The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	1230303	1243740	5362528	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1230303_1230915_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230911_1231577_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231573_1232197_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232449_1233193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1233278_1233446_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233853_1235707_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235856_1236072_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1236076_1236421_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236777_1237158_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1237154_1237502_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1238119_1238389_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238549_1238972_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239101_1240160_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1240238_1240889_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241071_1241662_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242163_1242412_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1243257_1243740_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	1521322	1526748	5362528	integrase	Enterobacteria_phage(50.0%)	6	1510310:1510326	1528944:1528960
1510310:1510326	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1521322_1521892_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521891_1522359_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1522345_1523026_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523035_1524172_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1524346_1525504_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525815_1526748_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528944:1528960	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	1772437	1849326	5362528	head,capsid,tRNA,tail,lysis,holin,portal,terminase	Enterobacteria_phage(42.67%)	86	NA	NA
WP_000569336.1|1772437_1773364_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1773368_1774100_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774080_1774188_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774247_1774949_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1774969_1776256_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1776289_1776544_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1776562_1776697_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1776700_1776943_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1777030_1777393_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1777389_1777746_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1778079_1778256_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1778257_1779205_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1779201_1779423_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1779521_1779803_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1779813_1780005_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1779977_1780160_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1780159_1780837_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1780833_1781619_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1781624_1781921_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1781996_1782287_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1782790_1784398_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1784504_1785197_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1785560_1786100_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1786096_1787116_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1787112_1787814_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1787810_1788095_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1788322_1788520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1788563_1788845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1788935_1789037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1789033_1789489_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1789488_1789659_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1789651_1789942_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1789938_1790301_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1790297_1790438_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1790523_1790958_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000691354.1|1791464_1792412_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1792421_1792691_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142999.1|1793190_1795128_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000143458.1|1795264_1795444_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1795484_1795757_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1795833_1796049_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|1796048_1796546_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1796542_1796980_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1797182_1797680_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1797676_1797934_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1798396_1798624_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|1798665_1799031_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958387.1|1799322_1799886_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1799882_1801544_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_096980770.1|1801607_1803545_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|1803589_1803811_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171878313.1|1803756_1806498_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	94.1	0.0e+00
WP_000125988.1|1806500_1806827_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1806836_1807187_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1807183_1807630_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1807626_1807971_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1808036_1808753_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1808767_1809142_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1809237_1809447_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212827.1|1809498_1812741_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1812733_1813075_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1813074_1813773_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1813789_1814110_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1814217_1814391_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1814461_1815385_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1815438_1816176_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1816121_1816754_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|1817013_1820493_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230468.1|1820559_1821159_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_000268876.1|1821223_1822537_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|1822538_1822808_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_072142879.1|1822968_1823385_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1823466_1824108_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1824269_1824518_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1825032_1826718_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1826714_1827434_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1827480_1827951_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1827992_1828454_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1828578_1830582_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1830578_1831715_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1831707_1832439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1832457_1833987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1833997_1835086_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1836326_1836644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1836705_1840335_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1847292_1849326_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	1874951	1913007	5362528	head,integrase,capsid,plate,tRNA,tail,lysis,holin,portal,terminase	Escherichia_phage(63.64%)	49	1876732:1876759	1908681:1908708
WP_000807362.1|1874951_1875851_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1876256_1876574_+	hypothetical protein	NA	NA	NA	NA	NA
1876732:1876759	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985259.1|1876815_1877841_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	3.9e-191
WP_000020919.1|1877956_1878256_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1878377_1878653_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1878663_1878834_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1878830_1879331_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1879394_1879619_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1879618_1879918_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1879920_1880145_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1880141_1880417_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1880406_1882689_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1882778_1884002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1884048_1884501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1884500_1886468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1886785_1887820_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1887819_1889592_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1889765_1890620_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1890678_1891752_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1891755_1892499_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1892598_1893108_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1893107_1893311_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1893314_1893596_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1893595_1894093_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1894107_1894533_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1894520_1894946_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000917144.1|1895053_1895521_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1895513_1895966_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1896032_1896668_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1896664_1897012_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1897016_1897925_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1897917_1898529_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217053.1|1898525_1899725_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001008233.1|1899745_1900189_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1900160_1900763_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1900762_1901296_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1901323_1901917_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1901976_1903167_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1903179_1903698_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1903754_1904030_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1904062_1904182_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1904174_1906622_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1906636_1907116_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1907115_1908279_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1908360_1908579_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1908852_1910214_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1908681:1908708	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1910361_1910694_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1910884_1911607_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1911603_1913007_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	1996231	2079242	5362528	head,integrase,capsid,tail,holin,portal,terminase,transposase	Escherichia_phage(32.08%)	80	1992849:1992863	2039319:2039333
