The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	356958	371623	5523389	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	19	358239:358254	375768:375783
WP_000956557.1|356958_357492_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|357688_357862_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|357909_358191_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358239:358254	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358535_358733_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359068_359353_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359349_359700_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|359690_360227_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|361548_362148_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|362212_363526_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|363527_363797_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|363908_364481_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364553_365183_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365264_365906_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366066_366315_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366376_367474_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367562_368600_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|368733_368976_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369141_370125_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370207_371623_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
375768:375783	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	508503	567531	5523389	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|508503_509763_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|509765_510770_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|510851_511049_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511152_512451_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512655_513081_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513119_515561_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|515741_516473_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516599_517001_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517019_517718_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|517768_518428_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518445_518844_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|518853_519492_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519494_520658_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|520741_522367_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522483_522759_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|522907_523237_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|523418_524168_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524164_524920_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|526446_527844_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|527859_528165_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528174_528639_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528652_529303_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|529312_530167_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530166_530853_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|530981_531257_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531583_531979_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|531985_532300_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532304_532532_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532573_533023_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533093_533888_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534510_534942_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|534949_536158_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536292_536931_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537148_537769_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538077_539490_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539534_540197_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540304_541270_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541377_542238_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|542326_542707_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|542824_544768_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|544957_545698_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|545909_546848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|546910_547465_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|547789_547996_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548091_549435_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|549757_550396_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550601_552335_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552331_556111_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556113_556455_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556666_556918_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|556911_557262_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557341_557872_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558181_559138_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|559277_560780_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|560793_561816_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|561802_562798_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|562830_563829_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564004_565378_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565533_566085_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566178_567531_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	599951	612527	5523389	integrase	Enterobacteria_phage(81.82%)	15	594984:594999	613479:613494
594984:594999	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|599951_601226_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|601393_601699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|601775_602510_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|602547_603792_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|604117_604690_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|604763_605264_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283021.1|605260_605995_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|606546_606813_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|606809_607400_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|607392_607680_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|607672_608128_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|608263_608584_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|608598_610932_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|611287_611482_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|611699_612527_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
613479:613494	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 4
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	1007284	1074108	5523389	tail,integrase,lysis,transposase,holin,plate	Shigella_phage(37.5%)	75	1064659:1064674	1079468:1079483
WP_000246433.1|1007284_1008616_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1008618_1009143_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1009139_1010420_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1010444_1011527_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1011490_1013341_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1013344_1013758_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1013848_1015240_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1015290_1015515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1015549_1016050_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1016745_1017264_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1017473_1019615_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_128484508.1|1019690_1023914_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1024115_1024379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1024293_1024479_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|1024559_1025732_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1025849_1026620_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1026773_1027247_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|1027289_1029734_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|1029973_1030552_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1030656_1031424_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1031394_1032135_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|1032290_1032551_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1032569_1032830_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1033015_1033789_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|1034606_1036346_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|1036290_1037076_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1037146_1038202_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1038253_1038547_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1038549_1038948_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|1038957_1039410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1039716_1039983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023438539.1|1039894_1040452_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1040508_1041966_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1042226_1042685_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1042776_1044021_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|1044078_1044480_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1044518_1045574_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1045861_1046965_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1046976_1048230_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_128484509.1|1048434_1049598_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	1.0e-227
WP_000206732.1|1049824_1050130_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1050129_1050492_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1050482_1051019_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1051695_1051992_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1052269_1052962_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1053059_1053320_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1053312_1053864_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1054039_1054219_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1054208_1055150_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1055146_1055641_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1055640_1056294_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1056290_1056617_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1056613_1057003_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1057022_1057832_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1057839_1058829_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1058842_1059595_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1059809_1060349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1060492_1060726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1061004_1061298_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1061434_1061770_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1061773_1062250_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1062466_1062649_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1062739_1063033_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_162829202.1|1063404_1064618_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
1064659:1064674	attL	TCCGGGGCGGTTCAGT	NA	NA	NA	NA
WP_000424732.1|1064709_1065135_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1065121_1066180_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1066170_1066755_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554706.1|1066758_1067529_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000368084.1|1067528_1068131_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|1068102_1068546_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|1068566_1068977_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|1069007_1069562_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1069622_1070396_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_128484510.1|1071220_1071964_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|1072926_1074108_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1079468:1079483	attR	ACTGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 5
