The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	1235905	1259406	5471440	transposase,integrase,tail,holin	Enterobacteria_phage(33.33%)	27	1227551:1227565	1260277:1260291
1227551:1227565	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1235905_1237111_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1237112_1238426_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1238422_1240054_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1240054_1240453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1240550_1240964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150578.1|1241359_1242604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1242679_1243015_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1243017_1243773_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1244114_1244681_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1244655_1245267_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1245263_1245929_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1245925_1246549_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1246801_1247545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1247630_1247798_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1248205_1250059_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1250208_1250424_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1250428_1250773_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171540.1|1251129_1251510_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1251506_1251854_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1252354_1253568_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1253785_1254055_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1254215_1254638_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1254767_1255826_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1255904_1256555_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1256737_1257328_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1257829_1258078_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1258923_1259406_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1260277:1260291	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	1536978	1542404	5471440	integrase	Enterobacteria_phage(50.0%)	6	1525966:1525982	1544600:1544616
1525966:1525982	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1536978_1537548_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1537547_1538015_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1538001_1538682_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1538691_1539828_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1540002_1541160_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1541471_1542404_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1544600:1544616	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	1788520	1895961	5471440	holin,tRNA,terminase,protease,tail,integrase,portal	Enterobacteria_phage(49.4%)	122	1873152:1873166	1898023:1898037
WP_000569336.1|1788520_1789447_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1789451_1790183_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1790163_1790271_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1790330_1791032_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1791052_1792339_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1792372_1792627_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1792645_1792780_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1792783_1793026_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1793113_1793476_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1793472_1793829_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1794162_1794339_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1794340_1795288_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1795284_1795506_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1795604_1795886_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1795896_1796088_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1796060_1796243_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1796242_1796920_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1796916_1797702_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1797707_1798004_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1798079_1798286_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1798766_1799144_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1799121_1800183_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1800263_1800953_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1801057_1801288_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1801357_1801897_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|1801893_1802913_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_000788810.1|1802909_1803611_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1803607_1803910_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1803977_1804310_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1804401_1804509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1804566_1806093_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1806557_1807109_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1807118_1807916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1808032_1808134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1808130_1808586_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1808585_1808756_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1808748_1809039_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1809035_1809398_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1809394_1809535_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1809620_1810055_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1810306_1810459_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1811262_1813209_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1813345_1813525_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1813565_1813811_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1813888_1814104_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1814108_1814642_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1814912_1815482_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1815481_1815628_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1815855_1816041_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1816558_1817035_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_086257459.1|1817031_1819155_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102414.1|1819151_1819364_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1819363_1820866_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1820810_1822835_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1822922_1823249_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1823241_1823523_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1823525_1824149_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1824161_1824560_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1824567_1825320_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1825333_1825756_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1825782_1826091_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1826134_1828780_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1828776_1829106_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1829105_1829804_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1829814_1830558_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1830503_1831133_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514991.1|1831373_1834847_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228302.1|1834914_1835514_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1835578_1836892_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1836893_1837163_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1837530_1837779_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1838293_1839979_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1839975_1840695_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1840741_1841212_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1841253_1841715_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1841839_1843843_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1843839_1844976_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1844968_1845700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1845718_1847248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1847258_1848347_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1849587_1849905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1849966_1853596_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1860553_1862587_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1862718_1863828_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1864089_1864371_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1864662_1865205_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1865292_1865967_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1865982_1868463_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1868473_1869508_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1869589_1869928_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1870145_1870997_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1871117_1871390_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1871499_1871814_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1871823_1872171_-	hypothetical protein	NA	NA	NA	NA	NA
1873152:1873166	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1873221_1873461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1873794_1874583_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1874579_1875380_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1875444_1876263_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1876314_1877061_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1877034_1878000_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1877996_1879001_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1878997_1880275_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1880531_1881584_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1881882_1882737_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1882765_1884028_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1884037_1884490_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1884520_1884805_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1884808_1886164_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1886211_1887252_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1887351_1888131_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1888212_1889112_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1889517_1889835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1890099_1891113_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1891228_1891528_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1891649_1891925_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1891935_1892106_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1892102_1892603_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1892666_1892891_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1892890_1893190_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1893192_1893417_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1893413_1893689_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1893678_1895961_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1898023:1898037	