The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	870948	928341	5571128	transposase,integrase,protease	Stx2-converting_phage(37.5%)	40	898478:898537	928336:929646
WP_001034451.1|870948_875508_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000895883.1|875834_876644_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001345954.1|876709_877120_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000135074.1|877137_878097_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_171879515.1|878339_879553_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000624681.1|879987_880338_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422686.1|880334_880760_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_001239082.1|881413_891085_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|892959_893634_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|893682_894672_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_001121626.1|895279_896929_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
898478:898537	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_170986177.1|898531_899744_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001453071.1|900475_900649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000605048.1|901223_901772_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|904093_904441_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001358695.1|904437_905112_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	2.4e-11
WP_001218882.1|906102_907368_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
WP_000779482.1|907831_908158_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|908154_908418_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001290179.1|908489_909356_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839294.1|909448_909646_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777672.1|909657_910146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854720.1|910142_910520_-	toxin	NA	NA	NA	NA	NA
WP_001539669.1|910609_910978_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692349.1|911057_911279_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	2.1e-09
WP_001186788.1|911365_911842_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849596.1|911857_912343_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234642.1|912397_913216_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.5e-44
WP_001119719.1|913315_913549_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000839179.1|913634_914039_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612617.1|914035_914383_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000099145.1|914431_915970_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.8e-293
WP_000581493.1|916089_916545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341130.1|916621_919138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820383.1|919258_922378_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069724.1|922711_923584_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001330680.1|923693_924713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420028.1|926207_926780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077631814.1|926865_927144_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_170986177.1|927127_928341_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
928336:929646	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCACCTCCGGATGTTGTTAATCTCAACCGGCGTTGGTGATGAAAACAACGCACCACCTTCCCCGGCATAACAACCGGGGAAAAACGTAAAAAATAATCGGGAATGTGACCGTCAGAAGATAAACGGGGGGATTGCGGTGGCTGAGCCGTACCGGTATGTCGGGTGATTGTTGCGAAACGATGCTTCCGCACGCGATAAAGGAGGTAGGACTTTCGTGAGACAAGGGGAAAACTGGCGTTCTGATAATTGCAGAGTTGTTTTTGAAGGCGGTGATGGTGAGTCAGCCTGTGACCTGTGGGCAGGCGACAGATATCACTGGTGGGATAAGACTGTCTGATTGGTATTATAAATATATAAGAGAGATCAAATACATGAGCTCAAACTCATGAGATCAAACACATGAGTTCATATATGTGAAATAAATCTGTGAGTGTGATCAGCAGACCAGTCTACCCAGTAGCAACAGATTGCGTTGTACTCACAGGGTTATCCCTGATAACTGGCGTATAACCTGCGTACATAAAACGTACCTGCAATGCACCTGAACAGAGTGCATTAAGCATCCGCCTGAGCGGTAAACGTATCCGATCTGGTGAGTGACAGTCTGAGAGCATTCTCAGTAATCGCCCCCTTGTATCCTGGAAATTGGTTAAGAGCGATTAGATTTGGCAAGGTGTATGCAGCCAGCAGCTTAACATCTCAGCTAACTGGCTGGTTACCTTCAGGTTGTCGCAATGGCATCGGACATCCGGTGTCGGATAACTAAACGTAGCGTTAAGGCGATATTGCTGAGAGACCGGTTAAGTGGTTGCACGGGAGTAATGAGTTTGGGGAGGGGACCAGAATGTCAGTCTGGTGCGGTATGCTGGCAGTATCACGTTGATTACAGCATAAAGTAACGAGAGGCTAATAGCGGTTAAAACCAGAGCAGTTCCGTCGTTGTTCATCCCGGGAGACGCTGGAAAAAGTGATTTCCCGCACACGTTATAACCTTACCCCTGCGGAGCCGGAAGCCTTCTGCGGTCGATCGGCTGGCAGAACTGACGACAAATTTTACGCGTGTGGATCCAGTCTGGTCACCTGAGTATCCGGTAATCACAACGGTCTGGTGTTATCTGCTCTGTGTGATTCTTTTTAGGTCTTCTCCGGTTGTTGGTAACCTGGATAATACCGCGAACGTTAAGCGGTATCGTGACAACGAATAATTTGAAATTAAAAGGGGCAGGGTGGTCTGCTTCGGGGATTAACGGCTTA	NA	NA	NA	NA
>prophage 2
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	1362183	1403694	5571128	capsid,integrase,plate,holin,terminase,tail	Salmonella_phage(48.78%)	51	1362397:1362414	1406113:1406130
WP_000054753.1|1362183_1362444_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
1362397:1362414	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138346.1|1362658_1364056_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291431.1|1364052_1364253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001135920.1|1364249_1365644_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.4	8.4e-213
WP_001288450.1|1365754_1366684_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	38.1	2.5e-48
WP_001213769.1|1366686_1367700_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.5	2.8e-101
WP_000312940.1|1367672_1367966_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	1.1e-26
WP_000637724.1|1367955_1368255_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_001419980.1|1368251_1368467_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000065473.1|1368472_1370536_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	1.3e-275
WP_000551015.1|1370582_1371212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769009.1|1371264_1371813_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_001113515.1|1371828_1373130_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	4.0e-132
WP_000051353.1|1373132_1374035_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000801672.1|1374031_1374181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000567468.1|1375351_1376026_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	2.3e-59
WP_000016208.1|1376167_1376368_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001282584.1|1376371_1378633_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000868571.1|1378950_1379181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|1379226_1379649_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174014.1|1379680_1380022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|1380467_1380809_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194117.1|1380812_1381289_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	1.0e-85
WP_000779566.1|1381272_1381797_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162797.1|1381858_1382431_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	2.3e-60
WP_001130793.1|1382433_1384056_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113486.1|1384055_1385522_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	1.0e-261
WP_000184965.1|1385412_1386147_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.1	8.9e-97
WP_000873174.1|1386161_1387382_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.1e-200
WP_001066729.1|1387385_1387892_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000627478.1|1387903_1388845_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	2.4e-155
WP_001125667.1|1389072_1389480_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	1.8e-70
WP_000008729.1|1389476_1390031_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.0e-80
WP_001142484.1|1390017_1390407_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_032173191.1|1390381_1390945_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	2.2e-79
WP_000046926.1|1390948_1392094_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	4.7e-161
WP_000109249.1|1392104_1392545_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393945.1|1392548_1393001_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000990881.1|1393178_1395164_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.6	6.8e-176
WP_001420197.1|1395163_1395751_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155119.1|1395750_1396053_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_000081738.1|1396055_1397117_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.3	4.5e-158
WP_001214055.1|1397120_1397462_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
WP_000050470.1|1397611_1398343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110002.1|1398342_1398771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301079.1|1398835_1399588_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	5.0e-87
WP_001270632.1|1399587_1399941_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197086.1|1399940_1401140_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	1.1e-184
WP_001096975.1|1401816_1402686_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	57.7	1.6e-44
WP_000805562.1|1402685_1403279_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	2.0e-59
WP_001045288.1|1403250_1403694_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	1.9e-22
1406113:1406130	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 3
