The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	357095	399003	5454413	terminase,integrase,holin,capsid,tail,tRNA,head,transposase	Stx2-converting_phage(36.84%)	42	358376:358391	403148:403163
WP_000956557.1|357095_357629_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|357825_357999_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|358046_358328_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358376:358391	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000917896.1|359077_359374_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000848748.1|359546_360221_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|360311_360512_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_162829202.1|360616_361829_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001339373.1|362431_362584_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_162829202.1|365230_366444_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024164617.1|366984_367200_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|367199_367697_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|367913_368099_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|368626_368941_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|369022_369247_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_000958387.1|369934_370498_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_126446204.1|370494_372156_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_126446139.1|372219_374157_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_069197361.1|374201_374423_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	94.5	2.7e-33
WP_000125988.1|376624_376951_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|376960_377311_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|377307_377754_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|377750_378095_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275479.1|378160_378877_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030063.1|378882_379257_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001475672.1|379612_382855_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_000807954.1|382847_383189_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072619016.1|383188_383887_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_113576411.1|383897_384641_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.7e-148
WP_126446220.1|384586_385219_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.4	1.2e-97
WP_171507011.1|385465_388861_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	83.2	0.0e+00
WP_001230466.1|388928_389528_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_126446216.1|389592_390906_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	8.8e-79
WP_054191722.1|390907_391177_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	1.2e-43
WP_001118000.1|391288_391861_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_113580212.1|391933_392563_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|392644_393286_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|393446_393695_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|393756_394854_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|394942_395980_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|396113_396356_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|396521_397505_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|397587_399003_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
403148:403163	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	1033571	1150956	5454413	plate,transposase,holin,integrase	Enterobacteria_phage(20.0%)	98	1082008:1082067	1086427:1087736
WP_000246440.1|1033571_1034903_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1034905_1035430_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1035426_1036707_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000393844.1|1037777_1039628_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000056995.1|1040050_1041526_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000037399.1|1041822_1042323_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142960.1|1043019_1043538_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103342.1|1043747_1045889_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_000509112.1|1045964_1050197_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_001358771.1|1050316_1051054_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339420.1|1051235_1052744_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_001475373.1|1052812_1053334_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|1054079_1055216_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|1055218_1056979_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|1057180_1057444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1057358_1057544_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|1057624_1058797_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1058914_1059685_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1059838_1060312_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973088.1|1060354_1062799_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|1063038_1063617_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1063721_1064489_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1064459_1065200_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615979.1|1065355_1065634_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1065636_1065897_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1066082_1066856_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001358779.1|1067673_1069413_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|1069357_1070143_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1070213_1071269_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1071320_1071614_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1071616_1072015_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|1072024_1072477_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1072783_1073050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023438539.1|1072961_1073519_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1073575_1075033_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1075293_1075752_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1075843_1077088_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174702.1|1077145_1077547_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1077585_1078641_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1078928_1080032_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1080043_1081297_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
1082008:1082067	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|1082061_1083274_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001130487.1|1083358_1084540_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_162829202.1|1085218_1086432_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001185340.1|1087204_1087477_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|1087482_1088034_-	Polarity suppression protein	NA	NA	NA	NA	NA
1086427:1087736	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGTAATGCATGCTATATTTACCATTTGCTTTGCGGAATTTTTATCAAGAAAAGGGAATCCATTCATTGGATTTGTTGTGCTTGATAGTCCATTAGTGACGCACTTTGATAAAGATAGAGGGGGTTCTCTATCGGATGTTAATAGCGTCAGTCTCAGTGATTCATTTTATCACGCATTAATCAAAAGGGACTATAATTTCCAGATTGTAATTCTTGAGAATAAAGGTCCGACGTTCCAAATAAAAATTAATGATGCAAATAAAATCCATAACTTAAATAAGAATGGAAGCTCTGGTTTTTATCCTGTTTAATACATTAAAAATATAACTGCTAATTGGGGTGCTCGAAATTATATTTCGTTTCGAGCGCTCAGTTCATTTCTAAATAATTTGCAAAATTATTTTGGGTACTTTCGCCTCTACACTTCCTTCGGGTGGTTCCACAATAATGGATCTCACCGGCGTTTGATATTTTATAATCTAACCCCTTAGCGCGCGCAGCCCCCCACGCCTGCTCGCTTCGCTTAACAGACTGGTTTTCATGCATTCCGCAAATCGTCTCAGAAGCCACCACACAAGGGCTTTCGCGTCAAAAATGGTGCATGAGAATCATGCGTTTTCATGCGCTATAGACATGCACTCATGCGCTCTCAGGCCAGCCAGGGAAAAGGCGTAAAAAATCCCAGTACTGGACCGGGATTACGTGGGCTTTTTTTGCTAATCAGACAGGAATTTGCTGACGGCTTGACAGCTTTGACGCGGAGCCATAGCGATTGAGAGTTTGCTGTTGTTTTTCCGGCATTTGTGCTTTCTCTGATTCCTGTTCATTGCGCCGGGGCTTCATGATTATCGTATCCACACTTTCCAGTGCGGTAAATGTGTAGGAACATTCAAGATTCTGGCACTGATACCATGAGCGTTTAACCGATGGTGCTTCATAGGCGGAGGTTCTGGCGTGTGCCGTCGTACCGCATTCGGGACATTTAAGTGCCATTAATATTACTCCTGCATGCCGTTAATGTAATCCAGACGTTGCTGAAAGCGCAGTTGTTGTGCAGGGGTGTAAGAGCTCTGGCAATCACGAACCATCATGGGGTCAGGCATCACACCGGATTCATCCAGAATCATACGATAATCCCCGGCAATTTCAGGCGGTGTTATTGCCAGCTGGCGAACCAGAGCATTGCGTAATATACGGGACGCAACGTCAACCCCTCCGCGCCCCTTCAGGAACGGAGCCAGTGCAGATGTCA	NA	NA	NA	NA