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	1653048	1694338	5523389	tail,integrase,lysis,transposase,holin,terminase,portal,protease	Enterobacteria_phage(47.83%)	52	1642490:1642504	1677229:1677243
1642490:1642504	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000034810.1|1653048_1653819_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
WP_001303849.1|1654092_1654311_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1654350_1654518_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1654760_1655363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1655573_1655795_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1655893_1656175_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1656185_1656377_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1656349_1656532_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1656528_1657209_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1657906_1658089_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1658085_1658256_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1658248_1658869_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1658865_1659531_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1659742_1660702_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1661039_1661162_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1661176_1661866_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1662049_1662793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1662878_1663037_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1663117_1663516_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1663658_1663874_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1663873_1664371_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1664367_1664835_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1664822_1664975_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000934137.1|1666139_1668242_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|1668238_1668451_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1668378_1669503_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1669624_1669960_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1669904_1671932_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_000998048.1|1672132_1673671_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1673720_1674068_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1674064_1674445_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_171878309.1|1674504_1674792_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	1.3e-40
WP_001283153.1|1674784_1675060_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1675071_1675650_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1675646_1676048_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1676058_1676802_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1676862_1677249_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1677229:1677243	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1677257_1677587_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1677558_1680624_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1680623_1680953_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1680962_1681661_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1681666_1682410_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1682346_1682955_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000881110.1|1684923_1686429_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.4	3.5e-281
WP_001233141.1|1686499_1687099_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1687158_1688475_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1688476_1688746_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1688922_1689903_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1689936_1690956_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1691452_1691614_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1691782_1692664_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_162829202.1|1693125_1694338_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	1759074	1797973	5523389	tail,transposase,head,plate,protease	Shigella_phage(56.41%)	58	NA	NA
WP_001056416.1|1759074_1759659_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|1759826_1760075_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|1760076_1762167_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|1762238_1763171_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|1763173_1763395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1763407_1763662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1763663_1763945_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1763941_1764214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|1764218_1764512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1764523_1765054_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|1765151_1765694_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|1765697_1766231_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|1766230_1766746_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|1766749_1767301_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|1767297_1767609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|1767623_1767974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|1767989_1768322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1768314_1768512_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370521.1|1768501_1768798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|1768794_1769304_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852378.1|1769373_1769799_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1769870_1770371_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_122994438.1|1770405_1770834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122255.1|1770817_1771036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|1771046_1771274_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|1771254_1771563_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|1771559_1771850_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360581.1|1771852_1772434_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|1772433_1774098_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532590.1|1774097_1775687_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.9e-168
WP_000046901.1|1775670_1777002_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|1777123_1777597_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|1777773_1778898_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|1778897_1779845_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002056.1|1779888_1780287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1780283_1780703_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1780699_1781260_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1781260_1781506_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1781502_1783005_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1783013_1783379_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1783393_1783870_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|1783996_1786072_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|1786058_1787408_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|1787391_1788516_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1788505_1789120_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1789112_1789550_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1789549_1790632_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1790622_1791183_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1791182_1792094_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1792128_1792650_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1792729_1792933_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1793154_1793715_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1793814_1795854_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1796000_1796183_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1796218_1796464_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1796502_1796967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1797081_1797282_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1797235_1797973_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
>prophage 7
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	1950918	2020483	5523389	tail,integrase,capsid,transposase,head,holin,portal,protease	Escherichia_phage(27.27%)	77	1959406:1959421	1980772:1980787
WP_000156526.1|1950918_1952679_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1952864_1953317_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1953392_1954433_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1954789_1955299_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1955517_1956147_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1956109_1958272_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1958281_1958728_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1958850_1960905_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1959406:1959421	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1960936_1961395_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1961490_1962153_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1962325_1962739_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1962783_1963101_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1963158_1964349_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1964443_1964722_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1964718_1965048_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1965138_1965798_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1966205_1967225_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1967202_1967445_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1967512_1969984_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1970077_1970269_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1970265_1970454_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1971027_1971213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1971399_1971789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1971930_1972086_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1972363_1972651_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1972650_1972842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1972869_1973271_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1973379_1973652_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1973635_1974061_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1974267_1974723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484534.1|1974801_1975893_+	DNA-binding protein	NA	V5URT9	Shigella_phage	69.8	1.1e-132
WP_000788751.1|1975899_1976646_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1976667_1977438_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1977453_1977867_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1978218_1978992_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1979357_1979495_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813263.1|1979596_1979752_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1979919_1980198_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1980199_1981249_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1980772:1980787	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1981261_1981633_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1981622_1981994_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1982145_1982964_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1983584_1984298_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1985064_1986915_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1987090_1988303_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1988508_1988823_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1989350_1989536_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1989757_1989871_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1990091_1990625_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1990784_1991057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1991312_1991519_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1992269_1992545_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1992620_1993001_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1992997_1993345_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1993394_1994933_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1997109_1997316_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1997312_1998905_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1998894_2000400_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2000436_2000784_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2000841_2001108_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2001089_2001830_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2001843_2002275_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2002301_2002715_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2002695_2005275_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2005271_2005601_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2005600_2006299_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000194760.1|2006309_2007053_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|2006998_2007631_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|2007821_2008349_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|2008482_2011956_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|2012023_2012623_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|2012687_2014001_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2014002_2014272_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|2016264_2017383_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2017379_2019173_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2019191_2019899_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2019895_2020483_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	2271466	2392015	5523389	tail,integrase,lysis,capsid,transposase,head,holin,terminase,portal,tRNA,protease	Enterobacteria_phage(38.68%)	150	2337376:2337391	2365630:2365645