1992849:1992863	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1996231_1997410_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1997390_1997582_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_096980766.1|1997659_1997950_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.0	1.0e-48
WP_162829202.1|1998010_1999223_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023353.1|1999429_1999699_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_000491542.1|1999839_2000715_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2000939_2001590_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2002914_2004081_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2004199_2004673_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2004871_2005930_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2006101_2006431_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2006531_2006714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001417247.1|2007116_2009264_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2010711_2012250_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2012299_2012647_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2012643_2013024_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2013385_2013931_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2013927_2014671_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2014682_2015762_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2015823_2016759_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2017215_2018133_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2018234_2019185_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2019302_2020946_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532910.1|2021571_2022288_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|2023516_2024729_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000378596.1|2025500_2026817_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2027130_2028183_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2028444_2036427_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2036916_2037714_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2037949_2038972_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2038971_2039175_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|2039233_2041705_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2039319:2039333	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2041800_2041989_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2041985_2042174_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2042654_2042807_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2043081_2043726_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2043823_2044051_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2044047_2044473_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2044541_2045579_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2045490_2046033_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2046067_2046766_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2046787_2047012_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2047008_2047365_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2047397_2047550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2047546_2047858_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2047984_2048548_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2048657_2048762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2048949_2049162_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2049329_2049608_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000904141.1|2050669_2051029_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2051025_2051715_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2053254_2055105_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2055186_2056400_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2056710_2056926_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2056930_2057275_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2057325_2057859_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2058014_2058197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2058209_2058341_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2058568_2058754_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2059280_2059595_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2059676_2059901_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2060295_2060805_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2062689_2062896_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2062892_2064485_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2064474_2065980_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2066016_2066364_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2066421_2066688_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2066669_2067410_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2067423_2067855_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2067881_2068295_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2068275_2070138_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_134790849.1|2070089_2070854_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|2070850_2071180_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060722696.1|2071179_2071878_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000194760.1|2071888_2072632_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_122995769.1|2072577_2073207_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	2.1e-102
WP_171878314.1|2073447_2076927_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	99.0	0.0e+00
WP_001230508.1|2076993_2077593_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268876.1|2077657_2078971_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|2078972_2079242_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
>prophage 6
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	2136821	2156807	5362528	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	2149943:2149956	2159949:2159962
WP_032161583.1|2136821_2137958_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2137908_2138232_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2138389_2139574_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2139573_2140086_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2140140_2140506_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2140514_2140670_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2143472_2143961_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2144117_2144690_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2144733_2145264_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2146355_2146670_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2146674_2147634_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2147710_2150533_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2149943:2149956	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2150539_2150905_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2150901_2151519_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2151530_2151830_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2151826_2152093_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2152089_2152293_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2152316_2152733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2152825_2152939_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2152935_2153178_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2153189_2153468_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2153478_2153829_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2153850_2154054_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2154125_2154263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2154352_2154757_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2154772_2155423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2155452_2155800_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2155805_2156807_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2159949:2159962	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	2477353	2577237	5362528	head,protease,capsid,tail,holin,portal,terminase	Escherichia_phage(29.17%)	123	NA	NA
WP_001260835.1|2477353_2478175_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2478274_2478358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2478450_2478786_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2479182_2480436_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2480542_2481436_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2481570_2482791_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2482915_2483611_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2483563_2484856_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2485013_2485628_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2485670_2486525_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2486526_2487144_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2487154_2489578_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2489638_2492065_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2492263_2492569_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_078168192.1|2492676_2493387_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2493389_2493950_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2493984_2494326_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2494460_2494787_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2495775_2496027_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2496099_2498571_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2498663_2498855_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2498851_2499040_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2499440_2499605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2499608_2499827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072143447.1|2499898_2500198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2500550_2500829_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2500830_2501022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2501042_2501414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2501511_2501814_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2501810_2502236_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2502258_2503221_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2503227_2503968_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001304151.1|2503993_2504173_+	hypothetical protein	NA	A0A088CE47	Shigella_phage	88.9	5.6e-13
WP_001118159.1|2504777_2505173_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2505229_2505814_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2505929_2506034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2506222_2506435_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2506602_2506881_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_171878315.1|2506882_2507932_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	6.5e-109