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	1900056	1926278	5471440	holin,plate,tRNA,terminase,lysis,head,tail,capsid,portal	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1900056_1901091_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1901090_1902863_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1903036_1903891_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1903949_1905023_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1905026_1905770_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1905869_1906379_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1906378_1906582_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1906585_1906867_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1906866_1907364_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1907378_1907804_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1907791_1908217_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1908188_1908362_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1908324_1908792_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1908784_1909237_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1909303_1909939_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1909935_1910283_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1910287_1911196_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1911188_1911800_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217043.1|1911796_1912996_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001008233.1|1913016_1913460_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1913431_1914034_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1914033_1914567_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1914594_1915188_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1915247_1916438_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1916450_1916969_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1917025_1917301_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1917333_1917453_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1917445_1919893_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1919907_1920387_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1920386_1921550_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1921631_1921850_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1922123_1923485_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|1923632_1923965_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1924155_1924878_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1924874_1926278_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	2009502	2148454	5471440	terminase,transposase,protease,lysis,head,portal,tail,integrase,capsid,holin	Stx2-converting_phage(36.51%)	163	2006120:2006134	2108528:2108542
2006120:2006134	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|2009502_2010681_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2010661_2010853_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2010930_2011275_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2011462_2011813_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2011809_2012166_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|2012499_2012676_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289930.1|2012677_2013625_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2013621_2013843_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2013941_2014223_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|2014233_2014425_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|2014397_2014580_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2014576_2015257_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001301718.1|2015253_2016039_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_000995486.1|2016044_2016341_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2016415_2016559_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2016527_2016692_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2016764_2017133_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2017315_2017567_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2017625_2017898_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2017875_2018058_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2018626_2019148_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2019649_2020345_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2020420_2020636_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2020777_2021074_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2021106_2021268_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2021254_2022076_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2022072_2023449_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2023519_2023798_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2023930_2024146_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2024156_2024393_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2024349_2024796_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2024792_2025320_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2025316_2025499_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208493.1|2025773_2026502_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	95.2	1.4e-113
WP_000849633.1|2026757_2027438_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2027512_2028235_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2028234_2028840_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2028836_2029508_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2029498_2029987_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649753.1|2030636_2031596_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738080.1|2031607_2031877_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2032173_2032497_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|2032740_2034678_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2034814_2034994_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2035034_2035307_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2035383_2035599_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2035598_2036096_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2036092_2036530_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2036732_2037230_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2037226_2037484_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2037946_2038174_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2038215_2038581_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958361.1|2038873_2039437_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	94.7	5.6e-83
WP_001303179.1|2039433_2041095_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_096952392.1|2041158_2043096_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063023.1|2043140_2043362_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|2045887_2046214_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2046223_2046574_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2046570_2047017_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2047013_2047358_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2047416_2048133_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2048138_2048513_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2048608_2048818_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212920.1|2048869_2052112_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2052104_2052446_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001302649.1|2053188_2053509_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2053616_2053790_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001414206.1|2053860_2054784_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_000967278.1|2054838_2055576_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_122994717.1|2055521_2056154_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_171880606.1|2056392_2057568_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	99.5	3.3e-234
WP_171880614.1|2057519_2059871_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_171880607.1|2059938_2060538_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	2.2e-109
WP_171880608.1|2060602_2061916_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.9	6.9e-76
WP_001023381.1|2061917_2062187_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000491542.1|2062327_2063203_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2063427_2064078_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2065402_2066569_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2066687_2067161_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2067359_2068418_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2068589_2068919_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2069019_2069202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2069690_2069804_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2069816_2070011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2070469_2070838_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2070911_2071133_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2071195_2071672_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860080.1|2071686_2072166_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001234544.1|2072247_2073069_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2073289_2073700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2073715_2074399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2074534_2075605_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2075601_2076507_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|2076503_2077358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2077639_2079787_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2081234_2082773_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2082822_2083170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2083166_2083547_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000973176.1|2083908_2084454_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2084450_2085194_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2085205_2086285_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2086346_2087282_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2087738_2088656_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2088757_2089708_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2089825_2091469_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2092094_2092811_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2093153_2094608_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2094709_2096026_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2096339_2097392_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2097653_2105636_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2106125_2106923_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2107158_2108181_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2108180_2108384_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2108442_2110914_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2108528:2108542	