The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	883048	952834	5303225	integrase,tRNA,transposase,protease	Enterobacteria_phage(26.67%)	56	904252:904269	949914:949931
WP_001016260.1|883048_883795_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.2	1.0e-23
WP_001359388.1|883809_885351_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	6.4e-129
WP_032175509.1|886190_886559_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|886632_886854_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|886916_887393_-	RadC family protein	NA	NA	NA	NA	NA
WP_000213700.1|887407_887893_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.4e-13
WP_001234731.1|887983_888802_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.3e-45
WP_001323397.1|888956_889115_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_085959019.1|889235_890449_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000236756.1|891327_891522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221524.1|891721_892291_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270999.1|892458_892842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013320.1|892838_893264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001369053.1|893508_893706_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000624681.1|895743_896094_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422686.1|896090_896516_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_171877830.1|897169_898060_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_139371347.1|898058_899271_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
904252:904269	attL	ATCTTCAAGATAGGTATA	NA	NA	NA	NA
WP_000609742.1|910028_910703_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|910751_911741_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_001121624.1|912349_913999_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_001453071.1|916232_916406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418170.1|916979_917528_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.0	3.7e-15
WP_000631719.1|919849_920197_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001358695.1|920193_920868_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	2.4e-11
WP_001218883.1|921858_923124_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.9e-76
WP_000234485.1|923502_924210_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839816.1|924607_926743_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|926792_928049_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001302020.1|928250_929330_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|929394_929670_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001301529.1|929697_930750_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786908.1|930910_931630_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107568.1|931629_931956_+	YggL family protein	NA	NA	NA	NA	NA
WP_000394102.1|933035_934082_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745247.1|934198_935206_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239959.1|935448_936585_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174762.1|936577_937171_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277224.1|937178_937469_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|937465_938032_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|938049_938754_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055622.1|938771_939752_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017110.1|939942_940359_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|940358_940922_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593272.1|941033_941981_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|941993_942725_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286494.1|942804_943512_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|943606_944104_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001418166.1|944180_945575_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|946011_947166_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|947469_947685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|947820_947952_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|947960_949937_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
949914:949931	attR	TATACCTATCTTGAAGAT	NA	NA	NA	NA
WP_000758914.1|950082_950814_+	lipoprotein	NA	NA	NA	NA	NA
WP_000105566.1|950949_951870_+	agmatinase	NA	NA	NA	NA	NA
WP_000701842.1|952075_952834_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	1568965	1641682	5303225	plate,holin,capsid,head,tail,tRNA,integrase,portal,terminase	Enterobacteria_phage(76.47%)	83	1596105:1596137	1645725:1645757
WP_000950857.1|1568965_1569535_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403518.1|1569534_1570002_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000960724.1|1569988_1570669_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1570678_1571815_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1571989_1573147_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1573458_1574391_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|1574684_1575440_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000952959.1|1575834_1576866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1577230_1578571_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1578942_1579227_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531971.1|1579406_1580717_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426144.1|1580716_1582861_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1583063_1583549_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1584194_1584758_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112843.1|1584839_1587479_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182853.1|1587501_1588260_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675437.1|1588270_1588771_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822671.1|1588767_1589238_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1589234_1589756_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1589757_1590600_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1590770_1591322_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1591487_1592420_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1592454_1593540_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043835.1|1593543_1594368_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1594367_1595177_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1595176_1595725_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1595758_1596037_+	YfcL family protein	NA	NA	NA	NA	NA
1596105:1596137	attL	CGTAGGTCGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_000683769.1|1596157_1598164_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1598322_1599543_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1599817_1600996_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615820.1|1600992_1601988_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001173927.1|1603151_1603484_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1603745_1603886_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1604076_1604337_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000532200.1|1604528_1605551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132824.1|1605671_1606781_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	6.3e-195
WP_000005429.1|1606938_1608123_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	1.1e-221
WP_000290450.1|1608122_1608635_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665304.1|1608689_1609055_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.1e-55
WP_000333495.1|1609063_1609219_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853419.1|1609205_1612013_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.2	0.0e+00
WP_000979936.1|1612025_1612514_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
WP_000905075.1|1612540_1613140_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	1.2e-86
WP_001174924.1|1613568_1614009_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	4.4e-51