WP_000952736.1|2271466_2272288_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2272443_2273490_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2273486_2274281_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2274447_2275566_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2275534_2275804_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2275865_2276255_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2276387_2276903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2277017_2277170_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2277485_2277962_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2278086_2278410_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2278393_2278819_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2278887_2279925_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|2279836_2280379_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|2280412_2281129_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|2281161_2281443_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|2281439_2281742_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2281731_2282049_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2282002_2282320_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2282306_2282744_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2282745_2282937_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2282939_2283527_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2283642_2283747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2283935_2284148_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_128484528.1|2284315_2284594_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265159.1|2284595_2285645_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_128484529.1|2285657_2286032_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	6.0e-33
WP_000762929.1|2286028_2286850_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2287446_2287614_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2287928_2289866_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2290013_2290196_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2290233_2290503_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2290578_2290794_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2290798_2291143_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2291193_2291727_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2291997_2292567_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2292566_2292713_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2292940_2293147_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2293211_2293436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2293792_2293933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2294062_2294248_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2294289_2294655_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2294946_2295510_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2295506_2297168_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2297231_2299169_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2299213_2299435_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2299380_2301882_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2301961_2302288_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2302297_2302648_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_171877933.1|2302644_2303091_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
WP_000133388.1|2303087_2303432_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275499.1|2303490_2304207_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000710952.1|2304221_2304596_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2304691_2304901_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2304948_2308191_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2308183_2308525_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2308524_2309223_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2309239_2309494_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2309603_2309714_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2310016_2310895_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2310948_2311686_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2311631_2311868_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2311880_2311970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2311989_2314338_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001303921.1|2320637_2320913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2320973_2322335_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2322698_2323562_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2323545_2324682_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2324931_2326158_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2326206_2327328_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|2327689_2328903_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_032174463.1|2328901_2330119_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2330483_2330672_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_171878287.1|2331476_2331674_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2331666_2331879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2331868_2332333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2332325_2332559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2332564_2332864_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2332860_2334261_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2334461_2334713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2334709_2335120_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2335130_2335403_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2335529_2335754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2336005_2336212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2336211_2337267_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2337279_2337615_+|head	head decoration protein	head	NA	NA	NA	NA
2337376:2337391	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2337627_2338041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2338246_2338789_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2339044_2339326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2339926_2341387_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2341386_2342058_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2342226_2343597_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2343600_2344242_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2344277_2345384_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2345437_2345899_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2345908_2346562_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2346733_2347984_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2348097_2349240_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2349229_2349466_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2350390_2351092_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2351088_2351391_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2351458_2351791_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2351855_2351978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2352035_2353562_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2354063_2354519_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2354518_2354689_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2354681_2354972_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2354968_2355331_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2355327_2355468_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2355464_2356154_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2356475_2356781_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2356767_2357244_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2357460_2357643_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2357733_2358027_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_171878288.1|2358318_2358729_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	1.4e-70
WP_001031427.1|2359014_2359221_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2359385_2359580_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2359968_2360514_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2360488_2362414_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2362410_2362617_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2362613_2364215_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2364195_2365515_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2365524_2365857_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2365630:2365645	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2365911_2366937_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2366978_2367377_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2367388_2367742_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2367753_2368332_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2368328_2368724_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2368731_2369472_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2369487_2369910_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2369891_2370326_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2370318_2372868_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2372864_2373194_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2373193_2373892_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2373897_2374641_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2374577_2375210_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2375270_2378669_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2378735_2379335_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2379399_2382315_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2382314_2382896_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_171878289.1|2383015_2383906_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2383924_2384431_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2384467_2384968_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2385046_2385229_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2385726_2386395_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2386451_2386700_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2386775_2387156_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2387152_2387500_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2387549_2389088_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2389390_2390875_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2391061_2392015_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 9
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	2475543	2633535	5523389	tail,integrase,capsid,transposase,head,holin,terminase,portal	Stx2-converting_phage(29.81%)	191	2526792:2526851	2580907:2583348