WP_000154958.1|1088030_1088783_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|1089701_1089962_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973390.1|1089958_1090516_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
WP_001071227.1|1090512_1090734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|1090733_1091057_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016225.1|1091070_1093404_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|1093536_1094493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|1095168_1096068_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|1096166_1096889_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|1097054_1097333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013009125.1|1098035_1098938_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|1099183_1100242_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171067.1|1100383_1101511_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121345.1|1101689_1102646_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667045.1|1102655_1104854_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.1e-38
WP_000070685.1|1105789_1106479_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1106896_1107511_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1107758_1108088_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|1108400_1109111_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265657.1|1109079_1110723_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131065.1|1110712_1113238_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716386.1|1113263_1113932_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1113989_1114577_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|1114651_1115194_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|1116017_1116209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1116278_1116419_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1116418_1116682_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|1117045_1117147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182335.1|1117620_1118763_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860023.1|1118997_1119918_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001475396.1|1120074_1120986_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000998048.1|1121019_1122558_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1122607_1122955_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1122951_1123332_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001038968.1|1123738_1124095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1124327_1125540_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000621002.1|1131115_1131973_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001301722.1|1132221_1133091_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
WP_000417405.1|1133250_1133844_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|1133855_1134092_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046339.1|1134200_1135526_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000339591.1|1135751_1136606_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102115.1|1137132_1137852_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023931.1|1137862_1139290_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001301982.1|1139282_1139978_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000238414.1|1141070_1141499_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1141588_1142801_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001356433.1|1144203_1144338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159114.1|1145018_1146707_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
WP_000089099.1|1146720_1148193_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|1148206_1148794_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1148922_1150956_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	1664219	1686110	5454413	integrase,holin,protease,tail,lysis	Enterobacteria_phage(31.03%)	36	1654749:1654763	1669181:1669195
1654749:1654763	attL	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000533681.1|1664219_1665290_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.5e-201
WP_001303849.1|1665267_1665486_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1665525_1665693_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_114042585.1|1666146_1666533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1666743_1666965_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1667063_1667345_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1667355_1667547_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682302.1|1667519_1667702_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	95.0	5.3e-27
WP_000186844.1|1667698_1668379_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000100847.1|1668375_1669161_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995449.1|1669166_1669463_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
1669181:1669195	attR	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000372937.1|1669536_1669680_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000065351.1|1669884_1670253_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000788871.1|1671193_1671895_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000145931.1|1671891_1672182_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1672255_1672696_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|1672692_1672875_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1672871_1673042_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108058.1|1673034_1673655_+	recombination protein NinG	NA	Q716C3	Shigella_phage	97.6	4.9e-96
WP_001028854.1|1673651_1674317_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|1674528_1675488_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1675826_1675949_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1675963_1676653_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1676837_1677581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1677666_1677825_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1677905_1678304_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1678446_1678662_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1678661_1679159_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1679155_1679623_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1679610_1679763_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349511.1|1680437_1680803_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	81.4	1.1e-44
WP_000950813.1|1681439_1682420_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1682453_1683473_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1683969_1684131_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1684299_1685181_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247929.1|1685411_1686110_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	1904137	1968351	5454413	terminase,portal,holin,protease,capsid,tail,head,transposase	Enterobacteria_phage(31.58%)	71	NA	NA