WP_000189502.1|1613980_1614583_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	2.3e-95
WP_000217014.1|1614582_1616217_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.8	6.3e-143
WP_000071724.1|1616213_1616822_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111942.1|1616814_1617711_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_001067548.1|1617714_1618044_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001418080.1|1618061_1618628_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	3.3e-99
WP_000356344.1|1618639_1619275_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920585.1|1619267_1619735_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.5e-84
WP_000780572.1|1619872_1620280_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|1620276_1620669_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1620665_1620989_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1620991_1621192_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|1621191_1621686_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632332.1|1621787_1622588_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_001055118.1|1622633_1623686_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_001262673.1|1623709_1624546_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613767.1|1624700_1626452_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.1	0.0e+00
WP_000087814.1|1626451_1627498_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|1627512_1628037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390707.1|1628598_1628868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|1629232_1629544_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000686544.1|1629548_1630508_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000123486.1|1630532_1633391_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.7	0.0e+00
WP_000599394.1|1633397_1633763_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	2.5e-60
WP_157999962.1|1633759_1634323_-	ash family protein	NA	S5MQL6	Escherichia_phage	45.7	6.3e-10
WP_000104315.1|1634334_1634634_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	4.0e-40
WP_000153703.1|1634630_1634897_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	2.6e-30
WP_000985157.1|1634893_1635097_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000021652.1|1635183_1635297_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|1635293_1635536_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158965.1|1635547_1635835_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
WP_000813363.1|1635845_1636187_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|1636439_1636646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1636652_1636940_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1637053_1637374_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023404.1|1637470_1638475_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	5.8e-99
WP_000004831.1|1638633_1639791_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.2e-24
WP_001289167.1|1639856_1640870_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1640869_1641682_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1645725:1645757	attR	CGTAGGTCGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
>prophage 3
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	1865458	1874904	5303225		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1865458_1866385_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1866389_1867121_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1867101_1867209_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1867268_1868000_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001359340.1|1868221_1869907_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1869903_1870623_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1870669_1871140_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1871181_1871643_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1871767_1873771_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359338.1|1873767_1874904_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 4
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	2036080	2113246	5303225	holin,capsid,head,tail,transposase,integrase,portal,protease,terminase	Enterobacteria_phage(40.48%)	71	2029246:2029261	2094302:2094317
2029246:2029261	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085959019.1|2036080_2037294_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000502860.1|2037720_2038359_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_000966626.1|2038729_2040877_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|2042548_2043094_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2043090_2043834_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2043845_2044925_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986329.1|2044986_2045922_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011473.1|2046378_2047296_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2047397_2048348_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2050734_2051451_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2051793_2053248_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2053349_2054666_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2054980_2056033_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2064766_2065564_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533624.1|2065799_2066825_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	6.4e-101
WP_000096344.1|2066824_2067028_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048395.1|2067086_2069558_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	6.5e-59
WP_001090200.1|2069650_2069842_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2069838_2070027_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_138989205.1|2070427_2070592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171966.1|2070595_2070814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379578.1|2070973_2071129_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000381212.1|2071297_2071705_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2071785_2072013_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2071996_2072518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054492.1|2072498_2073464_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151189.1|2073504_2073906_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_115203268.1|2074277_2075732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546200.1|2076774_2076882_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000813254.1|2076984_2077140_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004956.1|2077305_2077956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2077936_2079040_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077629088.1|2079194_2079455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2079524_2079803_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265207.1|2079804_2080854_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	1.8e-111
WP_001217436.1|2080866_2081238_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2081227_2081599_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265266.1|2081752_2082571_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261910.1|2083191_2083905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874327.1|2084672_2086523_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411813.1|2086815_2087022_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2087026_2088016_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092850.1|2088058_2088592_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|2089146_2089233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2089454_2089640_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000736383.1|2089725_2089950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347012.1|2090306_2090444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2090580_2090766_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235441.1|2091167_2091677_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.2	3.6e-12
