_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072619016.1|2745424_2746123_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_001432971.1|2746133_2746877_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.1e-147
WP_171877913.1|2746822_2747452_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	8.1e-99
WP_171877903.1|2747692_2751169_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_001230445.1|2751235_2751835_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_171877904.1|2751899_2753213_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	1.1e-78
WP_001023994.1|2753214_2753484_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_001131657.1|2753596_2754172_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_072179253.1|2754244_2754874_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	2.3e-77
WP_001143784.1|2754955_2755597_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2756537_2756972_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837949.1|2757112_2758246_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	3.1e-117
>prophage 8
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	2939583	2996409	5485363	tail,terminase,transposase,portal,lysis,protease	Enterobacteria_phage(44.9%)	71	NA	NA
WP_000527769.1|2939583_2941044_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347489.1|2941132_2942416_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2943019_2943133_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2943201_2943435_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2943751_2944342_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885621.1|2944439_2945015_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.0e-100
WP_000279100.1|2945014_2948368_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001230388.1|2948432_2949032_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_171877905.1|2949098_2952497_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.6	0.0e+00
WP_001359078.1|2952556_2953204_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	1.4e-109
WP_000194779.1|2953101_2953845_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000884310.1|2953850_2954549_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	6.2e-132
WP_000447253.1|2954558_2954888_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372026.1|2954887_2957953_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2957924_2958254_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2958262_2958649_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2958709_2959453_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2959463_2959865_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677093.1|2959861_2960440_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	2.1e-101
WP_001283154.1|2960451_2960727_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_001097039.1|2960719_2961043_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|2961129_2963157_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|2963101_2964610_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|2964609_2964822_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934100.1|2964818_2966921_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000373425.1|2966920_2967415_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031433.1|2967977_2968184_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	1.5e-25
WP_000035576.1|2968484_2968916_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001019139.1|2969067_2969241_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2969412_2969568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2969647_2969713_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2969715_2969904_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2969914_2970127_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2970488_2970986_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2970982_2971516_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2971512_2971824_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2971828_2972044_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2972797_2973013_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2973313_2973526_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2973580_2973670_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047140.1|2973947_2974700_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
WP_001265198.1|2974713_2975763_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2975764_2976043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2976109_2976361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2976577_2976733_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2976804_2977092_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2977091_2977331_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071528610.1|2977355_2977661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2977863_2978196_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|2978632_2979973_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151196.1|2980006_2980426_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.6e-55
WP_000054504.1|2980466_2981432_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|2981412_2981934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2981917_2982145_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2982222_2982630_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2982822_2982978_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344966.1|2982979_2983555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2984041_2984230_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2984226_2984418_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048331.1|2984511_2986983_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2987055_2987307_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876986.1|2987341_2988622_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|2988623_2988752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836042.1|2988809_2989829_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001358608.1|2989840_2991055_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_001358609.1|2991260_2991587_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2991721_2992063_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2992097_2992658_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2992660_2993371_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2993478_2993784_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041707.1|2993982_2996409_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
>prophage 9
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	3248323	3343458	5485363	tRNA,tail,holin,terminase,portal,lysis,protease	Enterobacteria_phage(46.03%)	104	NA	NA
WP_000984517.1|3248323_3249205_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055778.1|3249396_3251445_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431368.1|3251464_3252163_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|3252259_3252757_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207282.1|3252886_3254170_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001358625.1|3254138_3256772_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001302304.1|3256852_3258292_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|3258409_3258646_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3258750_3258942_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812736.1|3258942_3259599_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_000976483.1|3259994_3260336_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879314.1|3260348_3261221_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168751.1|3261224_3261599_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3261737_3261968_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011656.1|3262069_3262726_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3262749_3263412_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936918.1|3263408_3265469_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024742.1|3265677_3266337_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|3266663_3267020_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|3267086_3267377_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173471.1|3267510_3268689_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|3268744_3269386_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|3269422_3271234_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301737.1|3271468_3272944_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|3273281_3274151_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|3274278_3275721_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448391.1|3275851_3276823_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184052.1|3276942_3278265_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001303192.1|3278280_3279213_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|3279291_3280047_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571476.1|3280043_3280829_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3281074_3282085_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3282093_3282705_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|3282843_3282909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024953.1|3282979_3283582_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3283583_3284105_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|3284139_3284880_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|3284908_3285361_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258685.1|3285478_3287251_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891621.1|3287560_3288127_+	hydrolase	NA	NA	NA	NA	NA