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	1630500	1635926	5571128	integrase	Enterobacteria_phage(50.0%)	6	1619488:1619504	1638122:1638138
1619488:1619504	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_165826618.1|1630500_1631070_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	1.0e-68
WP_000403518.1|1631069_1631537_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000960724.1|1631523_1632204_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1632213_1633350_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1633524_1634682_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1634993_1635926_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1638122:1638138	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	1883580	1966534	5571128	protease,capsid,lysis,tRNA,holin,transposase,terminase,head,tail	Escherichia_phage(65.88%)	93	NA	NA
WP_000569336.1|1883580_1884507_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1884511_1885243_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1885223_1885331_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1885390_1886092_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_000063639.1|1886112_1887399_-	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	100.0	4.5e-253
WP_001193437.1|1887432_1887687_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001030159.1|1887705_1887840_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
WP_000457735.1|1887843_1888086_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_001094868.1|1888160_1888907_-	DUF551 domain-containing protein	NA	H6WZG0	Escherichia_phage	100.0	1.4e-142
WP_001014291.1|1888909_1889101_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_001289963.1|1889102_1889873_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	100.0	1.1e-142
WP_000763381.1|1889869_1890091_-	TraR/DksA family transcriptional regulator	NA	H6WZG3	Escherichia_phage	100.0	1.7e-35
WP_001447493.1|1890189_1890471_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|1890481_1890673_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682316.1|1890645_1890828_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186761.1|1890824_1891505_-	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	100.0	1.2e-132
WP_000100845.1|1891501_1892287_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|1892292_1892589_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372937.1|1892663_1892807_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1892775_1892940_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065379.1|1893012_1893381_-	DUF2528 family protein	NA	H6WZH0	Escherichia_phage	100.0	4.5e-65
WP_170986177.1|1893643_1894857_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000167591.1|1894862_1895315_-	hypothetical protein	NA	H6WZH3	Escherichia_phage	100.0	1.2e-83
WP_000198444.1|1895373_1895757_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745483.1|1896245_1896410_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1896412_1897459_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1897452_1897914_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885202.1|1897981_1898323_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_000250473.1|1898383_1899091_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1899169_1899397_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|1899535_1899832_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185479.1|1899864_1900803_+	replication protein	NA	H6WZI2	Escherichia_phage	100.0	1.3e-172
WP_000788912.1|1900799_1901501_+	hypothetical protein	NA	H6WZI3	Escherichia_phage	100.0	4.5e-130
WP_000145935.1|1901497_1901788_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000125.1|1901858_1902137_+	hypothetical protein	NA	H6WZI5	Escherichia_phage	100.0	9.9e-49
WP_000103678.1|1902269_1902485_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001484315.1|1902495_1902732_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	98.7	6.0e-39
WP_001484314.1|1902688_1903135_+	recombination protein NinB	NA	H6WZI6	Escherichia_phage	100.0	3.2e-81
WP_000153279.1|1903131_1903659_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	100.0	1.2e-100
WP_001254256.1|1903655_1903838_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_001302649.1|1904556_1904877_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1904984_1905158_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_032321671.1|1905228_1906152_+	antirepressor	NA	H6WZJ1	Escherichia_phage	100.0	5.8e-178
WP_001004031.1|1906226_1906949_+	phage antirepressor KilAC domain-containing protein	NA	H6WZJ2	Escherichia_phage	100.0	1.3e-132
WP_001107997.1|1906948_1907554_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	100.0	3.3e-97
WP_171879516.1|1907550_1908222_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	100.0	1.1e-133
WP_000512812.1|1908212_1908701_+	late gene antiterminator protein	NA	H6WZJ5	Escherichia_phage	100.0	5.3e-90
WP_001484313.1|1909193_1909625_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	100.0	7.1e-70
WP_000216690.1|1909621_1909786_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_171879517.1|1910161_1912015_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	100.0	0.0e+00
WP_000284515.1|1912164_1912380_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075147.1|1912379_1912877_+	lysozyme	NA	H6WZK1	Escherichia_phage	100.0	3.4e-92
WP_000092250.1|1912873_1913341_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	100.0	5.0e-77
WP_000839224.1|1913542_1914040_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1914036_1914294_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000828066.1|1914731_1915058_+	TonB family protein	NA	H6WZK5	Escherichia_phage	100.0	6.8e-57
WP_001484168.1|1915189_1915390_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	100.0	8.7e-31
WP_171879518.1|1915431_1915962_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	100.0	1.4e-99
WP_000958416.1|1916077_1916641_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001372135.1|1916637_1918299_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	100.0	0.0e+00
WP_000173031.1|1918362_1920300_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063096.1|1920344_1920566_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1923092_1923419_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007911.1|1923428_1923779_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_171879519.1|1923775_1924222_+	HK97 gp10 family phage protein	NA	H6WZL6	Escherichia_phage	100.0	4.0e-76
WP_000133388.1|1924218_1924563_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_171879520.1|1924628_1925345_+	immunoglobulin domain-containing protein	NA	H6WZL8	Escherichia_phage	100.0	5.6e-128
WP_000710945.1|1925359_1925734_+|tail	tail assembly protein	tail	H6WZL9	Escherichia_phage	100.0	3.5e-65
WP_001513217.1|1925829_1926039_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212868.1|1926086_1929329_+|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	100.0	0.0e+00
WP_000807960.1|1929321_1929663_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	100.0	8.7e-63
WP_171879521.1|1929662_1930361_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	100.0	9.5e-133
WP_171879522.1|1930371_1931115_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	100.0	9.8e-152
WP_050546863.1|1931060_1931693_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001233198.1|1935473_1936073_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	100.0	8.0e-112
WP_000268889.1|1936137_1937451_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	100.0	3.8e-82
WP_001023420.1|1937452_1937722_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_001131652.1|1937834_1938410_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	100.0	6.7e-100
WP_001025654.1|1938741_1939983_-	NADPH-dependent L-lysine N(6)-monooxygenase MbtG	NA	H6WZN2	Escherichia_phage	100.0	2.0e-250
WP_001419933.1|1940633_1941842_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	100.0	2.4e-232
WP_001261971.1|1942046_1942295_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_001359340.1|1942809_1944495_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_001419932.1|1944491_1945211_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1945257_1945728_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1945769_1946231_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1946355_1948359_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359338.1|1948355_1949492_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001294379.1|1949484_1951764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1951774_1952863_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636923.1|1953494_1953812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356845.1|1953872_1957505_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000860780.1|1957514_1960547_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1964500_1966534_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	2187792	2308658	5571128	integrase,protease,capsid,tRNA,holin,transposase,terminase,head,portal,tail	Enterobacteria_phage(28.3%)	113	2255890:2255906	2295222:2295238
WP_001419904.1|2187792_2189175_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.2	1.6e-43
