The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	1220927	1244422	5459302	holin,tail,transposase,integrase	Enterobacteria_phage(33.33%)	27	1212573:1212587	1245293:1245307
1212573:1212587	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1220927_1222133_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222134_1223448_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223444_1225076_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225076_1225475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225572_1225986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150576.1|1226381_1227644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227719_1228055_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228057_1228813_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229130_1229697_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229671_1230283_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230279_1230945_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1230941_1231565_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231817_1232561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232646_1232814_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233221_1235075_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235224_1235440_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235444_1235789_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236145_1236526_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236522_1236870_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237370_1238584_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238801_1239071_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239231_1239654_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239783_1240842_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1240920_1241571_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241753_1242344_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242845_1243094_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1243939_1244422_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245293:1245307	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	1522007	1527433	5459302	integrase	Enterobacteria_phage(50.0%)	6	1510995:1511011	1529629:1529645
1510995:1511011	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522007_1522577_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522576_1523044_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523030_1523711_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523720_1524857_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525031_1526189_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526500_1527433_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529629:1529645	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	1773053	1876929	5459302	terminase,tail,transposase,protease,tRNA,portal,holin	Enterobacteria_phage(64.29%)	119	NA	NA
WP_000569336.1|1773053_1773980_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1773984_1774716_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774696_1774804_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774863_1775565_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1775585_1776872_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1776905_1777160_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1777178_1777313_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1777316_1777559_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1777646_1778009_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1778005_1778362_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1778695_1778872_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1778873_1779821_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1779817_1780039_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1780137_1780419_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1780429_1780621_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1780593_1780776_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1780775_1781453_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1781449_1782235_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1782240_1782537_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1782612_1782756_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1782724_1782889_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1782961_1783330_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1783590_1784172_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1784188_1784461_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1784973_1785525_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1785531_1785813_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1785935_1786583_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1786691_1786910_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1787024_1787321_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1787353_1788292_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1788288_1788990_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1788986_1789277_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1789347_1789626_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1789758_1789974_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1789984_1790221_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1790177_1790624_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1790620_1791148_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1791144_1791321_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1791323_1791725_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1791684_1791894_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1791886_1792492_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1792488_1792683_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1792675_1793110_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1793616_1794564_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1794573_1794843_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1795353_1797300_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1797437_1797617_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1797657_1797903_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1797980_1798196_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1798200_1798734_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1799004_1799574_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1799573_1799720_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1799947_1800133_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1800344_1800617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1800649_1801126_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1801122_1803246_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1803242_1803455_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1803454_1804957_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_162829202.1|1805863_1807077_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001097065.1|1808326_1808653_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1808645_1808927_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1808929_1809553_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1809565_1809964_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1809971_1810724_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1810737_1811160_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1811186_1811495_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1811538_1814184_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1814180_1814510_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1814509_1815208_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1815218_1815962_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1815907_1816537_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1816777_1817953_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1817904_1820250_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1820317_1820917_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1820981_1822295_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1822296_1822566_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1822933_1823182_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1823696_1825382_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1825378_1826098_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1826144_1826615_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1826656_1827118_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1827242_1829246_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1829242_1830379_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1830371_1831103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1831121_1832651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1832661_1833750_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1834990_1835308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1835369_1838999_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1845956_1847990_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1848121_1849231_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1849492_1849774_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1850065_1850608_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1850695_1851370_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1851385_1853866_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1853876_1854911_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1854992_1855331_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1855548_1856400_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1856520_1856793_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1856902_1857217_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1857226_1857574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1858624_1858864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1859197_1859986_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1859982_1860783_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1860847_1861666_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434031.1|1861717_1862464_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1862437_1863403_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1863399_1864404_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1864400_1865678_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1865934_1866987_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1867285_1868140_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1868168_1869431_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1869440_1869893_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1869923_1870208_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1870211_1871567_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1871614_1872655_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1872754_1873534_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1873615_1874515_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1874920_1875238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1875567_1876929_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	1974942	2048647	5459302	integrase,terminase,head,tail,transposase,portal,capsid,holin	Escherichia_phage(34.69%)	71	1974449:1974464	2032835:2032850