WP_001261931.1|3288444_3288693_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|3289064_3290078_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|3290292_3290370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023995.1|3290480_3290750_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000268977.1|3290751_3292065_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	7.4e-78
WP_001230489.1|3292129_3292729_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_044782730.1|3292799_3296291_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.2	0.0e+00
WP_122368358.1|3296531_3297161_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	1.9e-103
WP_000194755.1|3297106_3297850_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	6.8e-145
WP_001357740.1|3297860_3298559_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|3298558_3298888_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|3298884_3301530_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|3301573_3301882_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3301908_3302331_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3302344_3303097_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3303104_3303503_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3303515_3304139_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3304141_3304423_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3304415_3304742_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|3304829_3306809_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|3306798_3308301_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|3308300_3308513_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|3308509_3310633_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373410.1|3310629_3311106_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_000735655.1|3311524_3311749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255337.1|3311772_3312240_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_001092859.1|3312236_3312770_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	3.1e-99
WP_001015164.1|3312812_3313370_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.3	8.6e-52
WP_000284516.1|3313373_3313589_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290217.1|3313665_3313938_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143457.1|3313978_3314158_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	3.7e-25
WP_000142961.1|3314294_3316241_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	98.1	0.0e+00
WP_000738068.1|3316725_3316995_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3317006_3317966_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000483505.1|3318348_3319407_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|3319558_3319756_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|3319971_3320352_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|3320370_3321360_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|3321411_3321669_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|3321665_3323066_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|3323062_3323941_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|3323951_3324860_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621231.1|3324846_3325080_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_000587261.1|3325076_3325739_-	ash family protein	NA	Q8W643	Enterobacteria_phage	96.3	6.1e-113
WP_001090255.1|3325846_3326554_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	5.3e-115
WP_000944728.1|3326635_3326869_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|3327025_3327715_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|3327862_3328564_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|3328560_3328761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553977.1|3328959_3329142_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_001365075.1|3329147_3329720_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|3330089_3330917_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|3330957_3331329_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|3331520_3331775_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063651.1|3331808_3333095_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.5	1.7e-252
WP_069190626.1|3333099_3333876_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252980.1|3333928_3334324_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|3334364_3335108_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564730.1|3335104_3336076_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176809.1|3336240_3338670_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214274.1|3338694_3339795_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185748.1|3340182_3340929_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|3340942_3341509_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|3341724_3343458_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 10
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	3372850	3434020	5485363	tail,holin,terminase,capsid,integrase,portal,transposase,plate,head	Enterobacteria_phage(78.72%)	76	3364763:3364777	3381304:3381318
3364763:3364777	attL	TCAGCGCCCGGCGTT	NA	NA	NA	NA
WP_001300279.1|3372850_3373852_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3373857_3374205_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3374234_3374885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3374900_3375305_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3375394_3375532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3375603_3375807_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3375828_3376179_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3376189_3376468_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3376479_3376722_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3376718_3376832_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3376924_3377341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3377364_3377568_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3377564_3377831_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3377827_3378127_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|3378138_3378756_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599376.1|3378752_3379118_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
WP_000123459.1|3379124_3381947_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
3381304:3381318	attR	AACGCCGGGCGCTGA	NA	NA	NA	NA
WP_000686522.1|3382023_3382983_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_000211280.1|3382987_3383302_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000193206.1|3383384_3384227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068330.1|3384266_3384764_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087821.1|3385412_3386459_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_000613756.1|3386458_3388210_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262671.1|3388364_3389201_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	6.0e-150
WP_001055104.1|3389224_3390277_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632345.1|3390322_3391123_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063103.1|3391224_3391719_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|3391718_3391919_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|3391921_3392245_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072321.1|3392241_3392634_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	1.3e-70
WP_000780536.1|3392630_3393038_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