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2111009_2111198_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2111194_2111383_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2111863_2112016_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2112290_2112935_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2113032_2113260_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2113256_2113682_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2113750_2114788_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2114699_2115242_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2115276_2115975_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2115996_2116221_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2116217_2116574_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2116606_2116759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2116755_2117067_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2117193_2117757_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2117866_2117971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2118157_2118370_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2118537_2118816_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2118817_2119867_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2119879_2120239_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2120235_2120925_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2121558_2121987_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2122464_2124315_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2124396_2125610_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2125920_2126136_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2126140_2126485_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2126535_2127069_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2127224_2127407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2127419_2127551_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2127778_2127964_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2128490_2128805_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2128886_2129111_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2129505_2130015_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2131899_2132106_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2132102_2133695_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2133684_2135190_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2135226_2135574_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2135631_2135898_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2135879_2136620_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2136633_2137065_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2137091_2137505_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_021498924.1|2137485_2140065_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_171880609.1|2140061_2140391_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	1.2e-58
WP_001301816.1|2140390_2141089_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_171880610.1|2141099_2141843_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_072147834.1|2141788_2142418_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_171880611.1|2142658_2146138_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
WP_001230508.1|2146205_2146805_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268847.1|2146869_2148183_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2148184_2148454_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	2206034	2226020	5471440	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2214160:2214174	2231111:2231125
WP_032161583.1|2206034_2207171_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2207121_2207445_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2207602_2208787_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2208786_2209299_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2209353_2209719_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2209727_2209883_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2212685_2213174_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2213330_2213903_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2213946_2214477_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
2214160:2214174	attL	TTTTTCTGCTTCTGC	NA	NA	NA	NA
WP_000211280.1|2215568_2215883_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2215887_2216847_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2216923_2219746_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599379.1|2219752_2220118_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2220114_2220732_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2220743_2221043_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2221039_2221306_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2221302_2221506_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2221529_2221946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2222038_2222152_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2222148_2222391_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2222402_2222681_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2222691_2223042_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2223063_2223267_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2223338_2223476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2223565_2223970_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2223985_2224636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2224665_2225013_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2225018_2226020_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2231111:2231125	attR	GCAGAAGCAGAAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	2561272	2631102	5471440	tail,terminase,protease,head,portal,transposase,capsid,holin	Stx2-converting_phage(39.62%)	77	NA	NA
WP_001260835.1|2561272_2562094_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2562193_2562277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2562369_2562705_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2563101_2564355_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2564461_2565355_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2565489_2566710_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2566834_2567530_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2567482_2568775_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2568932_2569547_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2569589_2570444_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2570445_2571063_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2571073_2573497_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2573557_2575984_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2576182_2576488_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2576595_2577306_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2577308_2577869_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2577903_2578245_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2578379_2578706_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2579694_2579946_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001491751.1|2580018_2581359_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	1.8e-58
WP_162829202.1|2581453_2582667_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001090200.1|2583895_2584087_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2584083_2584272_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2584672_2584837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2584840_2585059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2585130_2585430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2585781_2586060_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2586061_2586253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2586273_2586645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2586866_2588079_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000693943.1|2588354_2588780_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2588802_2589765_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788939.1|2589771_2590512_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	1.7e-124
WP_001118159.1|2591322_2591718_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2591774_2592359_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2592474_2592579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2592767_2592980_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2593147_2593426_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2593427_2594477_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2594489_2594849_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2594845_2595535_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2596171_2596600_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2597078_2598929_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2599368_2599584_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2599588_2599933_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2599983_2600517_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2600787_2601357_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2601356_2601503_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2601730_2601916_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2602340_2602568_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2602609_2602975_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958360.1|2603267_2603831_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_001301491.1|2603827_2605489_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2605552_2607490_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2607534_2607756_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2607701_2610281_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125988.1|2610283_2610610_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2610619_2610970_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2610966_2611413_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2611409_2611754_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2611819_2612536_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2612550_2612925_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2613020_2613230_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212818.1|2613277_2616520_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2616512_2616854_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|2616853_2617552_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_086257471.1|2617562_2618306_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.8	2.8e-146
WP_140407598.1|2618251_2618884_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.8	3.0e-101
WP_001230508.1|2623371_2623971_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268849.1|2624035_2625349_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2625350_2625620_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2625733_2626309_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2626381_2627011_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2627092_2627734_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2627895_2628138_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2628269_2629553_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2629641_2631102_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
>prophage 8