1974449:1974464	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1974942_1976156_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1976527_1978675_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1980122_1981661_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1981710_1982058_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1982054_1982435_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1982796_1983342_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1983338_1984082_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1984093_1985173_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1985234_1986170_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1986626_1987544_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1987645_1988596_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1990982_1991699_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1992041_1993496_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1993597_1994914_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1995227_1996280_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829202.1|2001755_2002968_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2006326_2007124_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2007359_2008382_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2008381_2008585_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2008643_2011115_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2011210_2011399_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2011395_2011584_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2012064_2012217_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2012491_2013136_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2013233_2013461_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2013457_2013883_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_057699194.1|2013951_2014983_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.8	3.1e-87
WP_072143023.1|2014894_2015437_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2015471_2016170_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2016191_2016416_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2016412_2016769_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2016801_2016954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2016950_2017262_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2017388_2017952_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2018061_2018166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2018352_2018565_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2018732_2019011_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2019012_2020062_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2020074_2020434_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2020430_2021120_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2021753_2022182_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2022659_2024510_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2024591_2025805_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2026115_2026331_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2026335_2026680_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2026730_2027264_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2027419_2027602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2027614_2027746_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2027973_2028159_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2028685_2029000_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2029081_2029306_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2029700_2030210_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2030181_2032110_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2032093_2032300_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2032296_2033889_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2032835:2032850	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2033878_2035384_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2035420_2035768_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2035825_2036092_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2036073_2036814_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2036827_2037259_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2037285_2037699_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_060722691.1|2037679_2040259_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847298.1|2040255_2040585_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2040584_2041283_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2041293_2042037_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|2041982_2042612_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|2042852_2044028_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|2043979_2046331_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2046398_2046998_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|2047062_2048376_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2048377_2048647_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	2106227	2126210	5459302	integrase,transposase,tail	Enterobacteria_phage(75.0%)	28	2119346:2119359	2129352:2129365
WP_032161728.1|2106227_2107361_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2107311_2107635_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2107792_2108977_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2108976_2109489_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2109543_2109909_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2109917_2110073_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2112875_2113364_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2113520_2114093_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2114136_2114667_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2115758_2116073_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2116077_2117037_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2117113_2119936_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2119346:2119359	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2119942_2120308_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2120304_2120922_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2120933_2121233_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2121229_2121496_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2121492_2121696_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2121719_2122136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2122228_2122342_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2122338_2122581_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2122592_2122871_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2122881_2123232_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2123253_2123457_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2123528_2123666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2123755_2124160_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2124175_2124826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2124855_2125203_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2125208_2126210_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2129352:2129365	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	2446756	2561010	5459302	terminase,head,tail,protease,transposase,portal,capsid,holin	Enterobacteria_phage(28.18%)	140	NA	NA
WP_001260835.1|2446756_2447578_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2447677_2447761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2447853_2448189_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2448585_2449839_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2449945_2450839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2450973_2452194_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2452318_2453014_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2452966_2454259_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2454416_2455031_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2455073_2455928_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2455929_2456547_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2456557_2458981_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2459041_2461468_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2461666_2461972_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2462079_2462790_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2462792_2463353_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2463387_2463729_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2463863_2464190_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2465178_2465430_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2465502_2467974_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2468066_2468258_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2468254_2468443_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2468843_2469008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2469011_2469230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2469301_2469601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2469953_2470232_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2470233_2470425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2470445_2470817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2470914_2471217_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2471213_2471639_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2471661_2472624_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2472630_2473371_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2474181_2474577_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2474633_2475218_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2475333_2475438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2475626_2475839_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2476006_2476285_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2476286_2477336_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2477348_2477708_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2477704_2478394_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2479033_2479462_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2479940_2481791_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2482230_2482446_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2482450_2482795_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2482845_2483379_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2483649_2484219_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2484218_2484