WP_001418004.1|2091648_2093577_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2093560_2093767_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2093763_2095356_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
2094302:2094317	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001253994.1|2095345_2096851_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256723.1|2096887_2097235_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|2097292_2098321_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2098372_2098756_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2098748_2099102_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974985.1|2099117_2099651_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|2099647_2100043_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|2100050_2100803_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479105.1|2100816_2101248_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533425.1|2101274_2101688_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_115203272.1|2101668_2104248_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.5	0.0e+00
WP_000847304.1|2104244_2104574_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001152199.1|2104573_2105272_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	9.9e-130
WP_000194706.1|2105282_2106026_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	1.2e-149
WP_052915903.1|2105971_2106604_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_000649829.1|2106794_2107322_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_115203273.1|2107455_2110929_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_000279123.1|2111661_2112975_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.4	1.3e-74
WP_001023432.1|2112976_2113246_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
>prophage 5
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	2235621	2281353	5303225	plate,holin,tail,integrase,terminase	Escherichia_phage(35.09%)	67	2232465:2232479	2274146:2274160
2232465:2232479	attL	CGATGCCAACAAGCG	NA	NA	NA	NA
WP_000916763.1|2235621_2235852_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2235990_2236365_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2236368_2237241_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2237253_2237595_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2237987_2239064_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_001311878.1|2239029_2239311_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001417978.1|2239417_2239606_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.6	6.7e-17
WP_071780718.1|2239598_2239793_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	2.2e-31
WP_001004419.1|2239856_2240909_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.0	7.2e-116
WP_000102214.1|2240920_2244067_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.2	0.0e+00
WP_001417976.1|2244166_2244442_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	2.2e-40
WP_000245528.1|2244516_2244693_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560226.1|2244686_2244908_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001005968.1|2245575_2245779_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_000379555.1|2245780_2245936_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000410105.1|2246241_2246661_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2246757_2247000_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_001417974.1|2247497_2248280_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	67.1	1.9e-44
WP_000789003.1|2248286_2249033_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	1.4e-113
WP_001151232.1|2249791_2250214_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	8.8e-65
WP_024183474.1|2250271_2250628_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.4e-58
WP_000137943.1|2250723_2251113_+	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	52.1	1.0e-22
WP_000967389.1|2251346_2251559_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	92.9	2.4e-26
WP_000411315.1|2251836_2252049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940308.1|2252120_2252720_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	7.2e-105
WP_000228032.1|2252719_2253010_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640150.1|2253006_2253561_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	2.6e-72
WP_000211421.1|2253831_2254443_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	99.3	1.0e-53
WP_001208723.1|2254676_2255246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071779784.1|2255214_2255430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|2255593_2255935_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001194114.1|2255938_2256415_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.8	6.0e-86
WP_001417965.1|2256398_2256791_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	84.5	7.9e-52
WP_000113283.1|2256934_2257120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417963.1|2257252_2257867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219002.1|2257820_2258372_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	4.2e-67
WP_001130792.1|2258374_2259997_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000113485.1|2259996_2261463_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	1.5e-260
WP_000184959.1|2261353_2262088_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.5	3.1e-97
WP_000873172.1|2262102_2263323_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.5	1.1e-203
WP_001066733.1|2263326_2263833_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000627482.1|2263844_2264786_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_162136460.1|2264782_2265016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125665.1|2265014_2265422_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_000008730.1|2265418_2265973_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.6e-80
WP_001142482.1|2265959_2266349_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
WP_032175481.1|2266323_2266887_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	4.1e-78
WP_000046932.1|2266890_2268036_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	6.8e-160
WP_000109249.1|2268046_2268487_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393961.1|2268490_2268943_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_000990888.1|2269120_2271127_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	79.1	1.7e-158
WP_000346976.1|2271126_2271777_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.3	1.8e-61
WP_000648663.1|2271780_2272083_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.6e-26
WP_000042294.1|2272085_2273117_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.3	1.7e-98
WP_000826144.1|2273113_2273449_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	44.9	4.0e-20
WP_000849713.1|2273529_2273943_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000818127.1|2273942_2274350_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	39.8	3.1e-14
2274146:2274160	attR	CGATGCCAACAAGCG	NA	NA	NA	NA
WP_001145370.1|2274421_2275174_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.6	4.1e-89
WP_001270634.1|2275173_2275527_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_001197066.1|2275526_2276726_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.9	2.0e-183
WP_000049957.1|2276722_2277403_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	2.9e-102
WP_171877822.1|2277402_2278113_+|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	48.0	7.7e-29
WP_000782982.1|2278109_2278529_+|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	65.8	6.5e-36
WP_000356378.1|2278500_2279103_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	3.3e-97
WP_064577890.1|2279102_2279648_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.6	2.4e-54
WP_000904991.1|2279677_2280232_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	6.3e-87
WP_000812736.1|2280696_2281353_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
>prophage 6
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	2531581	2588791	5303225	holin,capsid,head,tail,integrase,portal,protease,terminase	Enterobacteria_phage(33.33%)	73	2535685:2535700	2567822:2567837