WP_000113674.1|2475543_2476674_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2476651_2476900_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2476964_2479436_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2479528_2479720_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2479716_2479905_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2480302_2480470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2480463_2480697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2480674_2481082_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2481104_2481323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2481395_2481695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2481958_2482366_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2482442_2482670_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2482653_2483205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2483176_2484217_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2484128_2484671_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2484857_2485439_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2485435_2485600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2486298_2487057_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2487335_2487548_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2487768_2488026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2488095_2488374_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2488375_2489422_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2489434_2489794_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2489802_2490333_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2490574_2490772_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2490922_2491981_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2492777_2494631_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2494780_2494996_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2495000_2495345_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2495395_2495929_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2496199_2496769_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2496768_2496915_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2497142_2497328_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2497752_2497980_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2498021_2498387_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2498676_2499240_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2499236_2500898_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2500961_2502899_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2502943_2503165_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2503110_2505612_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2505691_2506018_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2506027_2506378_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_171877933.1|2506374_2506821_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
WP_000133388.1|2506817_2507162_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2507220_2507937_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2507942_2508317_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2508412_2508622_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2508674_2511917_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2511909_2512251_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2512250_2512949_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2512959_2513703_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2513648_2514281_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2514623_2515799_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_128484559.1|2515750_2516011_+	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	98.6	8.1e-37
WP_162829348.1|2516013_2517227_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_001228304.1|2519476_2520076_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2520227_2521541_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2521542_2521812_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2522838_2524164_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
2526792:2526851	attL	GTAAGCGTACAGCGAGGGCCGTATTGACGGGGATGTGTTATTCAGCTGGCAGTGCTATGC	NA	NA	NA	NA
WP_000998048.1|2526828_2528367_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2528416_2528764_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2528760_2529141_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2529480_2529759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2530186_2530333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2530469_2531117_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2531300_2531891_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2533397_2534048_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001500821.1|2535347_2536478_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2536455_2536704_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2536768_2539213_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2539305_2539494_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2539490_2539679_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2540166_2540319_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2540488_2540878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2540980_2541256_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2541239_2541665_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2541687_2542641_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2542647_2543388_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2543417_2544188_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2544203_2544599_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2544655_2545012_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2545060_2545273_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2545308_2545680_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2545676_2546039_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2546154_2546259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2546447_2546660_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000998188.1|2546956_2547124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2547189_2547468_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2548531_2548906_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2548902_2549724_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2549950_2550148_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2550298_2551357_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_171878292.1|2551848_2553699_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2554137_2554353_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2554352_2554850_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2555066_2555252_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2555779_2556094_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2556175_2556400_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2556441_2556807_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2557095_2557659_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2557655_2559317_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2559380_2561318_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2561362_2561584_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2561529_2564031_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2564110_2564437_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2564446_2564797_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2564793_2565240_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2565236_2565581_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2565639_2566356_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2566361_2566736_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2566831_2567041_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2567093_2570336_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2570328_2570670_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2570669_2571107_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_162829348.1|2571228_2572442_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_012779365.1|2572607_2575868_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2575870_2576086_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2576153_2576753_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2576817_2578041_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2578042_2578312_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2578425_2579001_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2579710_2580361_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2580943_2582482_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2582531_2582879_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2582875_2583256_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2584218_2584461_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
2580907:2583348	attR	GTAAGCGTACAGCGAGGGCCGTATTGACGGGGATGTGTTATTCAGCTGGCAGTGCTATGCGCCACGGAAGCAGTTCGCTGACCCGGTTGACCGGCCAGTCTGCTATGACGCCAAGCACATGGCGAAGGTAGCTTTCTGGATCCACGTCATTCAGTTTGCACGTCCCGATCAGGCTGTACAGTAGCGCTCCCCGCTCACCACCATGATCAGAGCCGAAGAACAGGAAGTTTTTACGACCCAGACTGACCGCCCGCAGGGCATTTTCAGCGATGTTGTTGTCGATTTCCACCCAGCCATCGTTCGCATAGTACGTCAGTGCCGGCCACTGGTTAAGTGCGTACGCGAACGCCTTCGCCAACTCTGAGTGTCGCGACAGGGTCTTCATCTTTTCACGCAACCAGCTTTCCAGGGATTTCAACAACGGTTTCGTTTTTCGCTGACGTTCAGCAAGCCGCTGCTCTGCCGGCATTCCCCTTATATCCGCCTCTATGGCGTACAACTGACCGATCTGCTCCAGGGCTTCTTCCGTCAGTGCTGACGGGATGCGGACGTGCACATCGTGGATCTTTCGGCGGGCATGAGCCCAGCAGGCAGCTTCCGTTATCCCACCATTGCGATACAGCTCGTTGAACCCGGCGTACGCATCCGCTTGCAGCACACCGCTGAAGCAGGCAAGATGAGTCTGCGGATGGATGCCTTTTCTGTCCGGGCTGTAAGCGAACCACACTGCAGGTGCCAACGCTGACCCTGCATTGCGGTCATCACGAACATACGCCCACAACCGCCCGGTCTTCGTCTTCTTATTACCCGGCAGCAGTACCTGGACCGGGGTATCATCGGCATGGAGTTTGCCGTCAGTCATGACATAGCCATGAAGCGCCTCTTCCAGCGGAGACAGCAGCCGGCAGCATGCATCCACCCAGCCCGACAGCAGTGAACGCCTCAGCTCCACACCTTGCCGGCCGTATATTTCTGACTGGCGATACAGCGGGGTGTGCTCTGCATACTTCGAGGTCAGCACGCGGGCCAGCAGCCCCGGTCCGGCGATACCCCGCTCGATGGGCCGCGAAGGTGCAGGTGCCTGCACGATGGCATCGCACTGAGTACAGGCATGTTTTTCCCGTACCGTCCGGATAACCCGGAAGGCGCTACGCATCAACTCCAGCTGTTCGGCGGTATCCTCGCCCAGATAGCTCAGTGAACCGCCGCAGTTCGGGCAGCACGGCGCCGCAGGCAACAGTCGCTTTTCGTCACGGGGTAGTGATTCAGGGAACGGCTTACGGGTGCGGGTCTGACGCAACGGACGCTGTACTGCCGGGTCATACACCCTACCAGTCAGCGTATCGCTCTCTTTCTGAAGCCGGTTCAGATCGGCTTCCATTTGTGCGATACGGCGGGAGACTTTTTCGGAACGACTGCCGAAGTTCATCCGGCGGAGTTTATCCAGCTGCGCCTGCAGATGGTCTATTTCGCGCTCCCGGTTGCTCAGCTTTTCCTGCAGGGCGTGGATCAGCGCTTCCTGTTCGGCCAGGCGCTGTTTCAGCAGGAAGATGTCGTCAGAAGAGATGTCGTTCATAAGCCCGTATTTTACCGGGCTTATTCTGTGACAACCAGGATAAAGAGATTTACAGCATGGTCAGGGAGGTCAGCAGCCGCTTAGGCTGTCGCCAGTCGATACCTTCCAGCAGCATCGCCAGCTGCGCCTGCGTAAGGAACACTTTGCCATCACGGGCTGACGGCCAGGCGAAGCGCCCACGCTCCAGCCGTTTGGTCAGGAGGCACAGTCCGTCACCGGTGGACCACAGCAGTTTAACCTGACTGCCGCTGCGGCCCCGGAAAATGAAAACATGGCCGGACATGGGATCGTCTTTCAGCGCCGTTTGTACTTTCGCAGCCAGGCCGTTGAAGCCATTTCTCATATCGGTGATACCGGCAACCAGCCAAATTTTGGTCCCGGAAGGTAACGGGATCATCGCTTCAGTTCCTGTATCAGCAGAGTCAGGAGCTTTTCGCTGACATTGCCATTGAAGCGGAGCGTCCCGTGCCGGAACGTTACCTCACAGCTGATACTGAGGGTTTCCGGGTCCTCTGCGAGCGATTCTGGCTGTTCGGCAGCTGCATCGAGAGTCACAGGAAGTAGCTGGGGGCTCTCTGAAGAAGGTAATAGCAGCTTTCCCTCGCGCCATTGTTGTCGCCATTTGAACAACAGATTGGCGTTAATGCCATTTTCAAGAGCAAGTTTTGAGATGGATATCCCGGGTTCACAGGAGGCAGCAACGAGCTGCTGTTTAAATTCGGGAGGATAATTAGGGCAGCCTTTTCGCCTGCCGGGAGTCACATTTTTCTGCATATCTGATACTTTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAGACGGTTCAGGCTGTACGCTTAC	NA	NA	NA	NA