WP_000211298.1|2189256_2189709_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000831732.1|2189806_2191006_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000165782.1|2191076_2191499_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000020322.1|2191562_2192498_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_000944851.1|2192487_2193048_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000599437.1|2193114_2194044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709111.1|2194060_2194870_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_000933666.1|2194885_2195713_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_000118630.1|2195706_2196567_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000075719.1|2196563_2197385_-	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.9	1.2e-06
WP_000939730.1|2197388_2198303_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023157840.1|2198555_2200514_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.7	2.1e-121
WP_000595497.1|2200506_2201358_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_000803506.1|2201354_2202701_+	dihydroorotase	NA	NA	NA	NA	NA
WP_000022378.1|2202761_2203784_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000230473.1|2203936_2204272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024622770.1|2204313_2205498_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_001419900.1|2205861_2206116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000746719.1|2206339_2207590_-	metallochaperone AztD	NA	NA	NA	NA	NA
WP_004175378.1|2207628_2208579_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001104308.1|2208610_2209468_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_000544020.1|2209464_2210202_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.0	5.7e-11
WP_000059621.1|2212637_2213894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	3.3e-75
WP_001011474.1|2214456_2215374_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2215475_2216426_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2218812_2219529_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2219871_2221326_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2221427_2222744_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2223058_2224111_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2232844_2233642_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_170986177.1|2234489_2235702_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000379584.1|2235781_2235934_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.0e-07
WP_001003381.1|2236126_2236534_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|2236611_2236839_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705361.1|2236822_2237344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054513.1|2237324_2238290_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_001151172.1|2238330_2238738_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000101550.1|2239178_2240138_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000813254.1|2240509_2240665_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004956.1|2240830_2241481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2241461_2242565_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000975564.1|2242719_2242980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2243049_2243328_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265287.1|2243329_2244379_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	5.3e-111
WP_001217436.1|2244391_2244763_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090266.1|2244752_2245124_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	3.0e-53
WP_171879524.1|2245276_2246095_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261910.1|2246715_2247429_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874328.1|2248196_2250047_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000411813.1|2250339_2250546_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2250550_2251540_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_053897656.1|2251582_2252116_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	3.3e-101
WP_032140280.1|2252670_2252757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2252978_2253164_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000347010.1|2253840_2253978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2254114_2254300_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2254701_2255211_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001418004.1|2255182_2257111_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
2255890:2255906	attL	TTATGTGCCCTGTCCGC	NA	NA	NA	NA
WP_000259002.1|2257094_2257301_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2257297_2258890_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_114475637.1|2258879_2260385_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	9.3e-101
WP_000256821.1|2260421_2260769_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522623.1|2260826_2261855_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2261906_2262290_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2262282_2262636_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974985.1|2262651_2263185_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|2263181_2263577_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_171879525.1|2263584_2264337_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.0e-132
WP_000479105.1|2264350_2264782_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533419.1|2264808_2265222_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_171879526.1|2265202_2267782_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.7	0.0e+00
WP_000847304.1|2267778_2268108_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_045896506.1|2268107_2268806_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	1.8e-131
WP_053895436.1|2268816_2269560_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_123055119.1|2269505_2270138_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.2	2.7e-102
WP_171879527.1|2270480_2273954_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228316.1|2274021_2274621_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_000216455.1|2274773_2276087_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	6.9e-76
WP_001023356.1|2276088_2276358_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|2276464_2276554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024219018.1|2276573_2278922_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2279512_2282914_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|2285222_2285498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938119.1|2285558_2286920_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|2287283_2288147_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531595.1|2288130_2289267_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2289516_2290743_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2290791_2291913_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|2292161_2293391_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2293755_2293944_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2294748_2294946_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2294938_2295151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551672.1|2295140_2295380_+	hypothetical protein	NA	NA	NA	NA	NA
2295222:2295238	attR	GCGGACAGGGCACATAA	NA	NA	NA	NA
WP_001204078.1|2295372_2295606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2295598_2295832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2295837_2296137_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833619.1|2296133_2297534_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|2297734_2297986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|2297982_2298393_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233303.1|2298403_2298676_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2298802_2299027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796963.1|2299278_2299485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2299484_2300540_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2300552_2300888_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224606.1|2300900_2301314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2301519_2302062_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2302317_2302599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735413.1|2303200_2304661_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2304660_2305332_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2305500_2306871_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2306874_2307516_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2307551_2308658_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	2426071	2494533	5571128	capsid,integrase,protease,holin,transposase,terminase,head,tail	Escherichia_phage(30.61%)	75	2418962:2418975	2435771:2435784
2418962:2418975	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113678.1|2426071_2427355_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
WP_000113189.1|2427332_2427581_-	excisionase	NA	NA	NA	NA	NA
WP_000048537.1|2427645_2430117_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