WP_000920594.1|3393175_3393643_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356352.1|3393635_3394271_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_001476003.1|3394282_3394849_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_001067548.1|3394866_3395196_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111935.1|3395199_3396096_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071706.1|3396088_3396619_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
WP_000108494.1|3396621_3398781_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	6.0e-109
WP_000631344.1|3398777_3399680_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_001414827.1|3399688_3400267_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
WP_000954203.1|3400310_3400883_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3401039_3401528_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000853407.1|3401540_3404348_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.4	0.0e+00
WP_000333495.1|3404334_3404490_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|3404498_3404864_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3404918_3405431_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005445.1|3405430_3406615_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.0	3.5e-220
WP_000132765.1|3406772_3407096_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_001254932.1|3407046_3408198_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001317900.1|3409504_3410644_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|3410933_3411194_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3411385_3411526_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001303543.1|3411714_3411996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|3412987_3413536_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001283421.1|3413592_3415425_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611328.1|3415421_3416078_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001302050.1|3416373_3416550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106479.1|3416536_3416761_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001154288.1|3416828_3417551_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001273005.1|3417780_3418533_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158226.1|3418529_3419198_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128215.1|3419212_3420199_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001302033.1|3420303_3421104_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001302103.1|3421191_3421743_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087466.1|3421791_3422508_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079722.1|3422827_3424585_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146772.1|3424850_3426257_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000270665.1|3426281_3426692_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015033.1|3426691_3427057_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245723.1|3427134_3428622_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|3428655_3429069_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118883.1|3429255_3430461_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|3430457_3430691_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334610.1|3430799_3431468_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	3.3e-82
WP_000494168.1|3431578_3432058_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001254932.1|3432868_3434020_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 11
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	3470456	3513482	5485363	tail,holin,terminase,capsid,portal,protease,head	Escherichia_phage(30.77%)	53	NA	NA
WP_001023990.1|3470456_3470726_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	97.8	1.7e-45
WP_086260589.1|3470727_3471951_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.8	1.1e-80
WP_001230428.1|3472015_3472615_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_171877907.1|3472682_3476156_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_000649829.1|3476289_3476817_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_151310946.1|3477007_3477640_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.7e-104
WP_000194760.1|3477585_3478329_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001152185.1|3478339_3479038_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000847304.1|3479037_3479367_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082428.1|3479363_3481943_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533402.1|3481923_3482337_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3482363_3482795_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3482808_3483549_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3483530_3483797_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3483854_3484202_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253986.1|3484238_3485744_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001374583.1|3485733_3487326_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|3487322_3487529_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|3487512_3489441_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|3489412_3489922_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3490316_3490541_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_024165987.1|3490622_3490937_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3491464_3491650_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3491871_3491985_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3492205_3492739_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3492898_3493171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|3493426_3493642_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000874390.1|3494080_3495931_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|3496697_3497411_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3498031_3498850_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3499001_3499373_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3499362_3499734_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3499746_3500796_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3500797_3501076_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3501243_3501399_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3501500_3501638_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3502003_3502777_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3503128_3503542_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450981.1|3503557_3504328_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	3.9e-79
WP_000788751.1|3504349_3505096_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3505102_3506194_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3506272_3506728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3506934_3507360_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3507343_3507616_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3507724_3508126_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3508153_3508345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3508344_3508632_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3508908_3509064_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3509205_3509595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3509781_3509967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3510540_3510729_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3510725_3510917_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171877908.1|3511010_3513482_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
>prophage 12
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	3528315	3653010	5485363	tRNA,tail,holin,terminase,capsid,integrase,portal,lysis,plate,protease,head	Escherichia_phage(44.62%)	114	3601940:3601956	3643962:3643978