WP_001260837.1|2531581_2532403_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2532502_2532586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2532678_2533014_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2533410_2534664_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2534770_2535664_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2535685:2535700	attL	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_000225283.1|2535798_2537019_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2537143_2537839_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2537791_2539084_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148719.1|2539241_2539856_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2539898_2540753_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2540754_2541372_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072141521.1|2541382_2543806_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041708.1|2543866_2546293_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.7	4.7e-211
WP_000778147.1|2546491_2546797_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2546904_2547615_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2547617_2548178_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2548212_2548554_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2548688_2549015_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001358608.1|2549220_2550435_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_000836042.1|2550446_2551466_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_077631648.1|2551523_2551631_+	transporter	NA	NA	NA	NA	NA
WP_001206151.1|2551653_2552949_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.3e-154
WP_000048562.1|2553287_2555759_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_001090185.1|2555838_2556042_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449178.1|2556038_2556227_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000559927.1|2556775_2557291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2557405_2557558_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000104592.1|2557823_2558540_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_000471546.1|2558589_2558805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693859.1|2558801_2559227_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000770544.1|2559251_2560217_+	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_001151255.1|2560257_2560683_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.8e-63
WP_000935420.1|2561109_2561322_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000256993.1|2561354_2561573_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000224233.1|2561574_2561838_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207982.1|2561848_2562718_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|2562833_2562938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|2563127_2563340_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001302544.1|2563381_2563567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001417850.1|2563507_2563786_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265028.1|2563787_2564834_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001217410.1|2564846_2565221_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762928.1|2565217_2566039_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000216629.1|2566635_2566803_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023171.1|2567117_2569055_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.6	4.3e-292
2567822:2567837	attR	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_001213059.1|2569202_2569385_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2569422_2569692_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2569767_2569983_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731256.1|2569987_2570332_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	98.2	2.9e-58
WP_000992167.1|2570382_2570916_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2571186_2571756_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2571755_2571902_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2572129_2572315_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|2572739_2572967_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000235441.1|2573368_2573878_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.2	3.6e-12
WP_001418004.1|2573849_2575778_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2575761_2575968_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2575964_2577557_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253994.1|2577546_2579052_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256723.1|2579088_2579436_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|2579493_2580522_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2580573_2580957_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2580949_2581303_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974985.1|2581318_2581852_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|2581848_2582244_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|2582251_2583004_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479105.1|2583017_2583449_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533425.1|2583475_2583889_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_115203275.1|2583869_2586449_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.6	0.0e+00
WP_000847379.1|2586445_2586775_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152567.1|2586774_2587473_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.5e-130
WP_000140755.1|2587478_2588222_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_071781836.1|2588158_2588791_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
>prophage 7
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	2809236	2863793	5303225	holin,tail,tRNA,portal,protease,terminase	Enterobacteria_phage(32.2%)	65	NA	NA
WP_000837948.1|2809236_2810370_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-117
WP_001295593.1|2810510_2810945_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2811885_2812527_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_077631646.1|2812608_2813238_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001131657.1|2813310_2813886_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001230459.1|2815542_2816142_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_115203273.1|2816209_2819683_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_077775224.1|2819923_2820553_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_001417859.1|2820498_2821242_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.3e-148
WP_001152227.1|2821252_2821951_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.0	2.2e-129
WP_000847298.1|2821950_2822280_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000929511.1|2822276_2824922_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.5	0.0e+00
WP_000532075.1|2824965_2825274_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479043.1|2825300_2825723_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2825736_2826489_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2826496_2826895_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974957.1|2826907_2827531_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281348.1|2827533_2827815_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|2827807_2828134_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2828221_2830246_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2830190_2831693_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2831692_2831905_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2831901_2834025_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373410.1|2834021_2834498_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_171815854.1|2834758_2834935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343114.1|2835011_2835299_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	3.1e-29