WP_000102123.1|2585171_2586416_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2586508_2586697_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2586693_2586882_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2587446_2587656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2587656_2588295_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2588306_2588459_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2588751_2589090_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2589481_2589724_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2589707_2590133_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_128484576.1|2590201_2591245_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2591237_2591699_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2591732_2592449_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2592481_2592763_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2592759_2592987_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2592979_2593291_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2593418_2593637_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2593638_2594196_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2594429_2594642_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2594761_2595106_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2595227_2595500_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2595501_2596551_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2596563_2596869_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2596931_2597486_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2597710_2597908_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2598043_2598757_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2599207_2599639_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_128484575.1|2600116_2601967_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2602406_2602622_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2602626_2602971_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2603021_2603555_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2603825_2604395_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2604394_2604541_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2604763_2604949_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2605474_2605789_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2605870_2606095_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2606481_2607027_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2607001_2608927_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2608923_2609130_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2609126_2610728_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2610708_2612028_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2612037_2612370_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2612425_2613451_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2613492_2613891_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2613902_2614256_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2614270_2614804_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2614800_2615196_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2615203_2615956_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2615969_2616392_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2616418_2616832_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2616812_2619425_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2619421_2619751_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2619750_2620449_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2620459_2621203_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|2621148_2621778_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|2622018_2625498_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|2625565_2626165_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2626229_2627543_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2627544_2627814_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2627927_2628503_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2628575_2629205_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2629286_2629928_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2630089_2630332_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2630463_2631747_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2631835_2633296_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2633331_2633535_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	2903652	2961941	5523389	tail,capsid,head,holin,terminase,portal,protease	Stx2-converting_phage(42.22%)	59	NA	NA
WP_000422055.1|2903652_2904702_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2904921_2905680_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2905676_2906267_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2906306_2907179_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2907391_2908975_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2909002_2909623_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2909619_2910501_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2910638_2910683_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2910774_2912337_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2912336_2913932_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983855.1|2913932_2915294_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000209521.1|2915305_2916499_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2916498_2917305_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2917685_2917865_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2917950_2918451_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2918496_2919003_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001023426.1|2925085_2925355_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_024748463.1|2925356_2926670_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001230495.1|2926734_2927334_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748464.1|2927400_2930880_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_129137391.1|2931126_2931759_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2931704_2932448_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303038.1|2932458_2933157_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2933156_2933498_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2933490_2936733_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2936785_2936995_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2937090_2937465_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2937470_2938187_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2938245_2938590_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2938586_2939033_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2939029_2939380_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2939389_2939716_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2939795_2942297_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2942242_2942464_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2942508_2944446_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2944509_2946171_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2946167_2946731_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|2947020_2947386_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2947427_2947655_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2948079_2948265_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2948492_2948639_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2948638_2949208_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2949478_2950012_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2950062_2950407_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2950411_2950627_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_024748470.1|2951066_2952917_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2953395_2953824_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2954461_2955151_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2955147_2955507_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2955519_2956569_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2956570_2956849_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2957016_2957229_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2957417_2957522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2957637_2958222_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2958278_2958674_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2959484_2960225_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2960231_2961194_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2961216_2961642_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2961638_2961941_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 11
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	3275509	3326631	5523389	tRNA,transposase,tail,integrase	Enterobacteria_phage(60.0%)	59	3268733:3268748	3326710:3326725
3268733:3268748	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3275509_3277243_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3277419_3277908_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3278027_3278420_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_128484540.1|3278419_3280498_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3280490_3281639_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3281840_3282485_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3282495_3282885_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3282899_3283949_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3283951_3284812_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3284830_3286432_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3286477_3288139_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3288281_3288785_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3288805_3290770_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3290774_3291701_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3291697_3292585_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3292711_3293290_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3293292_3293643_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3294422_3294851_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3294857_3296282_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3296256_3297057_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3297223_3298210_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3298224_3299739_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_171878298.1|3299808_3300798_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3301594_3302098_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3302177_3302429_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3302543_3302630_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3302891_3303215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3303385_3303883_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3303919_3304159_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3304350_3305562_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3305623_3306289_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3306645_3307647_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3307652_3308000_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3308029_3308680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3308695_3309100_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3309189_3309327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3309398_3309602_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3309623_3309974_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3309984_3310263_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3310274_3310517_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3310513_3310627_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3310719_3311136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3311159_3311363_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3311359_3311626_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3311622_3311922_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|3311933_3312551_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|3312547_3312913_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3312919_3315742_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3315818_3316778_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3316782_3317097_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|3318188_3318719_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|3318762_3319335_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3319491_3319980_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|3322782_3322938_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|3322946_3323312_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3323366_3323879_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3323878_3325063_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3325220_3325544_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3325494_3326631_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3326710:3326725	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 12
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	3384215	3451289	5523389	tail,integrase,capsid,transposase,head,holin,terminase,portal	Enterobacteria_phage(31.82%)	67	3399868:3399883	3456948:3456963