WP_000156526.1|3528315_3530076_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3530144_3530663_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3530732_3530900_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759107.1|3531155_3531719_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445550.1|3531715_3533356_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333168.1|3533360_3534614_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053083.1|3534743_3536651_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_001086511.1|3536662_3538771_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224291.1|3539014_3540124_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001301917.1|3540120_3540663_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3540836_3541847_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111457.1|3541957_3542695_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919493.1|3542660_3543176_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_077626202.1|3543183_3543711_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165679.1|3543738_3544809_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001303867.1|3547423_3548125_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750295.1|3548207_3548747_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263919.1|3549102_3549678_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244347.1|3549670_3550630_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055981.1|3550626_3551772_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235210.1|3551783_3552575_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3552571_3553339_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|3553381_3555994_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|3556259_3557462_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|3557630_3559031_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|3559633_3560722_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|3560906_3562097_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|3562147_3562795_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3562821_3563370_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925974.1|3563550_3565398_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|3565658_3570119_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001302273.1|3570118_3570823_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288845.1|3570803_3572126_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001359083.1|3572122_3572908_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3573043_3573823_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3573799_3574693_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011613.1|3574846_3575593_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3575589_3575772_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056544.1|3575823_3577056_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570541.1|3577092_3578079_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3578075_3579824_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000167336.1|3582331_3582616_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3582775_3584449_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3584559_3585243_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000799175.1|3585415_3586180_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3586348_3587632_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057154.1|3587702_3588791_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642854.1|3588989_3589682_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001301741.1|3589811_3591572_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642546.1|3591977_3592835_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|3592889_3595172_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|3595490_3595709_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882976.1|3595789_3596953_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	1.4e-205
WP_000978879.1|3596952_3597432_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	99.4	5.6e-84
WP_000069966.1|3597446_3599894_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.1	0.0e+00
WP_045154541.1|3599886_3600006_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	8.8e-15
WP_001031303.1|3600038_3600314_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3600370_3600889_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286699.1|3600901_3602092_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	3.7e-225
3601940:3601956	attL	GGTAATCAGCACAGGTT	NA	NA	NA	NA
WP_000905108.1|3602151_3602745_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001143729.1|3602775_3603186_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	2.9e-65
WP_001008238.1|3603206_3603650_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	4.1e-81
WP_000367937.1|3603621_3604224_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.6e-99
WP_000216981.1|3604223_3605543_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.9	4.7e-181
WP_001285340.1|3605539_3606151_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121463.1|3606143_3607052_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	5.7e-162
WP_000127164.1|3607056_3607404_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093753.1|3607400_3608036_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	96.7	7.9e-110
WP_001001768.1|3608102_3608555_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	3.1e-76
WP_000917155.1|3608547_3609015_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001300730.1|3608977_3609151_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040637.1|3609122_3609548_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000736604.1|3609535_3609961_-	hypothetical protein	NA	M1SV74	Escherichia_phage	94.3	5.7e-56
WP_001144104.1|3609975_3610473_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123123.1|3610472_3610754_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846403.1|3610757_3610961_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000988639.1|3610960_3611470_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000203436.1|3611569_3612313_-|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	96.8	2.1e-122
WP_001248569.1|3612316_3613390_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.7	3.9e-202
WP_001085953.1|3613448_3614303_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|3614476_3616249_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038161.1|3616248_3617283_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_001284793.1|3618063_3618840_+	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_000759934.1|3618836_3619646_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_000825551.1|3619660_3620206_+	cytolethal distending toxin type V subunit CdtC	NA	M1SNM4	Escherichia_phage	99.4	4.1e-99
WP_000268621.1|3620281_3622579_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.5	0.0e+00
WP_000027664.1|3622568_3622844_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3622840_3623065_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277966.1|3623064_3623367_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.7e-46
WP_000557703.1|3623366_3623591_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|3623654_3624155_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001005162.1|3624151_3624322_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001389237.1|3624332_3624689_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3624797_3625097_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3625190_3626186_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3626217_3627015_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918514.1|3627224_3628655_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3628864_3630013_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3630327_3630954_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3630989_3631853_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213047.1|3631854_3632472_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|3632482_3634927_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|3635165_3636458_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3636548_3637892_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3637902_3638514_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077072.1|3638668_3642697_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3642831_3643326_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3643870_3644836_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
3643962:3643978	attR	AACCTGTGCTGATTACC	NA	NA	NA	NA
WP_001043606.1|3644958_3646725_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202230.1|3646725_3648447_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
WP_001241680.1|3648488_3649193_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3649477_3649696_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3650382_3652659_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3652689_3653010_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 13
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	3777699	3823231	5485363	tail,holin,terminase,integrase,portal,lysis,protease	Enterobacteria_phage(42.11%)	66	3777284:3777298	3823305:3823319