WP_001139680.1|2835377_2835530_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_122989571.1|2835558_2835765_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	5.8e-30
WP_000455406.1|2835992_2836142_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056883.1|2836141_2836711_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087712.1|2836985_2837519_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	98.9	1.5e-101
WP_000284510.1|2837523_2837739_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|2837815_2838088_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_014640514.1|2838128_2838308_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	98.3	1.1e-24
WP_000874523.1|2838445_2840392_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_171877831.1|2841653_2842307_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.7e-57
WP_001265237.1|2842604_2843654_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_032207160.1|2843655_2843934_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_000284536.1|2844366_2844843_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001219082.1|2844845_2845205_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000128514.1|2845449_2845662_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_000137945.1|2845896_2846373_-	hypothetical protein	NA	O64352	Escherichia_phage	44.4	1.1e-07
WP_001209468.1|2846470_2847079_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	68.9	8.2e-72
WP_001266130.1|2847075_2847372_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141104.1|2847368_2847761_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	5.9e-39
WP_000450861.1|2847776_2848547_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	1.2e-80
WP_000790459.1|2848576_2849317_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000095674.1|2849323_2850292_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000693888.1|2850314_2850740_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|2850723_2851005_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2851105_2851525_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379610.1|2851790_2851943_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000449175.1|2852432_2852621_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2852617_2852806_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102127.1|2852898_2855571_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	95.7	2.3e-171
WP_000166312.1|2855563_2856373_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2856428_2856578_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2856615_2856804_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2856903_2857119_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2857120_2858356_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000662472.1|2858407_2859343_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000123746.1|2859471_2860845_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2860877_2861048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2861322_2862306_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2862560_2863793_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	2948861	3014333	5303225	holin,capsid,head,tail,transposase,integrase,protease,terminase	Stx2-converting_phage(32.65%)	75	2971008:2971021	3014986:3014999
WP_000422055.1|2948861_2949911_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2950130_2950889_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278896.1|2950885_2951476_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2951515_2952388_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2952600_2954184_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2954211_2954832_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2954828_2955710_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2955847_2955892_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194629.1|2955983_2957546_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2957545_2959141_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2959141_2960503_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2960514_2961708_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443044.1|2961707_2962514_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2962894_2963074_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2963159_2963660_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079491.1|2963705_2964212_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000938104.1|2966671_2967241_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2967306_2968218_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2968324_2968447_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_077631643.1|2968622_2968793_+|integrase	site-specific integrase	integrase	K7PHK0	Enterobacteria_phage	85.5	2.1e-17
WP_077817731.1|2968804_2969398_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	88.3	2.8e-93
WP_106423857.1|2970470_2970665_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|2970609_2971152_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
2971008:2971021	attL	TTAACCAGGATTCT	NA	NA	NA	NA
WP_001023357.1|2971372_2971642_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_000268972.1|2971643_2972804_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	98.2	2.8e-81
WP_029783341.1|2972868_2973507_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_085959019.1|2973525_2974738_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_072280596.1|2976844_2977477_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000194706.1|2977422_2978166_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	1.2e-149
WP_001179484.1|2978176_2978875_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
WP_000807954.1|2978874_2979216_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212946.1|2979208_2982475_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_001453698.1|2982526_2982736_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030057.1|2982831_2983206_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275469.1|2983211_2983928_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_000141141.1|2983994_2984339_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_000573392.1|2984335_2984782_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	1.5e-75
WP_001007889.1|2984778_2985129_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125996.1|2985139_2985466_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063105.1|2987992_2988214_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000173067.1|2988258_2990196_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001417827.1|2990259_2991921_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_001359495.1|2991917_2992481_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	1.2e-85
WP_001359494.1|2992596_2993127_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_000074669.1|2993168_2993393_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2993474_2993789_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2994316_2994502_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|2994718_2995216_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|2995215_2995431_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023143.1|2995869_2997720_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000216644.1|2998034_2998202_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_001059384.1|2999238_2999928_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2999924_3000290_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|3000290_3001346_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|3001347_3001626_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|3001695_3001956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|3002174_3002387_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|3002665_3003424_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3004122_3004287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|3004283_3005018_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157825328.1|3005051_3005594_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3005505_3006546_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|3006517_3007069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3007052_3007280_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3007356_3007764_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3008028_3008328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3008400_3008619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3008641_3009049_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3009026_3009260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3009253_3009421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3009818_3010007_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3010003_3010195_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048546.1|3010287_3012759_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