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	2901480	3021926	5471440	terminase,transposase,protease,head,lysis,portal,tail,integrase,capsid,holin	Escherichia_phage(33.65%)	143	2916982:2917009	3022089:3022116
WP_000422055.1|2901480_2902530_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2902749_2903508_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2903504_2904095_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2904134_2905007_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2905219_2906803_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2906830_2907451_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2907447_2908329_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2908466_2908511_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2908602_2910165_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2910164_2911760_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2911760_2913122_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2913133_2914327_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2914326_2915133_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2915513_2915693_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2915778_2916279_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2916324_2916831_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2916982:2917009	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000251936.1|2917320_2917491_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_032156508.1|2917868_2918453_-	protein kinase	NA	NA	NA	NA	NA
WP_001023406.1|2919583_2919853_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_078188319.1|2919854_2921168_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	8.5e-82
WP_001230517.1|2921232_2921832_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_001303164.1|2921898_2925375_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.2	0.0e+00
WP_069905658.1|2925615_2926245_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_062946134.1|2926190_2926934_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	4.0e-145
WP_001151061.1|2926939_2927638_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.4e-131
WP_000847298.1|2927637_2927967_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303163.1|2927963_2930609_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|2930652_2930961_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|2930987_2931410_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|2931423_2932176_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2932183_2932582_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2932594_2933218_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2933220_2933502_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2933494_2933821_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2933908_2935933_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_096952391.1|2935877_2937380_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.6	9.1e-290
WP_000102415.1|2937379_2937592_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077609.1|2937588_2939712_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.2	0.0e+00
WP_000373407.1|2939708_2940185_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2940659_2940845_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2941363_2941897_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|2941933_2942491_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|2942494_2942710_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2942787_2943033_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2943073_2943253_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142977.1|2943387_2945334_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
WP_000483509.1|2945928_2946987_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|2947137_2947335_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2947561_2948383_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2948379_2948754_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001366907.1|2948766_2949816_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	7.7e-110
WP_001304183.1|2949817_2950096_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|2950161_2950329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2950607_2950820_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2951008_2951113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2951228_2951591_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2951587_2951959_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2951994_2952207_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2952255_2952612_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118159.1|2952668_2953064_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000450843.1|2953079_2953850_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	7.9e-80
WP_000790456.1|2953879_2954620_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2954626_2955580_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2955602_2956028_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2956011_2956287_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2956389_2956779_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380323.1|2956947_2957100_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_001302871.1|2957111_2957417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555741.1|2957403_2957709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2958272_2958461_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2958457_2958646_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102179.1|2958738_2961183_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|2961247_2961496_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|2961473_2962604_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_001345079.1|2963903_2964554_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2966060_2966651_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2966834_2967482_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2967618_2967765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2968192_2968471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2968810_2969191_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2969187_2969535_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2969584_2971123_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2972088_2972658_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2972723_2973635_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2973741_2973864_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2975461_2976787_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2977813_2978083_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_171880613.1|2978084_2979398_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.7	2.9e-74
WP_001228304.1|2979549_2980149_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000514948.1|2980216_2983072_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_122989782.1|2983312_2983942_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_001151105.1|2984641_2985340_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2985339_2985669_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643101.1|2985665_2988278_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000533440.1|2988258_2988672_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2988698_2989121_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2989134_2989887_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2989894_2990290_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2990286_2990820_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2990834_2991188_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2991199_2991598_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2991639_2992665_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2992720_2993053_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2993062_2994382_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2994362_2995964_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2995960_2996167_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2996163_2998089_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2998063_2998609_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2998995_2999220_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2999301_2999616_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|3000079_3000547_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|3000554_3000701_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3000700_3001270_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3001540_3002074_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3002124_3002469_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3002473_3002689_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143070.1|3002838_3004692_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000935548.1|3005488_3006547_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3006697_3006895_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3007136_3007667_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3007675_3008035_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3008047_3009094_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3009095_3009374_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3009443_3009701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3009921_3010134_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3010412_3011171_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3011869_3012034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3012030_3012612_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3012798_3013341_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3013252_3014293_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3014264_3014816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3014799_3015027_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3015103_3015511_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3015774_3016074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3016146_3016365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3016387_3016795_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3016772_3017006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3016999_3017167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3017564_3017753_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|3017749_3017941_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3018033_3020505_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3020569_3020818_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3020795_3021926_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3022089:3022116	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	3068648	3175789	5471440	holin,tail,tRNA,terminase,protease,head,lysis,transposase,integrase,capsid,portal	Enterobacteria_phage(50.0%)	109	3105287:3105302	3169692:3169707