365_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2484592_2484778_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2485202_2485430_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2485471_2485837_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2486126_2486690_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2486686_2488348_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2488411_2490349_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2490393_2490615_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2490560_2493140_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2493142_2493469_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2493478_2493829_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2493825_2494272_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2494268_2494613_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|2494678_2495395_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|2495400_2495775_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2495870_2496080_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|2496132_2499213_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|2499205_2499547_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2499546_2499984_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2500171_2503432_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2503434_2503650_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2503717_2504317_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2504381_2505605_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2505606_2505876_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2507275_2507926_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2508508_2510047_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2510096_2510444_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2510440_2510821_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2511783_2512026_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2512736_2513981_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2514073_2514262_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2514258_2514447_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2515011_2515221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2515221_2515860_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2515871_2516024_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2516316_2516655_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2517046_2517289_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2517272_2517698_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2517766_2518810_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2518802_2519264_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2519297_2520014_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2520046_2520328_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2520324_2520552_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2520544_2520856_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2520983_2521202_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2521203_2521761_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2521994_2522207_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2522326_2522671_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2522792_2523065_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2523066_2524116_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2524128_2524434_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2524496_2525051_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2525275_2525473_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2525608_2526322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2526772_2527204_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2527681_2529532_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2529970_2530186_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2530190_2530535_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2530585_2531119_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2531390_2531960_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2531959_2532106_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2532328_2532514_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2533039_2533354_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2533435_2533660_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2534046_2534592_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2534566_2536492_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2536488_2536695_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2536691_2538293_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2538273_2539593_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2539602_2539935_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2539990_2541016_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2541057_2541456_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2541467_2541821_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2541835_2542369_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2542365_2542761_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2542768_2543521_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2543534_2543957_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2543983_2544397_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2544377_2546990_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2546986_2547316_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2547315_2548014_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2548024_2548768_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2548713_2549343_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_060722692.1|2549583_2553063_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230508.1|2553130_2553730_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2553794_2555018_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2555019_2555289_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2555402_2555978_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2556050_2556680_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2556761_2557403_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2557564_2557807_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2557938_2559222_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2559310_2560771_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2560806_2561010_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	2742977	2800695	5459302	terminase,head,tail,tRNA,capsid,holin	Escherichia_phage(42.19%)	69	NA	NA
WP_001295593.1|2742977_2743412_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2743992_2744634_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2744715_2745345_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2745417_2745993_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2746105_2746375_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2746376_2747690_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2747754_2748354_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2748424_2751922_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2752055_2752583_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2752773_2753406_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2753351_2754095_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2754105_2754804_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2754803_2755145_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2755137_2758218_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2758269_2758479_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2758574_2758949_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2758954_2759671_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2759739_2760084_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2760080_2760527_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2760523_2760874_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2760883_2761210_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2763736_2763958_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2764002_2765940_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2766003_2767665_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2767661_2768225_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2768513_2768879_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2768920_2769121_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2769252_2769579_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2769979_2770165_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2770387_2770519_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2770613_2771309_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2771582_2772116_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2772166_2772511_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2772515_2772731_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_021497500.1|2772880_2774734_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2775308_2775740_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2776301_2776856_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2776852_2777143_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2777142_2777742_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2778241_2779633_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2779632_2780622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2780589_2781741_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2782172_2782418_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2782496_2782658_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2782668_2782932_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2783183_2783396_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2783501_2783924_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2783939_2784701_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2784723_2785470_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2785476_2786265_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2786342_2786765_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2786761_2787016_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2787095_2787515_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2787757_2787937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2787947_2788103_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2788099_2788588_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2789029_2789251_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2789250_2789421_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2789495_2789771_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2789872_2792473_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2792465_2793275_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2793330_2793480_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2793517_2793706_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2793805_2794021_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2794022_2795258_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2795309_2796245_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2796373_2797747_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2798224_2799208_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2799462_2800695_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	2885641	2961097	5459302	integrase,terminase,head,protease,transposase,holin,portal,capsid,tail	Stx2-converting_phage(37.5%)	84	2901143:2901170	2961234:2961261