WP_001217455.1|2507944_2508304_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2508300_2508990_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2509626_2510055_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2510533_2512384_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2512823_2513039_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2513043_2513388_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2513438_2513972_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2514242_2514812_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2514811_2514958_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2515185_2515371_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2515795_2516023_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2516064_2516430_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958396.1|2516720_2517284_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_096980770.1|2519004_2520942_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|2520986_2521208_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2521153_2523655_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2523734_2524061_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2524070_2524421_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2524417_2524864_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2524860_2525205_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2525263_2525980_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2525985_2526360_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2526455_2526665_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|2526717_2529960_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|2529952_2530294_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2530293_2530731_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_001416688.1|2532821_2533160_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2533551_2533794_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2533777_2534203_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2534271_2535315_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2535307_2535769_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2535802_2536519_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2536551_2536833_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2536829_2537057_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2537049_2537361_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2537488_2537707_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2537708_2538266_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2538499_2538712_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2538831_2539176_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2539297_2539570_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2539571_2540621_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2540633_2540939_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2541001_2541556_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2541780_2541978_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2542113_2542827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2543277_2543709_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2544186_2546037_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2546475_2546691_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2546695_2547040_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2547090_2547624_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2547894_2548464_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2548463_2548610_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2548832_2549018_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2549543_2549858_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2549939_2550164_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2550550_2551096_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2551070_2552996_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2552992_2553199_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2553195_2554797_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2554777_2556097_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2556106_2556439_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2556494_2557520_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2557561_2557960_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2557971_2558325_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2558339_2558873_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2558869_2559265_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2559272_2560025_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2560038_2560461_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_032173694.1|2560589_2563127_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.0	0.0e+00
WP_000847298.1|2563123_2563453_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2563452_2564151_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2564161_2564905_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|2564850_2565480_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171878316.1|2565720_2569200_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_001230508.1|2569267_2569867_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878317.1|2569931_2571245_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.9	4.5e-83
WP_001023407.1|2571246_2571516_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2571629_2572205_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2572277_2572907_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2572988_2573630_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2573791_2574034_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2574165_2575449_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2575537_2576998_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2577033_2577237_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	2848847	2924379	5362528	head,protease,integrase,capsid,tail,holin,portal,terminase,transposase	Stx2-converting_phage(33.93%)	84	2864349:2864376	2924516:2924543
WP_000422055.1|2848847_2849897_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2850116_2850875_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2850871_2851462_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2851501_2852374_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2852586_2854170_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2854197_2854818_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2854814_2855696_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2855833_2855878_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2855969_2857532_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2857531_2859127_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983858.1|2859127_2860489_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2860500_2861694_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2861693_2862500_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2862880_2863060_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2863145_2863646_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2863691_2864198_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2864349:2864376	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2865511_2866162_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2867668_2868259_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2868442_2869090_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2869226_2869373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2869800_2870079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2870418_2870799_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2870795_2871143_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2871192_2872731_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2873696_2874266_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2874331_2875243_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2875349_2875472_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2877069_2878395_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2879422_2879692_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216533.1|2879693_2881007_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.7	4.6e-80
WP_001228304.1|2881158_2881758_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2881825_2884171_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2884122_2885298_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2885640_2886273_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2886218_2886962_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001152184.1|2886972_2887671_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2887670_2888012_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234948.1|2888004_2891247_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|2891299_2891509_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2891604_2891979_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2891984_2892701_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2892759_2893104_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2893100_2893547_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2893543_2893894_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2893903_2894230_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2894309_2896811_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2896756_2896978_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_096980770.1|2897022_2898960_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_000958387.1|2900681_2901245_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|2901535_2901901_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2901942_2902170_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2902594_2902780_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2903007_2903154_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2903153_2903723_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2903993_2904527_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2904577_2904922_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2904926_2905142_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2905291_2907145_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2907941_2909000_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2909150_2909348_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2909589_2910120_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2910128_2910488_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2910500_2911547_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2911548_2911827_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2911896_2912154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2912374_2912587_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2912865_2913624_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2914322_2914487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2914483_2915065_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2915251_2915794_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2915705_2916746_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2916717_2917269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2917252_2917480_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2917556_2917964_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2918227_2918527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2918599_2918818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2918840_2919248_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2919225_2919459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2919452_2919620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2920017_2920206_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2920202_2920394_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2920486_2922958_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2923022_2923271_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2923248_2924379_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2924516:2924543	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	2971075	3079515	5362528	head,protease,integrase,capsid,tRNA,tail,lysis,holin,portal,terminase,transposase	Enterobacteria_phage(50.0%)	109	3020565:3020624	3075711:3077020