WP_001299679.1|3068648_3069905_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3070118_3070742_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3070741_3071593_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3071743_3072691_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3072815_3074495_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3074549_3074828_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3075105_3075690_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3075806_3076898_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3077741_3080627_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3080726_3082646_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3082873_3083944_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3083954_3084587_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3084597_3086016_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000060146.1|3088350_3089373_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3089372_3090353_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3090349_3091108_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3091926_3092781_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3092806_3094777_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3094826_3095081_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3095929_3097142_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3097330_3097942_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3098041_3098956_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3099051_3100788_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3101959_3103030_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3103039_3104338_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3104700_3106233_+	SpoVR family protein	NA	NA	NA	NA	NA
3105287:3105302	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3106284_3107004_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3107225_3108767_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3108912_3109443_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3109488_3110757_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3110756_3111176_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3111548_3112460_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3112666_3113128_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3113204_3113864_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3113935_3114229_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3114240_3114399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3114469_3114871_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3114973_3115342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3115861_3116557_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3116580_3117393_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3117396_3117663_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3118901_3119486_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3119984_3120938_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3121124_3122609_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3122911_3124450_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3124499_3124847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3124843_3125224_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3125299_3125548_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3125604_3126273_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3126770_3126953_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3127031_3127532_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3127568_3128075_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3128093_3128984_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3129103_3129685_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3129684_3132600_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3132664_3133264_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3133330_3136729_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3136789_3137422_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3137358_3138102_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3138107_3138806_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3138805_3139135_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3139131_3141681_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3141673_3142108_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3142089_3142512_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3142527_3143268_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3143275_3143671_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3143667_3144246_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3144257_3144611_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3144622_3145021_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3145062_3146088_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3146143_3146476_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3146485_3147805_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3147785_3149387_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3149383_3149590_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3149586_3151512_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3151486_3152032_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3152420_3152615_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3152779_3152986_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3153271_3153682_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3153973_3154267_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3154357_3154540_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3154756_3155233_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3155219_3155525_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3155846_3156536_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3156532_3156673_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3156669_3157032_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3157028_3157319_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3157311_3157482_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3157481_3157937_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709088.1|3158438_3159965_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3160022_3160145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3160209_3160542_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3160609_3160912_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788834.1|3160908_3161610_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	4.9e-129
WP_000088655.1|3162534_3162771_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3162760_3163903_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3164016_3165267_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3165438_3166092_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3166101_3166563_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3166616_3167723_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3167758_3168400_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423733.1|3168403_3169774_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	1.2e-107
3169692:3169707	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3169942_3170614_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3170613_3172074_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3172674_3172956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3173211_3173754_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3173959_3174373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3174385_3174721_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3174733_3175789_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	3181881	3239232	5471440	holin,terminase,head,tail,integrase,capsid,portal	Stx2-converting_phage(26.79%)	71	3224799:3224819	3245889:3245909
WP_000085256.1|3181881_3183111_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3183359_3184481_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3184529_3185756_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3186005_3187142_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3187125_3187989_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3188352_3189714_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3189774_3190050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3192358_3195760_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3196350_3198699_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3198718_3198808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3198820_3199057_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3199002_3199740_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3199793_3200672_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3200974_3201085_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3201194_3201449_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3201465_3202164_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3202163_3202505_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212850.1|3202497_3205740_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_001453698.1|3205792_3206002_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3206097_3206472_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3206486_3207203_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3207268_3207613_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3207609_3208056_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3208052_3208403_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3208412_3208739_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_120795340.1|3208818_3211320_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_001063099.1|3211265_3211487_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3211531_3213469_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3213532_3215194_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|3215190_3215754_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000279786.1|3216043_3216409_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3216450_3216636_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3216765_3216906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3217262_3217487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3217551_3217758_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3217985_3218132_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3218131_3218701_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3218971_3219505_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3219555_3219900_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3219904_3220120_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3220195_3220465_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3220502_3220685_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3220832_3222770_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3223084_3223252_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3223848_3224670_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217439.1|3224666_3225041_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.4e-34
3224799:3224819	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3225053_3226103_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3226104_3226383_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3226550_3226763_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3226951_3227056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3227171_3227759_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3227761_3227953_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3227954_3228392_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3228378_3228696_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3228649_3228967_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001496829.1|3228956_3229259_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	86.9	1.2e-44