WP_000422055.1|2885641_2886691_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2886910_2887669_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2887665_2888256_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2888295_2889168_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2889380_2890964_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2890991_2891612_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2891608_2892490_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2892627_2892672_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2892763_2894326_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2894325_2895921_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2895921_2897283_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2897294_2898488_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2898487_2899294_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2899674_2899854_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2899939_2900440_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2900485_2900992_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2901143:2901170	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2904462_2905053_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2905236_2905884_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2906020_2906167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2906594_2906873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2907212_2907593_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2907589_2907937_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2907986_2909525_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2910490_2911060_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2911125_2912037_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2912143_2912266_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2913863_2915189_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2916215_2916485_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2916486_2917800_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2917951_2918551_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2918618_2920964_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2920915_2922091_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2922432_2923065_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2923010_2923754_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2923764_2924463_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2924462_2924804_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2924796_2928039_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2928086_2928296_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2928391_2928766_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2928780_2929497_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2929562_2929907_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2929903_2930350_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2930346_2930697_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2930706_2931033_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2931035_2933615_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|2933560_2933782_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2933826_2935764_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2935827_2937489_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|2937485_2938049_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2938338_2938704_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2938745_2938973_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2939397_2939583_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2939810_2939957_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2939956_2940526_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2940796_2941330_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2941380_2941725_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2941729_2941945_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2942094_2943948_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2944744_2945803_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2945953_2946151_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2946392_2946923_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2946931_2947291_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2947303_2948350_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2948351_2948630_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2948699_2948957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2949177_2949390_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2949668_2950427_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2951125_2951290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2951286_2951868_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2952054_2952597_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2952508_2953549_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2953520_2954072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2954055_2954283_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2954359_2954767_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2955030_2955330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2955402_2955621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2955643_2956051_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2956028_2956262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2956255_2956399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2956735_2956924_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2956920_2957112_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2957204_2959676_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2959740_2959989_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2959966_2961097_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2961234:2961261	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	3007793	3179997	5459302	integrase,terminase,head,portal,protease,transposase,lysis,holin,tRNA,capsid,tail	Enterobacteria_phage(32.5%)	197	3040503:3040518	3186654:3186674
WP_001299679.1|3007793_3009050_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3009263_3009887_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3009886_3010738_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3010888_3011836_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3011960_3013640_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3013694_3013973_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3014250_3014835_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3014951_3016043_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3018864_3019935_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3019945_3020578_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3020588_3022007_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3024038_3024239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3024346_3025369_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3025368_3026349_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3026345_3027104_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3027922_3028777_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3028802_3030773_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3030822_3031077_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3031925_3033138_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3033326_3033938_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3034037_3034952_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3035047_3036784_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3037175_3038246_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3038255_3039554_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3039916_3041449_+	SpoVR family protein	NA	NA	NA	NA	NA
3040503:3040518	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3041500_3042220_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3040503:3040518	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3042441_3043983_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3044128_3044659_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3044704_3045973_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3045972_3046392_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3046764_3047676_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3047882_3048344_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3048420_3049080_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3049151_3049445_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3049456_3049615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3049685_3050087_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3050189_3050558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3051077_3051773_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3051796_3052609_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3052612_3052879_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3054044_3055258_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3055431_3056016_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3056514_3057468_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3057654_3059139_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3059441_3060980_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3061029_3061377_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3061373_3061754_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3061829_3062078_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3062134_3062803_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3063300_3063483_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3063561_3064062_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3064098_3064605_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3064623_3065514_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3065633_3066215_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3066214_3069130_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3069194_3069794_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3069860_3073259_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3073319_3073952_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3073888_3074632_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3074637_3075336_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3075335