WP_001023396.1|3384215_3384485_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3384486_3385656_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3385720_3386320_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878310.1|3386387_3388901_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_129137391.1|3390102_3390735_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|3390680_3391424_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_024748502.1|3391434_3392133_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000847298.1|3392132_3392462_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3392458_3395038_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3395018_3395432_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3395458_3395890_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3395903_3396644_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3396625_3396892_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3396949_3397297_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3397333_3398839_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3398828_3400421_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3399868:3399883	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3400417_3400624_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3402508_3403018_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3403412_3403637_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3403718_3404033_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3404559_3404745_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3404972_3405104_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3405116_3405299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3405454_3405988_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3406038_3406383_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|3406387_3406603_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|3406913_3408126_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|3408208_3410059_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3411598_3412288_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3412284_3412644_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3412656_3413706_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3413707_3413986_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3414153_3414366_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3414552_3414657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3414766_3415330_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3415456_3415768_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3415764_3415917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3415949_3416306_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3416302_3416527_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3416548_3417247_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|3417281_3417824_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|3417735_3418773_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3418841_3419267_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3419263_3419491_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3419588_3420233_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3420507_3420660_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3421140_3421329_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3421325_3421514_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3421609_3424081_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3424139_3424343_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3424342_3425365_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3425600_3426398_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3426887_3434870_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3435131_3436184_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3436497_3437814_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3437915_3439370_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3439712_3440429_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3441054_3442698_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3442815_3443766_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3443867_3444785_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3445241_3446177_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3446238_3447318_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3447329_3448073_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3448069_3448615_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3448976_3449357_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3449353_3449701_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3449750_3451289_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3456948:3456963	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 13
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	3455255	3526997	5523389	tail,integrase,lysis,capsid,transposase,head,holin,terminase,protease	Stx2-converting_phage(56.96%)	92	3471563:3471577	3534140:3534154
WP_162829204.1|3455255_3456468_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000638172.1|3456452_3457334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|3457330_3458236_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|3458232_3459303_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|3459438_3460122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|3460137_3460548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|3460768_3461590_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|3461671_3462151_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|3462165_3462642_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3462704_3462926_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|3462999_3463368_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|3463826_3464021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|3464033_3464147_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|3464635_3464818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|3464918_3465248_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|3465419_3466478_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|3466676_3467150_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|3467268_3468435_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|3469758_3470409_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|3470633_3471509_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
3471563:3471577	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|3471649_3471919_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|3471920_3473234_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001230314.1|3473298_3473898_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000515107.1|3473964_3477444_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_050546863.1|3477703_3478336_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|3478281_3479019_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|3479072_3479996_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3480066_3480240_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3480347_3480668_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179515.1|3480684_3481383_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|3481382_3481724_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|3481716_3484959_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|3485010_3485220_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3485315_3485690_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3485695_3486412_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3486470_3486815_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3486811_3487258_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3487254_3487605_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3487614_3487941_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|3490305_3490527_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_171878299.1|3490571_3492509_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_000958396.1|3494229_3494793_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|3495084_3495450_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|3495491_3495719_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|3496181_3496439_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|3496435_3496933_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|3497135_3497573_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3497569_3498067_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|3498066_3498282_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|3498358_3498631_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3498671_3498851_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_171878300.1|3498987_3500925_-	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	99.5	0.0e+00
WP_001303568.1|3501168_3501492_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|3501788_3502058_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|3502069_3503029_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|3503678_3504167_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|3504157_3504829_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|3504825_3505431_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|3505430_3506153_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208495.1|3506227_3506962_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	98.8	4.7e-122
WP_001254256.1|3507236_3507419_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3507415_3507943_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3507939_3508386_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3508342_3508579_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3508589_3508805_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_000344569.1|3508937_3509270_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_001220560.1|3509733_3510345_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001248388.1|3510423_3511800_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|3511796_3512618_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|3512604_3512766_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|3512798_3513095_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|3513236_3513452_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3513526_3514222_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3514723_3515245_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3515813_3515996_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3515973_3516246_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_162829202.1|3516463_3517676_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000065362.1|3518051_3518420_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3518492_3518657_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3518625_3518769_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3518843_3519140_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3519145_3519931_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|3519927_3520608_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|3520604_3520787_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|3520759_3520951_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|3520961_3521243_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3521341_3521563_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|3521559_3522507_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|3523373_3523724_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_162829202.1|3524188_3525402_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132739.1|3525646_3525838_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|3525818_3526997_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
3534140:3534154	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 14
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	3613014	3713981	5523389	portal,tail,holin,terminase,tRNA,protease	Enterobacteria_phage(50.68%)	110	NA	NA