WP_001299679.1|2971075_2972332_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2972545_2973169_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2973168_2974020_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2974170_2975118_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2975242_2976922_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2976976_2977255_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2977532_2978117_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2978233_2979325_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|2980168_2983054_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|2983153_2985073_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|2985300_2986371_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2986381_2987014_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2987024_2988443_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|2990474_2990675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|2990782_2991805_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2991804_2992785_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2992781_2993540_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|2994358_2995213_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2995238_2997209_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2997258_2997513_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|2998361_2999574_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|2999762_3000374_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3000473_3001388_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3001483_3003220_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3003612_3004683_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3004692_3005991_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3006353_3007886_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3007937_3008657_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3008878_3010420_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3010565_3011096_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3011141_3012410_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3012409_3012829_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3013201_3014113_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3014319_3014781_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3014857_3015517_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3015588_3015882_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3015893_3016052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3016122_3016524_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3016626_3016995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3017514_3018210_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3018233_3019046_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3019049_3019316_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024183435.1|3019687_3020539_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
3020565:3020624	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|3020618_3021831_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001201843.1|3022398_3023352_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3023538_3025023_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3025325_3026864_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3026913_3027261_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3027257_3027638_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3027713_3027962_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3028018_3028687_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3029184_3029367_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3029445_3029946_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3029982_3030489_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000885630.1|3031517_3032099_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3032098_3035014_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3035078_3035678_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_171878318.1|3035744_3039143_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090920.1|3039203_3039836_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3039772_3040516_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3040521_3041220_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3041219_3041549_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3041545_3044095_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3044087_3044522_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3044503_3044926_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3044941_3045682_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683120.1|3045689_3046085_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000752995.1|3046670_3047024_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3047035_3047434_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3047475_3048501_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3048556_3048889_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3048898_3050218_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3050198_3051800_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3051796_3052003_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3051999_3053925_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3053899_3054445_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3054833_3055028_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3055192_3055399_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3055684_3056095_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3056386_3056680_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3056770_3056953_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3057169_3057646_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3057632_3057938_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3058259_3058949_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3058945_3059086_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3059082_3059445_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3059441_3059732_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3059724_3059895_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3059894_3060350_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3060851_3062378_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3062435_3062558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3062622_3062955_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3063022_3063325_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3063321_3064023_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3064947_3065184_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3065173_3066316_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3066429_3067680_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3067851_3068505_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3068514_3068976_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3069029_3070136_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3070171_3070813_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3070816_3072187_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3072355_3073027_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3073026_3074487_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3075087_3075369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3075764_3076977_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000224603.1|3077685_3078099_-	hypothetical protein	NA	NA	NA	NA	NA
3075711:3077020	attR	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAGCGGGCGATTCGTATGGTTCTGGAAAGTCAGGATGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGTGGGCTCACCAGCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCACGACGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_000380883.1|3078111_3078447_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3078459_3079515_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	3085617	3142953	5362528	head,integrase,capsid,tail,holin,portal,terminase	Stx2-converting_phage(25.0%)	71	3128520:3128540	3149610:3149630
WP_000085256.1|3085617_3086847_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3087095_3088217_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3088265_3089492_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3089741_3090878_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3090861_3091725_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3092088_3093450_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3093510_3093786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3096094_3099496_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3100086_3102435_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3102454_3102544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3102556_3102793_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3102738_3103476_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3103529_3104408_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3104710_3104821_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3104930_3105185_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152184.1|3105201_3105900_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|3105899_3106241_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234948.1|3106233_3109476_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|3109528_3109738_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3109833_3110208_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3110213_3110930_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3110988_3111333_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3111329_3111776_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3111772_3112123_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3112132_3112459_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3112538_3115040_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3114985_3115207_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_096980770.1|3115251_3117189_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001301491.1|3117252_3118914_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3118910_3119474_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3119764_3120130_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_032173704.1|3120171_3120357_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000347013.1|3120486_3120627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3120983_3121208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3121272_3121479_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3121706_3121853_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3121852_3122422_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3122692_3123226_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3123276_3123621_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3123625_3123841_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3123916_3124186_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3124223_3124406_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3124553_3126491_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3126805_3126973_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3127569_3128391_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3128387_3128762_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3128520:3128540	