WP_072140318.1|3229255_3229537_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3229569_3230286_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3230319_3230862_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3230773_3231811_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3231879_3232305_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3232288_3232612_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3232736_3233213_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3233528_3233681_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3233795_3234311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3234443_3234833_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3234894_3235164_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3235132_3236251_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3236417_3237212_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3237208_3238255_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3238410_3239232_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3245889:3245909	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	3499688	3555302	5471440	holin,transposase,protease,head,tail,capsid,portal	Escherichia_phage(26.19%)	61	NA	NA
WP_000003653.1|3499688_3500276_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3500272_3500980_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3500998_3502792_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3502788_3503907_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3506180_3506450_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3506451_3507765_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3507829_3508429_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515102.1|3508496_3511970_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.4	0.0e+00
WP_000649829.1|3512103_3512631_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3512821_3513454_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_050946666.1|3513399_3514143_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_001151105.1|3514153_3514852_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3514851_3515181_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082463.1|3515177_3517757_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3517737_3518151_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3518177_3518609_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3518622_3519363_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3519344_3519611_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3519668_3520016_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3520052_3521558_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3521547_3523140_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3523136_3523343_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3525519_3527058_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3527107_3527455_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3527451_3527832_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3527907_3528183_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3528933_3529140_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3529395_3529668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3529827_3530361_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3530581_3530695_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3530916_3531102_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3531629_3531944_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3532148_3533362_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3533537_3535388_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3536155_3536869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3537489_3538308_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3538459_3538831_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3538820_3539192_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3539204_3540254_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3540255_3540534_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3540701_3540857_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3540958_3541096_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3541461_3542235_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3542586_3543000_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3543015_3543786_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3543807_3544554_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3544560_3545652_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3545730_3546186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3546392_3546818_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3546801_3547074_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3547182_3547584_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3547611_3547803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3547802_3548090_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3548367_3548523_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3548664_3549054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3549240_3549426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3549999_3550188_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3550184_3550376_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3550469_3552941_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3553008_3553251_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3554642_3555302_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 12
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	3786213	3824314	5471440	holin,terminase,protease,lysis,tail,integrase,portal	Enterobacteria_phage(48.84%)	50	3785798:3785812	3824388:3824402
3785798:3785812	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3786213_3786912_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951025.1|3787142_3788024_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3788193_3788355_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3788851_3789871_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3789904_3790885_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3791061_3791331_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|3791332_3792649_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|3792708_3793308_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3793378_3796792_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3796852_3797461_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3797397_3798141_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152359.1|3798146_3798845_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	8.6e-134
WP_000447253.1|3798854_3799184_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3799183_3802249_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3802220_3802550_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3802558_3802945_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3803005_3803749_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3803759_3804161_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3804157_3804736_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3804747_3805023_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3805015_3805339_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3805425_3807453_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3807397_3807733_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3807854_3808979_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3808906_3809119_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3809115_3811218_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3811217_3811709_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3812383_3812536_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3812523_3812991_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3812987_3813485_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3813484_3813700_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3813842_3814241_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3814321_3814480_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3814565_3815309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3815492_3816182_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3816196_3816319_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3816656_3817616_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3817827_3818493_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3818489_3819110_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3819102_3819273_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3819269_3819452_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3820149_3820830_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3820826_3821009_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3820981_3821173_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3821183_3821465_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3821563_3821785_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3821995_3822598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545730.1|3822840_3823008_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	3.7e-27
WP_001303849.1|3823047_3823266_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3823243_3824314_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3824388:3824402	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	4361204	4465789	5471440	plate,transposase,integrase,tail	Enterobacteria_phage(25.81%)	103	4395297:4395315	4451976:4451994
WP_162829242.1|4361204_4362417_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001038968.1|4363937_4364294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301573.1|4364581_4365508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4365664_4366585_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182335.1|4366819_4367962_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000998048.1|4368773_4370312_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4370361_4370709_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4370705_4371086_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4371349_4371613_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4371612_4371753_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4371822_4372014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4372838_4373381_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4373455_4374043_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4374100_4374769_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4374794_4377320_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4377309_4378953_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4378921_4379632_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4379944_4380274_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4380521_4381136_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4381553_4382243_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4382239_4383196_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4383192_4385391_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4385400_4386357_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4386535_4387663_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4387804_4388863_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4389108_4390011_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4390713_4390992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4391158_4391881_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4391979_4392879_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4393554_4394511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4394643_4396977_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4395297:4395315	