WP_001090200.1|2430209_2430401_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2430397_2430586_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2430983_2431151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2431144_2431378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2431355_2431763_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|2431785_2432004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2432076_2432376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2432639_2433047_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2433123_2433351_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|2433334_2433886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2433857_2434898_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_158000204.1|2434809_2435352_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	5.8e-85
WP_000450692.1|2435385_2436120_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
2435771:2435784	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2436116_2436281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2436979_2437738_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2438016_2438229_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_170986177.1|2438457_2439671_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000975564.1|2439760_2440021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024221414.1|2440090_2440369_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001265289.1|2440370_2441426_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|2441426_2441792_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|2441788_2442478_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000216644.1|2443514_2443682_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000023143.1|2443996_2445847_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024164617.1|2446285_2446501_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|2446500_2446998_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|2447214_2447400_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|2447927_2448242_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2448323_2448548_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001359494.1|2448589_2449120_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_001359495.1|2449235_2449799_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	1.2e-85
WP_001417827.1|2449795_2451457_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173067.1|2451520_2453458_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001063105.1|2453502_2453724_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000125996.1|2456250_2456577_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|2456587_2456938_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573390.1|2456934_2457381_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000141141.1|2457377_2457722_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_001275469.1|2457788_2458505_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_001030057.1|2458510_2458885_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|2458980_2459190_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212946.1|2459241_2462508_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_000807954.1|2462500_2462842_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171879528.1|2462841_2463540_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	4.4e-130
WP_171879522.1|2463550_2464294_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	100.0	9.8e-152
WP_050546863.1|2464239_2464872_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_171879529.1|2465111_2468588_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	95.7	0.0e+00
WP_085959019.1|2468669_2469883_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_029783341.1|2469901_2470540_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_171879530.1|2470604_2471765_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	97.7	5.4e-80
WP_001358682.1|2471853_2472036_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.3	9.1e-27
WP_000767050.1|2472256_2472799_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106423857.1|2472743_2472938_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_106409364.1|2474947_2475070_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2475176_2476088_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938104.1|2476153_2476723_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001079491.1|2479182_2479689_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056492.1|2479734_2480235_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2480320_2480500_-	general stress protein	NA	NA	NA	NA	NA
WP_000443044.1|2480880_2481687_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2481686_2482880_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2482891_2484253_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2484253_2485849_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194629.1|2485848_2487411_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2487502_2487547_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2487684_2488566_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2488562_2489183_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001419830.1|2489210_2490794_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2491006_2491879_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278896.1|2491918_2492509_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2492505_2493264_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2493483_2494533_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	3010757	3089181	5571128	protease,capsid,integrase,plate,tRNA,holin,transposase,terminase,tail	Salmonella_phage(34.38%)	98	3038380:3038394	3097933:3097947
WP_001220997.1|3010757_3011453_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|3011510_3013421_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|3013552_3013897_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|3014258_3014618_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3014737_3014917_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854984.1|3014990_3016352_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|3016355_3016934_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624305.1|3017117_3018482_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000287615.1|3019688_3021233_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000394983.1|3021830_3023387_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150543.1|3023849_3024821_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|3024883_3025684_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|3025696_3026548_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156258.1|3026602_3027061_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|3027490_3028057_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010147.1|3028053_3028863_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|3029028_3029238_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|3029250_3029394_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006862.1|3030062_3030350_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|3030424_3030568_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|3030727_3030967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262182.1|3031110_3031902_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127211.1|3032078_3033452_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984495.1|3033497_3034379_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055778.1|3034570_3036619_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431368.1|3036638_3037337_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|3037433_3037931_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207282.1|3038060_3039344_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
3038380:3038394	attL	GGCAAATGACCAAAC	NA	NA	NA	NA
WP_001358625.1|3039312_3041946_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001419868.1|3042026_3043466_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001359800.1|3043583_3043820_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3043924_3044116_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812736.1|3044116_3044773_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_000904983.1|3045237_3045792_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	2.8e-87
WP_001115561.1|3045821_3046193_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	49.4	3.6e-14
WP_000978830.1|3046192_3046636_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.1	5.1e-47
WP_000613357.1|3046607_3047201_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.4	5.0e-58
WP_001096935.1|3047200_3048070_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	58.8	1.9e-45
WP_000049950.1|3048069_3048750_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197073.1|3048746_3049946_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_001270634.1|3049945_3050299_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_000301082.1|3050298_3051051_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.7	3.1e-89
WP_000466689.1|3051110_3051350_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_001214054.1|3051403_3051745_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.7	1.4e-33
WP_000081739.1|3051748_3052810_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.9	5.0e-157
WP_000155122.1|3052812_3053115_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	2.4e-48
WP_001419869.1|3053114_3053702_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	2.4e-84
WP_000990873.1|3053701_3055690_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.4	1.5e-271