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3128774_3129824_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3129825_3130104_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3130271_3130484_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3130672_3130777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3130892_3131480_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3131482_3131674_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3131675_3132113_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3132099_3132417_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3132370_3132688_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3132677_3132980_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3132976_3133258_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3133290_3134007_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3134040_3134583_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3134494_3135532_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3135600_3136026_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3136009_3136333_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3136457_3136934_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3137249_3137402_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3137516_3138032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3138164_3138554_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3138615_3138885_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3138853_3139972_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3140138_3140933_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3140929_3141976_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3142131_3142953_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3149610:3149630	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	3395098	3448165	5362528	head,protease,integrase,capsid,tail,holin,portal,terminase,transposase	Escherichia_phage(27.5%)	59	3397033:3397048	3449930:3449945
WP_000003653.1|3395098_3395686_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3395682_3396390_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3396408_3398202_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3397033:3397048	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3398198_3399317_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3401449_3401719_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3401720_3403034_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3403098_3403698_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_149025607.1|3403765_3406111_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_072618954.1|3406062_3407238_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_000649829.1|3407371_3407899_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_149025606.1|3408089_3408722_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	1.8e-101
WP_054191786.1|3408667_3409411_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_001151105.1|3409421_3410120_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3410119_3410449_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032106087.1|3410445_3413025_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000533402.1|3413005_3413419_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3413445_3413877_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3413890_3414631_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3414612_3414879_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3414936_3415284_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3415320_3416826_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3416815_3418408_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3418404_3418611_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3420495_3421005_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000411791.1|3421755_3421962_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3422217_3422490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3422649_3423183_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3423403_3423517_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3423738_3423924_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3424451_3424766_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3424970_3426184_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000261909.1|3429005_3429719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3430339_3431158_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3431309_3431681_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3431670_3432042_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3432054_3433104_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3433105_3433384_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3433551_3433707_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3433808_3433946_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3434311_3435085_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3435436_3435850_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3435865_3436636_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3436657_3437404_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3437410_3438502_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3438580_3439036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3439242_3439668_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3439651_3439924_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3440032_3440434_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3440461_3440653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3440652_3440940_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3441217_3441373_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3441514_3441904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3442090_3442276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3442849_3443038_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3443034_3443226_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3443319_3445791_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3445858_3446101_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3446078_3447098_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3447505_3448165_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3449930:3449945	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	3679098	3713693	5362528	protease,integrase,tail,lysis,holin,portal,terminase,transposase	Enterobacteria_phage(47.37%)	45	3678683:3678697	3713767:3713781
3678683:3678697	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3679098_3679797_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3680027_3680909_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3681077_3681239_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3681735_3682755_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3682788_3683769_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3683945_3684215_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3684216_3685533_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3685592_3686192_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_171878319.1|3686262_3689676_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090841.1|3689736_3690345_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3690281_3691025_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3691030_3691729_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3691738_3692068_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_162829202.1|3692932_3694146_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001283151.1|3694171_3694402_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	100.0	7.2e-29
WP_001097050.1|3694394_3694718_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3694804_3696832_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3696776_3697112_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_072187152.1|3697233_3698358_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_001072975.1|3698285_3698498_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3698494_3700597_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3700596_3701088_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3701762_3701915_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3701902_3702370_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3702366_3702864_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3702863_3703079_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3703221_3703620_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3703700_3703859_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3703944_3704688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3704871_3705561_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3705575_3705698_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3706035_3706995_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3707206_3707872_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3707868_3708489_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3708481_3708652_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3708648_3708831_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3709528_3710209_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3710205_3710388_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3710360_3710552_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3710562_3710844_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3710942_3711164_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3711374_3711977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3712219_3712387_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3712426_3712645_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3712622_3713693_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3713767:3713781	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	4256878	4356933	5362528	integrase,tail,transposase,plate	Enterobacteria_phage(24.14%)	95	4283402:4283420	4343120:4343138
WP_000998048.1|4256878_4258417_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4258466_4258814_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4258810_4259191_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4259454_4259718_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4259717_4259858_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4259927_4260119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4260943_4261486_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4261560_4262148_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4262205_4262874_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4262899_4265425_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001301550.1|4267026_4267737_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4268049_4268379_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4268626_4269241_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4269658_4270348_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4270344_4271301_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667050.1|4271297_4273496_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.8e-39