WP_000476014.1|3613014_3614376_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3614705_3615023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3615428_3616328_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3616409_3617189_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3617288_3618329_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3618376_3619732_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3619735_3620020_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3620050_3620503_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3620512_3621775_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3621803_3622658_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3622956_3624009_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3624265_3625543_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3625539_3626544_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3626540_3627506_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3627479_3628226_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3628277_3629096_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3629160_3629961_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3629957_3630746_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3631079_3631319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3632369_3632717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3632726_3633041_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3633150_3633423_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|3633543_3634395_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3634612_3634951_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3635032_3636067_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3636077_3638558_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3638573_3639248_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3639335_3639878_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3640169_3640451_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3640712_3641822_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3641953_3643987_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|3650943_3654573_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3654634_3654952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3656192_3657281_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3657291_3658821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3658839_3659571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3659563_3660700_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3660696_3662700_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3662824_3663286_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3663327_3663798_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3663844_3664564_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3664560_3666246_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|3666760_3667009_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3667170_3667812_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3667893_3668310_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3668470_3668740_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3668741_3669911_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3669975_3670575_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878301.1|3670642_3674122_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_050546863.1|3674381_3675014_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_054191786.1|3674959_3675703_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_001151105.1|3675713_3676412_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3676411_3676741_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171878302.1|3676737_3679383_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|3679426_3679735_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3679761_3680184_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_024748478.1|3680197_3680950_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000682716.1|3680957_3681356_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3681368_3681992_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3681994_3682276_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3682268_3682595_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3682682_3684707_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|3684651_3686154_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3686153_3686366_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3686362_3688486_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_171878303.1|3688482_3688959_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	99.4	6.2e-83
WP_012816791.1|3689476_3689662_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3689889_3690036_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3690035_3690605_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3690875_3691409_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3691413_3691629_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3691706_3691952_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3691992_3692172_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|3692309_3694256_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|3695059_3695212_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3695460_3695895_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3695980_3696121_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3696117_3696480_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3696476_3696767_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3696759_3696930_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3696929_3697385_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3697381_3697483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3697573_3697855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3697898_3698096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3698323_3698608_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3698604_3699306_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000147884.1|3699302_3700322_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_001182876.1|3700318_3700858_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3701221_3701914_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3702020_3703628_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3704131_3704422_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3704497_3704794_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3704799_3705585_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3705581_3706259_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3706258_3706441_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3706413_3706605_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3706615_3706897_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3706995_3707217_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_171878304.1|3707213_3708161_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	99.7	8.9e-182
WP_001356547.1|3708162_3708339_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3708672_3709029_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3709025_3709388_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3709475_3709718_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3709721_3709856_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3709874_3710129_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3710162_3711449_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3711469_3712171_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|3712230_3712338_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3712318_3713050_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3713054_3713981_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	3958262	3963688	5523389	integrase	Enterobacteria_phage(50.0%)	6	3948713:3948729	3960677:3960693
3948713:3948729	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3958262_3959195_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3959506_3960664_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3960838_3961975_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3960677:3960693	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3961984_3962665_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3962651_3963119_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3963118_3963688_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 16
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	4184101	4270566	5523389	tail,transposase,head,plate,tRNA,protease	Shigella_phage(44.9%)	102	NA	NA
WP_001298403.1|4184101_4184638_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190651.1|4184662_4185298_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|4185506_4186355_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196285.1|4186410_4186671_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
WP_000128776.1|4186864_4186945_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986037.1|4187366_4187747_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001297412.1|4187746_4188478_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399404.1|4188489_4189218_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020744.1|4189229_4190135_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|4190131_4190812_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4191084_4192059_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4192074_4193874_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|4194071_4194551_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|4194547_4195504_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168451.1|4195503_4196142_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|4196174_4196750_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|4196746_4196902_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000077537.1|4198554_4199085_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|4199275_4199524_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|4199525_4201616_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|4201686_4202619_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|4202621_4202843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4202855_4203110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4203111_4203393_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4203389_4203662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|4203666_4203960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4203971_4204502_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|4204599_4205142_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|4205145_4205679_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|4205678_4206194_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|4206197_4206749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|4206745_4206931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|4206969_4207302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|4207294_4207492_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|4207481_4207778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|4207774_4208284_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|4208353_4208779_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4208850_4209351_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4209385_4209814_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4209797_4210016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|4210025_4210253_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4210233_4210542_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|4210538_4210829_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|4210831_4211413_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|4211412_4213077_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|4213076_4214666_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|4214649_4215975_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|4216093_4216567_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|4216743_4217868_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|4217867_4218815_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|4218858_4219227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4219223_4219643_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4219639_4220200_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4220200_4220446_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4220442_4221945_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4221953_4222319_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4222333_4222810_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|4222936_4225012_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|4224998_4226348_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|4226331_4227456_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4227445_4228060_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4228052_4228490_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4228489_4229572_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4229562_4230123_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|4230122_4231034_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|4231068_4231590_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4231669_4231873_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4232095_4232656_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