_3075665_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3075661_3078211_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3078203_3078638_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3078619_3079042_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3079057_3079798_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3079805_3080201_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3080197_3080776_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3080787_3081141_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3081152_3081551_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3081592_3082618_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3082673_3083006_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3083015_3084335_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3084315_3085917_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3085913_3086120_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3086116_3088042_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3088016_3088562_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3088950_3089145_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3089309_3089516_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3089801_3090212_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3090503_3090797_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3090887_3091070_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3091286_3091763_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3091749_3092055_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3092376_3093066_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3093062_3093203_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3093199_3093562_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3093558_3093849_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3093841_3094012_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3094011_3094467_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3094968_3096495_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3096552_3096675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3096739_3097072_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3097139_3097442_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3097438_3098140_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3099064_3099301_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3099290_3100433_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3100546_3101797_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3101968_3102622_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3102631_3103093_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3103146_3104253_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3104288_3104930_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3104933_3106304_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3106222:3106237	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3106472_3107144_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3106222:3106237	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3107143_3108604_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3109460_3109742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|3109755_3111417_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|3111400_3111757_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3111880_3112063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3112046_3112487_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3112486_3112783_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3112779_3113118_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3113114_3114326_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3114327_3114900_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3114939_3116097_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3116389_3116614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3116738_3117011_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3117021_3117432_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3117428_3117680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3118050_3120183_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3120179_3120479_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3120484_3120727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3120716_3120908_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3120907_3121093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3121085_3121283_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3121308_3122052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3122109_3122298_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3122662_3123892_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3124140_3125262_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3125310_3126537_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3126786_3127923_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3127906_3128770_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3129133_3130495_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3130555_3130831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3133139_3136541_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3137131_3139480_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3139499_3139589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3139601_3139838_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3139783_3140521_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3140574_3141453_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3141755_3141866_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3141975_3142230_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3142246_3142945_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3142944_3143286_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3143278_3146521_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3146573_3146783_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3146878_3147253_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3147258_3147975_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3148033_3148378_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3148374_3148821_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3148817_3149168_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3149177_3149504_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3149583_3152085_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|3152030_3152252_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|3152296_3154234_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3154297_3155959_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3155955_3156519_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3156808_3157174_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3157215_3157401_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3157530_3157671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3158027_3158252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3158316_3158523_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3158750_3158897_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3158896_3159466_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3159736_3160270_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3160320_3160665_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3160669_3160885_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3160960_3161230_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3161267_3161450_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3161597_3163535_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3163849_3164017_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3164613_3165435_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3165431_3165806_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3165818_3166868_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3166869_3167148_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3167315_3167528_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3167716_3167821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3167936_3168524_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3168526_3168718_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3168719_3169157_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3169143_3169461_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3169414_3169732_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3169721_3170024_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3170020_3170302_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3170334_3171051_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3171084_3171627_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3171538_3172576_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3172644_3173070_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3173053_3173377_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3173501_3173978_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3174293_3174446_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3174560_3175076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3175208_3175598_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3175659_3175929_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3175897_3177016_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3177182_3177977_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3177973_3179020_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3179175_3179997_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3186654:3186674	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	3407472	3559015	5459302	integrase,terminase,head,protease,transposase,bacteriocin,holin,portal,capsid,tail	Escherichia_phage(37.88%)	176	3505562:3505577	3560780:3560795
WP_001028088.1|3407472_3407967_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3407987_3409316_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3409398_3409506_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203825.1|3410464_3411094_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3411141_3411363_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3411359_3411644_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120842.1|3412121_3412529_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	98.5	2.1e-79
WP_000426668.1|3412528_3412924_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000902692.1|3413157_3413331_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	88.0	7.6e-15
WP_000331700.1|3413396_3421778_-	hypothetical protein	NA	A0A0H4IT29	Shigella_phage	98.8	0.0e+00