WP_000113189.1|3012823_3013072_+	excisionase	NA	NA	NA	NA	NA
WP_000113678.1|3013049_3014333_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
3014986:3014999	attR	AGAATCCTGGTTAA	NA	NA	NA	NA
>prophage 9
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	3562530	3608055	5303225	lysis,holin,tail,integrase,portal,protease,terminase	Enterobacteria_phage(45.28%)	62	3562115:3562129	3608129:3608143
3562115:3562129	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3562530_3563229_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3563459_3564341_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3564509_3564671_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3565167_3566187_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3566220_3567201_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|3567377_3567647_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_115203279.1|3567648_3568965_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.5	2.6e-75
WP_001230268.1|3569024_3569624_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	91.5	2.6e-102
WP_000515306.1|3569693_3573107_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000090845.1|3573167_3573776_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3573712_3574456_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152339.1|3574461_3575160_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3575169_3575499_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371991.1|3575498_3578564_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3578535_3578865_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3578873_3579260_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3579320_3580064_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3580074_3580476_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3580472_3581051_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3581062_3581338_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3581330_3581654_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_000985947.1|3583712_3585221_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001072975.1|3585220_3585433_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934091.1|3585429_3587532_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3587531_3588023_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3588697_3588850_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3588837_3589305_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075155.1|3589301_3589799_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	2.4e-90
WP_000284524.1|3589798_3590014_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3590156_3590555_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3590635_3590794_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3590879_3591623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3591807_3592497_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3592511_3592634_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3592972_3593932_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3594143_3594809_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3594805_3595426_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000566868.1|3595418_3595589_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254239.1|3595585_3595768_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000736913.1|3595764_3596205_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145947.1|3596278_3596569_-	hypothetical protein	NA	A0A1I9LJP5	Stx_converting_phage	96.9	5.3e-45
WP_000788870.1|3596565_3597267_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	7.6e-130
WP_000438491.1|3598188_3598488_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000067727.1|3598629_3598845_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|3598920_3599616_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000854876.1|3599788_3600085_+	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_000478871.1|3600096_3600381_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000088205.1|3600813_3601086_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000065351.1|3602015_3602384_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001198861.1|3602456_3602621_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3602589_3602733_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3602806_3603103_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|3603108_3603894_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186828.1|3603890_3604571_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.9e-130
WP_000682316.1|3604567_3604750_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3604722_3604914_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3604924_3605206_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763358.1|3605304_3605526_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000120058.1|3605736_3606339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3606581_3606749_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3606788_3607007_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3606984_3608055_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3608129:3608143	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	3833174	3898407	5303225	lysis,holin,capsid,head,tail,transposase,tRNA,integrase,portal,protease,terminase	Enterobacteria_phage(61.82%)	76	3841652:3841698	3888201:3888247
WP_000420895.1|3833174_3834311_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383932.1|3834576_3836814_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001301880.1|3836800_3839773_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224578.1|3839773_3840664_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3840846_3841608_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3841652:3841698	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001359465.1|3842050_3842488_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3842512_3843097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201812.1|3843595_3844549_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226371.1|3844735_3846220_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3846764_3847433_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885620.1|3847487_3848072_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_000279124.1|3848071_3850978_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_001230405.1|3851042_3851642_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000515303.1|3851708_3855107_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
WP_000090855.1|3855167_3855776_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|3855712_3856456_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152525.1|3856461_3857160_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|3857159_3857489_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000235332.1|3857485_3859813_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000840184.1|3859822_3860047_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	4.4e-31