WP_000393962.1|3055867_3056320_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109249.1|3056323_3056764_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046924.1|3056774_3057920_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_032173188.1|3057923_3058487_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	1.4e-78
WP_001142484.1|3058461_3058851_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_000008728.1|3058837_3059392_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.2	7.2e-67
WP_024183605.1|3059388_3059796_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	5.1e-70
WP_001040698.1|3059761_3060130_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	89.3	6.1e-54
WP_099120809.1|3060170_3061112_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	3.7e-156
WP_171879532.1|3061123_3061630_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	1.1e-69
WP_171879533.1|3061633_3062854_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.8	3.4e-202
WP_086353604.1|3062868_3063606_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_000113495.1|3063490_3064960_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	5.1e-269
WP_001130793.1|3064959_3066582_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001218996.1|3066584_3067136_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_000113286.1|3067153_3067291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311799.1|3067434_3067827_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	2.5e-50
WP_001194111.1|3067810_3068287_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	1.1e-84
WP_000781775.1|3068290_3068632_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_071779784.1|3068795_3069011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|3068979_3069549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640144.1|3069770_3070313_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	4.9e-76
WP_000254097.1|3070309_3070600_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	2.1e-46
WP_000940310.1|3070599_3071199_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	1.9e-105
WP_000018421.1|3071758_3071971_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000156212.1|3072471_3073569_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.7	2.8e-211
WP_001204666.1|3073528_3074107_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000403777.1|3074378_3074735_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001151112.1|3074792_3075215_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.7e-63
WP_000450684.1|3075230_3075992_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.9	3.3e-118
WP_000788992.1|3076014_3076761_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	2.6e-112
WP_001419880.1|3076767_3077568_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.5	3.7e-40
WP_000702025.1|3077645_3078068_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033917.1|3078064_3078307_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	3.9e-17
WP_000410105.1|3078403_3078823_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000232637.1|3079122_3079341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001419881.1|3079306_3079501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560226.1|3079896_3080118_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001436857.1|3080117_3080288_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	5.1e-24
WP_001419882.1|3080362_3080638_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	2.3e-42
WP_000102209.1|3080738_3083882_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	66.8	0.0e+00
WP_001004417.1|3083893_3084946_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_010989194.1|3085009_3085204_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_001356607.1|3085196_3085385_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001311878.1|3085491_3085773_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189084.1|3085738_3086815_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.8e-98
WP_000976483.1|3087207_3087549_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879314.1|3087561_3088434_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168751.1|3088437_3088812_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3088950_3089181_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
3097933:3097947	attR	GGCAAATGACCAAAC	NA	NA	NA	NA
>prophage 8
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	3117383	3190200	5571128	integrase,capsid,plate,tRNA,holin,portal,terminase,head,tail	Enterobacteria_phage(72.34%)	83	3154911:3154970	3191140:3191263
WP_000564730.1|3117383_3118355_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176810.1|3118519_3120949_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214274.1|3120973_3122074_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185786.1|3122461_3123208_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|3123221_3123788_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|3124003_3125737_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001302043.1|3125913_3126402_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3126521_3126914_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3126913_3128992_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278931.1|3128984_3130133_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3130334_3130979_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3130989_3131379_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3131393_3132443_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3132445_3133306_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483252.1|3133324_3134926_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001359302.1|3134971_3136633_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.6	5.8e-11
WP_000147302.1|3136775_3137279_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3137299_3139264_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3139268_3140195_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3140191_3141079_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3141205_3141784_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001419883.1|3141786_3142137_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3142916_3143345_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3143351_3144776_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3144750_3145551_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3145717_3146704_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3146718_3148233_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3148302_3149292_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3150088_3150592_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3150671_3150923_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3151037_3151124_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3151386_3151710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3151880_3152378_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3152414_3152654_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3152845_3154057_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3154118_3154784_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3154911:3154970	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|3155140_3156142_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000490856.1|3156147_3156453_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|3156523_3157174_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|3157189_3157594_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|3157683_3157821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3157892_3158096_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3158117_3158468_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159462.1|3158478_3158757_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514281.1|3158768_3159011_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000021668.1|3159007_3159121_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985145.1|3159207_3159411_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000153681.1|3159407_3159653_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	90.1	1.7e-36
WP_000599403.1|3159794_3160160_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	2.1e-59
WP_000123437.1|3160166_3162989_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
WP_000686557.1|3163065_3164025_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_000211293.1|3164029_3164344_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000224220.1|3164796_3165060_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000236495.1|3165646_3166171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|3166185_3167232_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|3167231_3168983_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262679.1|3169137_3169974_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_001055077.1|3169997_3171050_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	9.2e-188
WP_000632312.1|3171095_3171896_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|3171997_3172492_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|3172491_3172692_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_024183580.1|3172694_3173018_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	6.3e-47
WP_000072343.1|3173014_3173407_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|3173403_3173811_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202149.1|3173949_3175827_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.0	1.3e-298