WP_000012437.1|3421847_3423113_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|3423123_3423375_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|3423385_3423832_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|3423834_3424488_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|3424581_3424983_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|3425039_3425180_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|3425412_3426150_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|3426229_3426847_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|3426852_3427131_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|3427145_3428414_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001459281.1|3428410_3430036_-	hypothetical protein	NA	A0A2R2Z356	Escherichia_phage	99.8	0.0e+00
WP_001303606.1|3430330_3430519_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3430657_3430927_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_044390836.1|3430928_3432866_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207919.1|3432862_3433513_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|3433512_3434076_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|3434059_3434521_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140442.1|3434571_3434961_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3435016_3436231_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3436254_3437262_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3437419_3439564_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143992.1|3439563_3441270_-|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|3441250_3442057_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001283921.1|3442456_3442714_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001505200.1|3442710_3443208_-	KilA-N domain-containing protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
WP_071535903.1|3443429_3443636_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	2.1e-11
WP_000622438.1|3443863_3443998_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
WP_001056876.1|3444012_3444579_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
WP_000087461.1|3444853_3445387_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3445391_3445607_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290231.1|3445683_3445956_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3445996_3446176_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_060722694.1|3446312_3448250_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.5	0.0e+00
WP_000738068.1|3448736_3449006_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3449017_3449977_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3450760_3451195_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3451187_3451382_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3451378_3451984_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004009.1|3451983_3452706_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
WP_000290549.1|3452780_3453458_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	100.0	4.3e-130
WP_001254256.1|3453732_3453915_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3453911_3454439_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3454435_3454882_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3454838_3455075_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3455085_3455301_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001036036.1|3455386_3455656_-	hypothetical protein	NA	A0A0P0ZCF7	Stx2-converting_phage	100.0	4.9e-45
WP_023439153.1|3455656_3458563_-	toprim domain-containing protein	NA	A0A0P0ZC72	Stx2-converting_phage	99.4	0.0e+00
WP_000062356.1|3458670_3459447_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	94.2	1.9e-129
WP_000438533.1|3459609_3459906_-	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_001180318.1|3460044_3460272_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3460350_3461058_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3461118_3461460_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|3461527_3461989_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3461982_3463029_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3463031_3463196_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|3463684_3464068_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3464126_3464597_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|3464747_3465116_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|3465188_3465353_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|3465321_3465465_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3465540_3465837_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3465842_3466628_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3466624_3467305_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3467301_3467484_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3467456_3467648_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3467658_3467940_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763383.1|3468038_3468260_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289935.1|3468256_3469030_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000797281.1|3469181_3469370_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|3469371_3469581_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000208030.1|3469577_3470420_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	67.2	5.8e-100
WP_000969528.1|3470416_3470677_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	96.5	7.8e-40
WP_000002093.1|3470676_3470961_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	3.5e-49
WP_001303965.1|3471032_3471332_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3471417_3471702_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3471754_3473065_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3473061_3473640_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3473660_3473888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3473925_3475167_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3476974_3477895_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3477894_3478200_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3478353_3478953_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3478949_3481496_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3481495_3482668_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3482797_3483490_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3483462_3484491_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|3487389_3488463_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3488511_3488646_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3488673_3488904_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3488878_3489067_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3489077_3489290_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3489575_3489788_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3490229_3490535_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3490641_3491286_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3491282_3492029_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3492028_3494125_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3494170_3495310_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3495297_3495744_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3495763_3497944_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3498063_3499368_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3499447_3499540_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3499552_3500689_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3500700_3502245_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3502378_3503236_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3503232_3503631_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3503627_3504215_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3504211_3504919_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3504937_3506731_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3505562:3505577	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3506727_3507846_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3510119_3510389_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3510390_3511704_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3511768_3512368_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3512435_3515909_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3516042_3516570_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_074460437.1|3516760_3517393_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	1.9e-103
WP_000194720.1|3517338_3518082_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_060722696.1|3518092_3518791_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000847304.1|3518790_3519120_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|3519116_3521696_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|3521676_3522090_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3522116_3522548_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3522561_3523302_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3523283_3523550_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3523607_3523955_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3523991_3525497_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3525486_3527079_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3527075_3527282_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3529456_3530995_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3531044_3531392_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3531388_3531769_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3531844_3532120_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3532870_3533077_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3533332_3533605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3533764_3534298_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3534518_3534632_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3534853_3535039_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3535566_3535881_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3537237_3539088_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3539855_3540569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3541189_3542008_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3542159_3542531_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3542520_3542892_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3542904_3543954_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3543955_3544234_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3544401_3544557_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3544658_3544796_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3545161_3545935_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3546286_3546700_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3546715_3547486_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3547507_3548254_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3548260_3549352_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3549430_3549886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3550092_3550518_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3550501_3550774_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3550882_3551284_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3551311_3551503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3551502_3551790_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3552067_3552223_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3552364_3552754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3552940_3553126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3553699_3553888_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3553884_3554076_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3554169_3556641_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3556708_3556951_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3556928_3557948_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3558355_3559015_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3560780:3560795	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 11