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4396990_4397314_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4397313_4397535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4397531_4398089_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4398085_4398346_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4399279_4400032_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4400028_4400580_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4400585_4400858_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4401267_4401834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|4402033_4402423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4402453_4403086_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4403078_4403537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4403536_4404154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4404126_4404543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4404546_4405728_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4406690_4407434_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4408257_4409031_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4409088_4409643_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4409672_4410083_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4410103_4410547_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4410518_4411112_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4411111_4411906_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4411905_4412217_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4413168_4413462_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4413580_4413781_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4413881_4414595_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4414722_4415106_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_162829202.1|4415131_4416344_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4416671_4416917_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4417986_4419240_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4419251_4420355_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749887.1|4420642_4421698_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4421736_4422138_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4422195_4423440_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4423531_4423990_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293020.1|4424250_4425708_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4425764_4426322_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4426233_4426500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4426806_4427259_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4427268_4427667_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4427669_4427963_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4428014_4429070_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4429140_4429926_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4429870_4431610_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4432427_4433201_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4433386_4433647_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4433665_4433926_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4434081_4434822_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4434792_4435560_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4435664_4436243_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4436482_4438927_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4438969_4439443_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4439596_4440367_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4440484_4441657_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4441737_4441923_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4441837_4442101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4442302_4444063_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4444065_4445202_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356741.1|4445947_4446535_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4446603_4448112_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000995683.1|4448293_4449010_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|4449149_4453382_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
4451976:4451994	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103125.1|4453457_4455599_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4455808_4456327_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4457023_4457524_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4457558_4457783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4457833_4459225_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4459315_4459729_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4459732_4461583_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4461546_4462629_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4462653_4463934_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4463930_4464455_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4464457_4465789_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	4904024	4963031	5471440	protease,transposase	Klosneuvirus(14.29%)	58	NA	NA
WP_001162171.1|4904024_4905377_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4905470_4906022_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4906177_4907551_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4907726_4908725_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4908757_4909753_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4909739_4910762_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4912417_4913374_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4913683_4914214_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4914293_4914644_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4914637_4914889_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4915100_4915442_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4915444_4919224_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4919220_4920954_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4921159_4921798_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4922120_4923464_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4923542_4923749_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4924073_4924628_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4924690_4925629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4925840_4926581_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4926770_4928714_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4928831_4929212_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4929300_4930161_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4930268_4931234_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4931341_4932004_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4932048_4933461_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4933769_4934390_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4934607_4935246_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4935380_4936589_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4936596_4937028_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4937650_4938445_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4938515_4938965_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4939006_4939234_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4939238_4939553_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4939559_4939955_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001170812.1|4940685_4941372_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4941371_4942226_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4942235_4942886_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4942899_4943364_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4943373_4943679_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4943694_4945092_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4945446_4946511_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4946618_4947374_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4947370_4948120_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4948301_4948631_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4948779_4949055_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4949171_4950797_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000101670.1|4952042_4952681_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4952690_4953089_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4953106_4953766_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4953816_4954515_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4954533_4954935_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4955061_4955793_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4955973_4958415_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4958453_4958879_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4959083_4960382_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4960485_4960683_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4960764_4961769_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4961771_4963031_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038380	Escherichia coli O157:H7 strain E32511 chromosome, complete genome	5471440	5099902	5114567	5471440	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	19	5095743:5095758	5113272:5113287
5095743:5095758	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5099902_5101318_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5101400_5102384_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5102549_5102792_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5102925_5103963_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5104051_5105149_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5105210_5105459_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5105619_5106261_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5106342_5106972_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5107044_5107617_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5107728_5107998_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5107999_5109313_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5109377_5109977_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5111298_5111835_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5111825_5112176_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5112172_5112457_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5112792_5112990_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5113334_5113616_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5113272:5113287	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5113663_5113837_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5114033_5114567_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