WP_001342220.1|3175850_3176318_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356338.1|3176310_3176946_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.8e-114
WP_077631798.1|3176957_3177524_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	5.6e-99
WP_001067540.1|3177541_3177871_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	6.4e-55
WP_001111954.1|3177874_3178771_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071727.1|3178763_3179372_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	7.6e-86
WP_000216962.1|3179368_3181372_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.6	4.1e-96
WP_000144027.1|3181371_3181950_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	1.0e-95
WP_000954200.1|3181993_3182566_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|3182722_3183211_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001419887.1|3183223_3186031_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.4	0.0e+00
WP_000333498.1|3186017_3186173_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_000665305.1|3186181_3186547_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|3186601_3187114_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|3187113_3188298_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132776.1|3188455_3189565_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.1	4.1e-202
WP_000488112.1|3189607_3189868_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3190059_3190200_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
3191140:3191263	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 9
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	3248042	3287084	5571128	capsid,lysis,holin,head,transposase,portal,terminase,tail	Enterobacteria_phage(35.9%)	40	NA	NA
WP_001023390.1|3248042_3248312_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	2.4e-44
WP_000279122.1|3248313_3249627_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	5.3e-76
WP_001253753.1|3249691_3250291_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	6.7e-111
WP_000649829.1|3253965_3254493_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3254683_3255316_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_053895436.1|3255261_3256005_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_171879521.1|3256015_3256714_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	100.0	9.5e-133
WP_000847304.1|3256713_3257043_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_171879526.1|3257039_3259619_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.7	0.0e+00
WP_000533419.1|3259599_3260013_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_000479105.1|3260039_3260471_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_171879525.1|3260484_3261237_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.0e-132
WP_000683079.1|3261244_3261640_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974985.1|3261636_3262170_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204554.1|3262185_3262539_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|3262531_3262915_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|3262966_3263995_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256821.1|3264052_3264400_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_114475637.1|3264436_3265942_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	9.3e-101
WP_000831776.1|3265931_3267524_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000259002.1|3267520_3267727_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_170986177.1|3268247_3269460_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000235436.1|3270923_3271433_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001436534.1|3271834_3272068_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.6	1.1e-19
WP_000079508.1|3272125_3272536_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001082533.1|3272843_3273308_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.9	4.5e-62
WP_001092893.1|3273606_3274140_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	8.1e-100
WP_024219164.1|3274176_3274734_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.3	3.9e-52
WP_000284510.1|3274737_3274953_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874312.1|3275103_3276957_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|3277217_3277553_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|3277833_3277965_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000935525.1|3278767_3279817_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	96.8	5.5e-201
WP_000917767.1|3279967_3280165_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640045.1|3280389_3280941_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.6	3.2e-67
WP_000904159.1|3280949_3281309_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	4.7e-35
WP_001265157.1|3281321_3282371_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.7e-109
WP_000287615.1|3282600_3284145_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000450876.1|3284578_3285349_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.7	2.0e-83
WP_000095669.1|3286121_3287084_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
>prophage 10
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	3753736	3789784	5571128	protease,integrase,lysis,holin,portal,terminase,transposase,tail	Enterobacteria_phage(58.33%)	42	3753321:3753335	3789858:3789872
3753321:3753335	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3753736_3754435_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3754665_3755547_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3755715_3755877_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_133302089.1|3756373_3757393_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950796.1|3757426_3758407_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	3.2e-86
WP_001101707.1|3758583_3758853_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000279047.1|3758854_3760168_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230272.1|3760232_3760832_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_171879535.1|3760901_3764315_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_000090845.1|3764375_3764984_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3764920_3765664_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152339.1|3765669_3766368_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3766377_3766707_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371991.1|3766706_3769772_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3769743_3770073_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001419733.1|3770081_3770468_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	8.0e-65
WP_000211123.1|3770528_3771272_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3771282_3771684_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3771680_3772259_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3772270_3772546_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3772538_3772862_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_000985965.1|3774920_3776429_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	1.0e-288
WP_001072975.1|3776428_3776641_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934091.1|3776637_3778740_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3778739_3779231_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3779905_3780058_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3780045_3780513_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075155.1|3780509_3781007_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	2.4e-90
WP_000284524.1|3781006_3781222_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3781364_3781763_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3781843_3782002_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3782087_3782831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3783016_3783706_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3783720_3783843_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3784181_3785141_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3785352_3786018_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108054.1|3786014_3786635_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	9.2e-95
WP_000567000.1|3786627_3786798_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3786794_3786977_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3786973_3787414_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_170986177.1|3787484_3788698_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_042094857.1|3788764_3789784_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	3.9e-191
3789858:3789872	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	4016534	4081750	5571128	protease,capsid,integrase,lysis,tRNA,holin,transposase,head,portal,terminase,tail	Enterobacteria_phage(60.0%)	74	4025012:4025058	4071544:4071590