3777284:3777298	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3777699_3778398_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3778628_3779510_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3779678_3779840_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3780336_3781356_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3781389_3782370_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3782546_3782816_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3782817_3784134_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3784193_3784793_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3784863_3788277_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3788337_3788946_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3788882_3789626_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000884310.1|3789631_3790330_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	6.2e-132
WP_000447253.1|3790339_3790669_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372026.1|3790668_3793734_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3793705_3794035_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|3794043_3794430_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|3794490_3795234_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|3795244_3795646_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677093.1|3795642_3796221_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	2.1e-101
WP_001283154.1|3796232_3796508_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_001097039.1|3796500_3796824_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|3796910_3798938_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|3798882_3800391_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|3800390_3800603_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3800599_3802702_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3802701_3803193_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3803867_3804020_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3804007_3804475_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075144.1|3804471_3804969_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3804968_3805184_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3805326_3805725_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3805805_3805964_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3806049_3806793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3806977_3807667_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3807681_3807804_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3808141_3809101_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3809312_3809978_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3809974_3810595_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3810587_3810758_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3810754_3810937_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3810933_3811374_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145931.1|3811447_3811738_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788871.1|3811734_3812436_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_053902211.1|3812432_3813332_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	4.2e-173
WP_000438489.1|3813364_3813661_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_000067727.1|3813802_3814018_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|3814091_3814787_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000854876.1|3814959_3815256_+	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_000478871.1|3815267_3815552_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_100207026.1|3815878_3816010_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	95.3	2.1e-17
WP_000088205.1|3815987_3816260_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392425.1|3816544_3816994_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000065374.1|3817189_3817558_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198854.1|3817630_3817795_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	4.0e-26
WP_000372923.1|3817763_3817907_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995439.1|3817982_3818279_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|3818284_3819070_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186844.1|3819066_3819747_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3819743_3819926_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3819898_3820090_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3820100_3820382_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|3820480_3820702_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3820912_3821515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3821757_3821925_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3821964_3822183_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3822160_3823231_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3823305:3823319	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	4403672	4447216	5485363	plate,transposase,integrase	Enterobacteria_phage(22.22%)	39	4403243:4403257	4428894:4428908
4403243:4403257	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4403672_4404854_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000893282.1|4405206_4406460_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4406471_4407575_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4407862_4408918_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4408956_4409358_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189550.1|4409415_4410660_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4410751_4411210_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4411470_4412928_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4412984_4413542_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4413453_4413720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4414026_4414479_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4414488_4414887_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554761.1|4414889_4415183_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4415234_4416290_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207562.1|4416360_4417146_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4417090_4418830_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543890.1|4419647_4420421_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	6.0e-19
WP_000729705.1|4420606_4420867_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|4420869_4421148_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4421303_4422044_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4422014_4422782_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4422886_4423465_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973060.1|4423704_4426149_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4426191_4426665_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4426818_4427589_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4427706_4428879_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_000393588.1|4429059_4429215_-	hypothetical protein	NA	NA	NA	NA	NA
4428894:4428908	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001145876.1|4429525_4431286_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4431288_4432425_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001414559.1|4433170_4433686_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509061.1|4433754_4437969_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103342.1|4438044_4440186_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4440395_4440914_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4441610_4442111_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4442145_4442370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056995.1|4442420_4443896_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4443902_4444316_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4444319_4446170_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4446133_4447216_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 15
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	4879624	4938634	5485363	protease,transposase	Klosneuvirus(11.11%)	59	NA	NA
WP_001162171.1|4879624_4880977_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4881070_4881622_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4881777_4883151_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853752.1|4883326_4884325_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.9	7.4e-70