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	3789966	3828063	5459302	integrase,terminase,protease,lysis,holin,portal,tail	Enterobacteria_phage(51.16%)	50	3789551:3789565	3828137:3828151
3789551:3789565	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3789966_3790665_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3790895_3791777_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3791946_3792108_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3792604_3793624_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3793657_3794638_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3794814_3795084_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3795085_3796402_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3796461_3797061_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3797131_3800545_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3800605_3801214_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3801150_3801894_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3801899_3802598_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3802607_3802937_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3802936_3806002_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3805973_3806303_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3806311_3806698_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3806758_3807502_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3807512_3807914_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3807910_3808489_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3808500_3808776_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3808768_3809092_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3809178_3811206_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3811150_3811486_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3811607_3812732_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3812659_3812872_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3812868_3814971_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3814970_3815462_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3816136_3816289_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3816276_3816744_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3816740_3817238_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3817237_3817453_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3817595_3817994_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3818074_3818233_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3818318_3819062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3819245_3819935_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3819949_3820072_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3820409_3821369_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3821580_3822246_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3822242_3822863_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3822855_3823026_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3823022_3823205_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3823902_3824583_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3824579_3824762_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3824734_3824926_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3824936_3825218_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3825316_3825538_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3825748_3826351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3826593_3826761_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3826800_3827019_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3827292_3828063_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3828137:3828151	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	4371276	4422882	5459302	tail,transposase,integrase	Enterobacteria_phage(34.78%)	56	4364433:4364449	4420328:4420344
4364433:4364449	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|4371276_4372815_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4372864_4373212_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4373208_4373589_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4373852_4374116_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4374115_4374256_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4374325_4374517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4375341_4375884_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4375958_4376546_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4376603_4377272_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4377297_4379823_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4379812_4381456_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4381424_4382135_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4382447_4382777_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4383024_4383639_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4384056_4384746_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4384742_4385699_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4385695_4387894_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4387903_4388860_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4389038_4390166_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4390307_4391366_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4391611_4392514_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4393216_4393495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4393661_4394384_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4394482_4395382_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4396057_4397014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4397146_4399480_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4399493_4399817_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4399816_4400038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4400034_4400592_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4400588_4400849_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4401782_4402535_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4402531_4403083_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4403088_4403361_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4403770_4404337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4404336_4404927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4404957_4405590_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4405582_4406041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4406040_4406658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4406630_4407047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4407050_4408232_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4409194_4409938_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4410761_4411535_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4411592_4412147_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4412176_4412587_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4412607_4413051_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4413022_4413616_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4413615_4414410_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4414409_4414721_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4415672_4415966_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4416084_4416285_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4416385_4417099_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4417226_4417616_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4417855_4418101_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4419170_4420424_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4420328:4420344	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4420435_4421539_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4421826_4422882_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 13
NZ_CP038405	Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome	5459302	4441668	4464397	5459302	plate,transposase	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_000027427.1|4441668_4442841_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4442921_4443107_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4443021_4443285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4443486_4445247_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4445249_4446386_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001478139.1|4447131_4447707_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4447775_4451990_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4452065_4454207_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4454416_4454935_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4455631_4456132_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4456166_4456391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4456441_4457833_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4457923_4458337_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4458340_4460191_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4460154_4461237_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4461261_4462542_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4462538_4463063_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4463065_4464397_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038406	Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence	92740	49396	58188	92740	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	45966:45979	52554:52567
45966:45979	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|49396_50203_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|50925_52139_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|52100_52439_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|53026_54193_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
52554:52567	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|54192_55164_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|56463_58188_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