WP_000420895.1|4016534_4017671_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383924.1|4017936_4020174_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001301880.1|4020160_4023133_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224578.1|4023133_4024024_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|4024206_4024968_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4025012:4025058	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001359465.1|4025410_4025848_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|4025872_4026457_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201812.1|4026955_4027909_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226371.1|4028095_4029580_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|4030124_4030793_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001419726.1|4030847_4031432_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_024183563.1|4031431_4034338_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_001230405.1|4034402_4035002_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000515301.1|4035068_4038467_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_000090855.1|4038527_4039136_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|4039072_4039816_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152525.1|4039821_4040520_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|4040519_4040849_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000235332.1|4040845_4043173_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000840184.1|4043182_4043407_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	4.4e-31
WP_000459484.1|4043399_4043834_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479153.1|4043815_4044238_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_024183562.1|4044253_4044994_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000683105.1|4045001_4045397_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|4045393_4045972_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753021.1|4045983_4046337_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	9.9e-62
WP_000710708.1|4046348_4046744_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_001419721.1|4046819_4047803_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	1.2e-170
WP_001299443.1|4047858_4048191_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|4048200_4049520_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001359455.1|4049500_4051102_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|4051098_4051305_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027246.1|4051301_4053227_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453580.1|4053201_4053747_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001300120.1|4054135_4054330_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|4054494_4054701_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001417742.1|4054986_4055397_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_000738495.1|4055688_4055982_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_122993458.1|4056072_4056255_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_001180487.1|4056471_4056948_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|4056934_4057240_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097226.1|4057561_4058251_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000971093.1|4058247_4058388_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001419720.1|4058384_4058747_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000224907.1|4059015_4059186_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|4059185_4059641_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|4059637_4059739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|4059829_4060111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|4060154_4060352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145437.1|4060579_4060864_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000788830.1|4060860_4061562_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000147924.1|4061558_4062578_-	replication protein	NA	M1FN81	Enterobacteria_phage	66.7	8.2e-109
WP_001182879.1|4062574_4063114_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000184665.1|4063144_4063372_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|4063482_4064175_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_114475610.1|4064285_4065890_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	1.2e-93
WP_000233576.1|4066478_4066685_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|4066760_4067057_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4067062_4067848_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186801.1|4067844_4068525_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.9e-131
WP_000149536.1|4068521_4068683_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.0	1.3e-21
WP_000129285.1|4068675_4069233_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|4069243_4069525_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763382.1|4069623_4069803_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	1.4e-27
WP_000488407.1|4069889_4070168_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001359450.1|4070366_4071530_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_001359679.1|4071864_4072497_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4071544:4071590	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255114.1|4072499_4073015_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691070.1|4073025_4074033_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001419152.1|4074045_4076655_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000729155.1|4078619_4079486_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4079487_4079700_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|4079807_4080329_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|4080364_4081750_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 12
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	4417122	4457975	5571128	transposase,integrase,tail	Enterobacteria_phage(20.0%)	39	4418467:4418512	4429703:4429748
WP_001130501.1|4417122_4418304_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	4.8e-145
4418467:4418512	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000950786.1|4420712_4421693_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001132166.1|4422692_4423283_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144082.1|4423465_4424092_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001117988.1|4424832_4425405_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_053887681.1|4425516_4425786_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.1	2.8e-32
WP_170986177.1|4425784_4426997_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_072184626.1|4427040_4427769_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	8.4e-47
WP_001281200.1|4427869_4428214_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000023577.1|4428527_4429688_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_000893281.1|4429892_4431146_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
4429703:4429748	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4431157_4432261_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4432548_4433604_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4433642_4434044_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189550.1|4434101_4435346_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4435437_4435896_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4436156_4437614_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4437670_4438228_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4438139_4438406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4438712_4439165_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4439174_4439573_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4439575_4439869_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226185.1|4439920_4440976_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4441046_4441832_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001419687.1|4441776_4443516_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4444421_4445195_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4445380_4445641_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|4445643_4445922_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4446077_4446818_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4446788_4447556_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4447660_4448239_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973088.1|4448478_4450923_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4450965_4451439_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4451592_4452363_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4452480_4453653_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4453733_4453919_+	protein YncO	NA	NA	NA	NA	NA
WP_032172865.1|4453833_4454049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145878.1|4455075_4456836_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420854.1|4456838_4457975_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038383	Escherichia coli O157:H7 strain DEC5E chromosome, complete genome	5571128	5335389	5386894	5571128	protease,capsid,integrase,plate,lysis,holin,transposase,head,terminase,portal,tail	Escherichia_phage(57.45%)	67	5352819:5352865	5384106:5384152