WP_000596024.1|4884357_4885353_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4885339_4886362_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4886375_4887878_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4888017_4888974_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4889283_4889814_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4889893_4890244_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4890237_4890489_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4890700_4891042_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060933.1|4891044_4894824_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4894820_4896554_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4896759_4897398_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4897720_4899064_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4899142_4899349_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4899673_4900228_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886884.1|4901439_4902180_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4902369_4904313_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4904430_4904811_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4904899_4905760_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4905867_4906833_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4906940_4907603_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4907647_4909060_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4909368_4909989_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4910206_4910845_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826434.1|4910979_4912188_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.8e-208
WP_000604943.1|4912195_4912627_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4913249_4914044_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4914114_4914564_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4914605_4914833_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4914837_4915152_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4915158_4915554_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4915880_4916156_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4916284_4916971_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4916970_4917825_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4917834_4918485_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4918498_4918963_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4918972_4919278_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001350568.1|4919293_4920691_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4921045_4922110_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4922217_4922973_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569694.1|4922969_4923719_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4923900_4924230_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4924378_4924654_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4924770_4926396_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943958.1|4926479_4927643_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	2.4e-80
WP_000547760.1|4928293_4928692_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012573.1|4928709_4929369_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4929419_4930118_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4930136_4930538_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4930664_4931396_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4931576_4934018_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4934056_4934482_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4934686_4935985_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4936088_4936286_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4936367_4937372_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4937374_4938634_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038412	Escherichia coli O157:H7 strain 493/89 chromosome, complete genome	5485363	5076727	5127270	5485363	tRNA,tail,holin,terminase,capsid,integrase,head	Enterobacteria_phage(33.33%)	61	5079140:5079155	5093538:5093553
WP_000918366.1|5076727_5078143_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5078225_5079209_+	quinone oxidoreductase	NA	NA	NA	NA	NA
5079140:5079155	attL	GGATGCGCAGCGTGCG	NA	NA	NA	NA
WP_000891404.1|5079374_5079617_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543816.1|5079753_5080791_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332270.1|5080879_5081998_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	98.6	1.5e-209
WP_001217541.1|5082037_5082286_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5082446_5083088_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5083169_5083799_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5083871_5084444_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001101707.1|5084555_5084825_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_171877910.1|5084826_5086140_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001230409.1|5086204_5086804_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	3.0e-111
WP_171877369.1|5086871_5090267_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_139116292.1|5090513_5091146_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_001432971.1|5091091_5091835_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.1e-147
WP_072619016.1|5091845_5092544_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|5092543_5092885_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212829.1|5092877_5096120_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	100.0	0.0e+00
5093538:5093553	attR	CGCACGCTGCGCATCC	NA	NA	NA	NA
WP_001453698.1|5096171_5096381_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|5096476_5096851_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|5096856_5097573_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|5097640_5097985_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|5097981_5098428_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|5098424_5098775_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|5098784_5099111_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063103.1|5101799_5102021_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	2.3e-32
WP_171877886.1|5102065_5104003_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.4	0.0e+00
WP_171877911.1|5104066_5105728_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958422.1|5105724_5106288_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000074669.1|5106976_5107201_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|5107282_5107597_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|5108124_5108310_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|5108526_5109024_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|5109023_5109239_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000143003.1|5109678_5111529_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001339373.1|5112346_5112499_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047096.1|5112808_5113561_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	5.8e-136
WP_001359939.1|5113574_5114564_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	9.9e-192
WP_001061413.1|5114571_5115369_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767105.1|5115388_5115778_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210136.1|5115774_5116101_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	8.6e-52
WP_001359044.1|5116097_5116751_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
WP_001359043.1|5116750_5117245_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	99.4	1.9e-87
WP_000104942.1|5117241_5118183_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|5118172_5118352_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|5118527_5119079_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|5119122_5119323_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|5119413_5120088_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|5120260_5120557_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|5121157_5121520_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|5121585_5122410_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008211.1|5122537_5123074_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5123064_5123415_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|5123411_5123885_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829413.1|5124031_5124499_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|5124500_5124692_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|5124694_5125429_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|5125428_5126001_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|5126037_5126319_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000654815.1|5126366_5126540_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5126736_5127270_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