WP_000459484.1|3860039_3860474_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479153.1|3860455_3860878_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000683105.1|3861640_3862036_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|3862032_3862611_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753019.1|3862622_3862976_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000710708.1|3862987_3863383_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_000063260.1|3863424_3864450_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_001299443.1|3864505_3864838_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3864847_3866167_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001417743.1|3866147_3867749_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	3.5e-311
WP_000198149.1|3867745_3867952_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027287.1|3867948_3869874_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453580.1|3869848_3870394_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001300120.1|3870782_3870977_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3871141_3871348_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001417742.1|3871633_3872044_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_000738495.1|3872335_3872629_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_122993458.1|3872719_3872902_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_001180487.1|3873118_3873595_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3873581_3873887_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097226.1|3874208_3874898_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000971093.1|3874894_3875035_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3875031_3875394_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3875390_3875681_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3875673_3875844_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3875843_3876299_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3876295_3876397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3876487_3876769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3876812_3877010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145437.1|3877237_3877522_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000788830.1|3877518_3878220_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000147923.1|3878216_3879236_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	2.8e-109
WP_001182879.1|3879232_3879772_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000184665.1|3879802_3880030_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|3880140_3880833_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001417737.1|3880939_3882547_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000233576.1|3883135_3883342_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3883417_3883714_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3883719_3884505_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186801.1|3884501_3885182_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.9e-131
WP_000149536.1|3885178_3885340_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.0	1.3e-21
WP_000129285.1|3885332_3885890_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3885900_3886182_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3886280_3886499_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3886546_3886825_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001359450.1|3887023_3888187_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_001359679.1|3888521_3889154_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3888201:3888247	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255114.1|3889156_3889672_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691070.1|3889682_3890690_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001417736.1|3890702_3893312_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988382.1|3893342_3894035_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3894254_3894797_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729155.1|3895276_3896143_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3896144_3896357_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3896464_3896986_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|3897021_3898407_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 11
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	4232474	4278670	5303225	integrase,plate,transposase	Enterobacteria_phage(22.22%)	40	4232045:4232059	4257784:4257798
4232045:4232059	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130496.1|4232474_4233656_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
WP_000893281.1|4234008_4235262_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
WP_001285288.1|4235273_4236377_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4236664_4237720_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4237758_4238160_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189550.1|4238217_4239462_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4239553_4240012_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4240272_4241730_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4241786_4242344_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4242255_4242522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4242828_4243281_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4243290_4243689_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4243691_4243985_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4244036_4245092_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4245162_4245948_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4245892_4247632_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4248537_4249311_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4249496_4249757_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|4249759_4250038_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4250193_4250934_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4250904_4251672_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4251776_4252355_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973088.1|4252594_4255039_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4255081_4255555_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4255708_4256479_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4256596_4257769_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4257849_4258035_+	protein YncO	NA	NA	NA	NA	NA
4257784:4257798	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4257949_4258213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145880.1|4258414_4260175_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420855.1|4260177_4261314_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001414559.1|4262059_4262575_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339432.1|4262643_4264152_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_071529145.1|4264333_4264984_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000103342.1|4269498_4271640_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4271849_4272368_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4273064_4273565_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4273599_4273824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611747.1|4275356_4275770_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4275773_4277624_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4277587_4278670_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NZ_CP038394	Escherichia coli O157:H7 strain DEC5A chromosome, complete genome	5303225	4709907	4717570	5303225	integrase,transposase	Enterobacteria_phage(33.33%)	6	4706633:4706648	4727972:4727987
4706633:4706648	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_000684856.1|4709907_4710864_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4710864_4711632_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_139371347.1|4711858_4713071_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001218930.1|4713186_4714452_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_001418352.1|4714918_4715938_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	9.3e-44
WP_001294533.1|4716067_4717570_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	3.9e-83
4727972:4727987	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