WP_000121344.1|4273505_4274462_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4274640_4275768_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4275909_4276968_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4277213_4278116_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4278818_4279097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4279263_4279986_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4280084_4280984_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4281659_4282616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4282748_4285082_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4283402:4283420	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4285095_4285419_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4285418_4285640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4285636_4286194_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4286190_4286451_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4287384_4288137_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4288133_4288685_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4288690_4288963_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4289372_4289939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4289938_4290529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4290559_4291192_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4291184_4291643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4291642_4292260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4292232_4292649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4292652_4293834_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4294796_4295540_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4296363_4297137_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_162829202.1|4297740_4298953_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001115552.1|4299091_4299502_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	93.3	7.0e-59
WP_162829202.1|4299504_4300718_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000344820.1|4300835_4301279_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4301250_4301844_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4301843_4302638_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4302637_4302949_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4303900_4304194_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4304312_4304513_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4304613_4305327_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_001303805.1|4306501_4306747_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4307816_4309070_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4309081_4310185_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_162829202.1|4311162_4312375_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000174701.1|4312879_4313281_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4313338_4314583_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4314674_4315133_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4315393_4316851_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4316907_4317465_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4317376_4317643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4317949_4318402_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4318411_4318810_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4318812_4319106_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4319157_4320213_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4320283_4321069_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4321013_4322753_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4323570_4324344_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4324529_4324790_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4324808_4325069_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4325224_4325965_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4325935_4326703_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4326807_4327386_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4327625_4330070_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4330112_4330586_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4330739_4331510_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4331627_4332800_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4332880_4333066_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4332980_4333244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4333445_4335206_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4335208_4336345_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356741.1|4337090_4337678_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4337746_4339255_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000509109.1|4340293_4344526_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
4343120:4343138	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103335.1|4344601_4346743_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4346952_4347471_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4348167_4348668_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4348702_4348927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4348977_4350369_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4350459_4350873_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4350876_4352727_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4352690_4353773_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4353797_4355078_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4355074_4355599_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4355601_4356933_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	4795124	4854135	5362528	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4795124_4796477_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4796570_4797122_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4797277_4798651_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4798826_4799825_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4799857_4800853_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4800839_4801862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4801875_4803378_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4803517_4804474_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4804783_4805314_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4805393_4805744_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4805737_4805989_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4806200_4806542_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4806544_4810324_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4810320_4812054_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4812259_4812898_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4813220_4814564_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4814642_4814849_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4815173_4815728_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4815790_4816729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4816940_4817681_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4817870_4819814_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4819931_4820312_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4820400_4821261_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4821368_4822334_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4822441_4823104_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4823148_4824561_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4824869_4825490_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4825707_4826346_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4826480_4827689_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4827696_4828128_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4828750_4829545_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4829615_4830065_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4830106_4830334_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4830338_4830653_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4830659_4831055_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4831381_4831657_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4831785_4832472_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4832471_4833326_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4833335_4833986_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4833999_4834464_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4834473_4834779_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4834794_4836192_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4837718_4838474_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4838470_4839220_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4839401_4839731_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4839879_4840155_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4840271_4841897_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4841980_4843144_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4843146_4843785_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4843794_4844193_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4844210_4844870_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4844920_4845619_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4845637_4846039_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4846165_4846897_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4847077_4849519_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4849557_4849983_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4850187_4851486_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4851589_4851787_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4851868_4852873_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4852875_4854135_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038398	Escherichia coli O157:H7 strain DEC4E chromosome, complete genome	5362528	4991003	5005668	5362528	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	19	4986844:4986859	5004373:5004388
4986844:4986859	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|4991003_4992419_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|4992501_4993485_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4993650_4993893_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|4994026_4995064_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4995152_4996250_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217542.1|4996311_4996560_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143817.1|4996720_4997362_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_072140863.1|4997443_4998073_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|4998145_4998718_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|4998829_4999099_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_064234994.1|4999100_5000414_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001230302.1|5000478_5001078_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_000008211.1|5002399_5002936_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5002926_5003277_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5003273_5003558_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5003893_5004091_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5004435_5004717_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5004373:5004388	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5004764_5004938_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5005134_5005668_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