WP_000208242.1|5335389_5335920_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|5335929_5337261_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001308187.1|5337327_5338254_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|5338346_5338832_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001301616.1|5338891_5339566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232687.1|5339688_5340315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|5340353_5340599_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|5341024_5341870_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|5341892_5343401_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250646.1|5343630_5344641_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796310.1|5344737_5345484_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|5345488_5345917_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|5345943_5346243_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|5346454_5346895_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|5346995_5347595_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216332.1|5347702_5348470_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|5348524_5349280_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045680.1|5349386_5350376_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|5350694_5351657_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|5351837_5352740_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5352819:5352865	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|5352978_5353197_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000887621.1|5353278_5354442_-	phage late control D family protein	NA	A0A0F7LDR0	Escherichia_phage	99.5	7.0e-205
WP_000978907.1|5354441_5354921_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069965.1|5354935_5357383_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.5	0.0e+00
WP_000785970.1|5357375_5357495_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|5357527_5357803_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|5357859_5358378_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|5358390_5359581_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_000905098.1|5359640_5360234_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	3.2e-105
WP_032173126.1|5360261_5360663_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.7	1.0e-09
WP_000376432.1|5360666_5361086_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	1.9e-35
WP_001030516.1|5361057_5361660_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	2.0e-99
WP_114475604.1|5361659_5362994_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.8	6.4e-178
WP_001285340.1|5362990_5363602_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121459.1|5363594_5364503_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
WP_000287615.1|5364619_5366164_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001093742.1|5366467_5367103_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	8.5e-112
WP_001001786.1|5367169_5367622_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917188.1|5367614_5368082_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001300730.1|5368044_5368218_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040699.1|5368189_5368615_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.0	8.8e-65
WP_000736587.1|5368602_5369028_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.6e-58
WP_001144101.1|5369042_5369540_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|5369539_5369821_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|5369824_5370028_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988630.1|5370027_5370537_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.9e-90
WP_000203450.1|5370636_5371380_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	5.6e-123
WP_001248580.1|5371383_5372457_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	2.8e-200
WP_001085981.1|5372515_5373370_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	98.6	4.6e-137
WP_000156854.1|5373543_5375316_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_000038179.1|5375315_5376350_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_001461844.1|5376740_5377475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000554772.1|5377547_5377754_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	95.5	5.3e-31
WP_032173123.1|5377753_5378206_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	98.0	3.2e-81
WP_000268628.1|5378205_5380491_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027659.1|5380480_5380756_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|5380752_5380977_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|5380976_5381279_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|5381278_5381503_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217661.1|5381566_5382067_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_001005162.1|5382063_5382234_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001308179.1|5382236_5382509_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|5382645_5382939_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985245.1|5383008_5383989_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.4e-185
WP_001223800.1|5384175_5384676_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5384106:5384152	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|5384825_5385524_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|5385520_5386894_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP038384	Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-3, complete sequence	69832	1262	57824	69832	transposase,integrase	Enterobacteria_phage(20.0%)	55	8360:8389	25571:25600
WP_001066926.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001368887.1|2789_3164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526857.1|3366_3546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273581.1|3794_4232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165382802.1|4334_5547_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000470626.1|6700_7342_+	recombinase family protein	NA	NA	NA	NA	NA
8360:8389	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000429836.1|8384_8819_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|8890_9241_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|9254_9530_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|9565_9988_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|10039_11734_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|11751_12114_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|12110_12347_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|12382_13051_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000179844.1|13125_14805_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|14807_15668_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|15718_17263_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_171879538.1|17441_17942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|18069_18909_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|18902_19250_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|19413_20205_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|20353_21367_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|21569_21920_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|22045_22606_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|22608_25575_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000517696.1|26801_27395_+	hypothetical protein	NA	NA	NA	NA	NA
25571:25600	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_001418189.1|27676_28264_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000578011.1|28563_28905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969997.1|29100_29382_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079946.1|29378_29648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829588.1|29702_29861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083841.1|30692_30941_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001222321.1|32039_32441_-	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000088800.1|32534_33368_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000998852.1|33419_33935_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071526091.1|33921_35094_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000842183.1|35132_36110_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000082784.1|36106_36706_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_001420206.1|36702_37050_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082928.1|37064_37616_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001231213.1|37612_38047_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173149.1|38077_39301_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001418198.1|39302_40805_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_013009342.1|40801_42772_-	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001368871.1|42772_43648_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000770129.1|43731_46392_-	peptidase M66	NA	NA	NA	NA	NA
WP_000139371.1|49267_49828_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205758.1|49882_50629_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.0	6.0e-08
WP_077626248.1|50648_51110_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000399770.1|52373_52940_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|52961_53273_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_013009335.1|53684_54080_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001151524.1|55055_55439_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013009334.1|55772_56363_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001130323.1|56483_57824_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