4232755_4234795_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4234941_4235124_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|4235159_4235405_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4235443_4235908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|4236022_4236223_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|4236176_4236914_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001302911.1|4237506_4238244_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4238375_4239710_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|4239742_4240624_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189215.1|4240726_4241314_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4241369_4241753_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|4242057_4242747_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_061349967.1|4242794_4243832_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4244038_4244458_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4244526_4245225_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4245256_4247917_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4248030_4249386_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4249431_4249755_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4249751_4251050_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4256825_4259399_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4259528_4260260_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|4260256_4261237_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4261371_4262109_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4262379_4262721_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4262824_4262872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4262970_4264131_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4264173_4265295_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4265305_4266376_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4266585_4266951_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4267100_4267619_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|4267608_4268835_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4268850_4269333_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4269409_4269757_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4269798_4270566_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP038376	Escherichia coli O157:H7 strain F1273 chromosome, complete genome	5523389	4280011	4293448	5523389	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_000162574.1|4280011_4280494_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4281339_4281588_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4282089_4282680_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4282862_4283513_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4283591_4284650_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4284779_4285202_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4285362_4285632_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000612591.1|4286249_4286597_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4286593_4286974_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4287330_4287675_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4287679_4287895_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|4288044_4289898_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4290305_4290473_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4290558_4291302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4291554_4292178_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4292174_4292840_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4292836_4293448_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 1
NZ_CP038378	Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence	99810	0	99395	99810	tail,head,transposase,integrase	Escherichia_phage(70.1%)	103	1382:1398	49279:49295
WP_001187870.1|510_1311_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	2.1e-147
1382:1398	attL	AATTTATTAGAGCAAAT	NA	NA	NA	NA
WP_000743174.1|1475_2519_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.4	1.1e-172
WP_000245711.1|2515_2737_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	4.8e-38
WP_001448353.1|3137_3656_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	5.2e-19
WP_000780954.1|3744_4251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217773.1|4237_5422_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000188920.1|5576_6143_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_000523975.1|6153_6765_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	98.0	2.7e-107
WP_000926352.1|6779_7661_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	2.8e-174
WP_032271816.1|7742_11117_+	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	84.7	0.0e+00
WP_000002800.1|11116_11473_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_162829200.1|11997_13211_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001189831.1|14215_15052_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_001286326.1|15130_15565_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_044683623.1|15576_18426_+|tail	tail fiber protein	tail	Q71TP5	Escherichia_phage	91.9	0.0e+00
WP_024220676.1|18425_19004_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_122993347.1|19047_19620_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_077625665.1|20108_20606_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	63.1	1.4e-24
WP_001312286.1|20586_20703_+	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	8.0e-13
WP_000580776.1|20699_21143_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|21129_21732_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000434689.1|21733_23653_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_000175491.1|23649_24015_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_032326569.1|24027_27015_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
WP_032271837.1|27004_27325_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	92.5	3.5e-42
WP_032271836.1|27528_27816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432105.1|28062_28845_-	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_001376650.1|28851_29529_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000068865.1|29726_30215_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001345478.1|30384_30942_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_001038142.1|30934_31189_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	3.6e-37
WP_000786064.1|31233_32253_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.2	6.4e-178
WP_000774692.1|32245_33955_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_001369290.1|34030_34894_+	SAM-dependent DNA methyltransferase	NA	Q1MVN7	Enterobacteria_phage	99.3	8.7e-160
WP_044683683.1|35306_40799_+	helicase	NA	A0A077SK04	Escherichia_phage	98.6	0.0e+00
WP_024220496.1|40832_41273_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.3	8.5e-79
WP_000747846.1|41269_41518_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_001100381.1|41579_42530_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_072096992.1|42562_43315_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	92.0	6.5e-119
WP_024224078.1|43393_43954_-	Ref family protein	NA	Q71TG3	Escherichia_phage	98.4	7.7e-101
WP_001224246.1|44201_44513_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	100.0	1.6e-47
WP_044683333.1|44563_45595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	8.4e-194
WP_000874156.1|46419_46629_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_023441713.1|46739_47591_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000908421.1|48737_49214_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_000124159.1|49297_50782_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
49279:49295	attR	AATTTATTAGAGCAAAT	NA	NA	NA	NA
WP_023442315.1|50781_51975_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.5	1.4e-179
WP_001326849.1|52060_52513_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_023442316.1|52601_53645_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.8e-205
WP_024224144.1|53672_53852_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	2.3e-22
WP_001216044.1|53856_54237_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
WP_001190712.1|54236_54458_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_024224146.1|54530_54920_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	98.4	4.1e-69
WP_032353386.1|55094_55667_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	96.3	5.3e-105
WP_024224114.1|55673_55925_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	97.6	1.4e-38
WP_001408981.1|56239_56500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057453.1|56772_57423_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	94.5	2.1e-97
WP_024224113.1|57404_57779_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	7.0e-66
WP_000269004.1|57785_58079_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_000516537.1|58257_58491_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_024224112.1|58576_58837_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
WP_000935430.1|60366_60579_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000403776.1|60624_60984_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_001018057.1|61650_61941_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_032349173.1|61937_62639_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	53.9	4.1e-51
WP_000476202.1|62635_62875_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_000158003.1|62867_63071_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_024220560.1|64069_64576_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	4.1e-93
WP_032271979.1|64648_65911_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	1.7e-233
WP_000684846.1|66212_66914_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	5.4e-144
WP_094320255.1|66910_67588_-	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.1	1.4e-133
WP_000484116.1|67584_68211_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_012817939.1|68108_68771_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_001561105.1|68712_68868_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	98.0	2.0e-19
WP_024224109.1|68934_69513_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	92.2	9.8e-99
WP_000840930.1|69515_69761_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|69907_70285_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|70294_71512_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896808.1|71515_72244_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	99.6	1.2e-138
WP_032346379.1|72230_73016_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212023.1|73017_74034_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
WP_000535208.1|74026_74659_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_001260617.1|74729_75764_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	77.7	1.5e-145
WP_000245706.1|75760_75982_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_001198659.1|76361_77360_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.2	4.5e-192
WP_001276599.1|77359_78724_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000751806.1|79107_79935_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_000660980.1|81944_84986_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	87.2	0.0e+00
WP_128484549.1|84982_85888_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.0	1.0e-158
WP_001177859.1|85880_86165_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000890203.1|86627_87416_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_171878311.1|87792_88044_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	98.8	2.0e-40
WP_001281116.1|88055_88448_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000888906.1|88781_89666_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001285362.1|90936_92133_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038868.1|92149_93151_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_000067713.1|93376_95083_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085155.1|95143_96733_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000041774.1|96742_97558_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000035299.1|97593_98175_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000509943.1|98186_98696_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
WP_001313475.1|98812_98968_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001369095.1|99149_99395_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