WP_000156439.1|1904137_1905898_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1906083_1906536_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1906611_1907652_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1908008_1908518_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1908736_1909366_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1909328_1911491_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1911500_1911947_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1912069_1914124_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1914155_1914614_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1914709_1915372_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1915544_1915958_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1916002_1916320_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1916377_1917568_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1917662_1917941_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1917937_1918267_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1918357_1919017_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1920420_1920663_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1920730_1923202_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1923295_1923487_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413706.1|1923483_1923672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1924245_1924431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1924617_1925007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1925148_1925304_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1925580_1925868_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1925867_1926059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1926086_1926488_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1926596_1926869_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1926852_1927278_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1927484_1927940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1928018_1929110_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1929116_1929863_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1929884_1930655_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1930670_1931084_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1931435_1932209_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1932574_1932712_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813263.1|1932813_1932969_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1933136_1933415_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1933416_1934466_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1934478_1934850_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1934839_1935211_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1935362_1936181_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1936801_1937515_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113588264.1|1938282_1940133_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_024182511.1|1940571_1940787_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000138558.1|1941042_1941315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1941474_1942008_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_162829202.1|1942323_1943537_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001450892.1|1943618_1945466_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.1	1.8e-255
WP_000259002.1|1945449_1945656_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1945652_1947245_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1947234_1948740_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1948776_1949124_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1949181_1949448_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1949429_1950170_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1950183_1950615_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1950641_1951055_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_113556599.1|1951035_1953615_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
WP_000847302.1|1953611_1953941_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
WP_025380484.1|1953940_1954639_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.8e-132
WP_000194802.1|1954649_1955393_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_063075060.1|1955338_1955968_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_171880464.1|1956208_1959466_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.7	0.0e+00
WP_001304111.1|1959468_1959684_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230444.1|1959750_1960350_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_126446216.1|1960414_1961728_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	8.8e-79
WP_001023352.1|1961729_1961999_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_107686092.1|1962123_1963017_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001301613.1|1964132_1965251_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1965247_1967041_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1967059_1967767_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1967763_1968351_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	2060784	2115697	5454413	protease,transposase,integrase	Escherichia_phage(25.0%)	47	2054954:2054969	2074252:2074267
2054954:2054969	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|2060784_2061987_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282214.1|2062173_2063991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|2065101_2065398_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|2065624_2065822_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|2066040_2067474_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|2071552_2072765_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|2075068_2075416_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
2074252:2074267	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_001171554.1|2075412_2075793_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001304211.1|2076348_2076639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|2077324_2077684_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591995.1|2077776_2079396_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|2079620_2079896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886249.1|2080276_2081056_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|2081065_2081368_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|2081376_2081697_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|2081689_2083393_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|2083402_2083867_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|2083867_2084542_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|2084553_2085171_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|2086382_2086646_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|2086947_2087088_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397130.1|2087958_2088630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126446107.1|2089649_2089904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|2090967_2091393_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|2091389_2091740_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_001475613.1|2091770_2093384_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.2e-165
WP_000957249.1|2094287_2094668_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|2094654_2094984_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|2095244_2095712_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|2095729_2096938_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|2096948_2097905_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|2097904_2098984_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|2098985_2099759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|2099751_2100894_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_171880466.1|2100903_2101962_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254140.1|2102284_2102866_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|2102865_2104023_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|2104045_2104501_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2104523_2105564_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2105612_2106191_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|2106259_2106835_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001358663.1|2106943_2108140_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001053349.1|2108707_2109094_+	TerD family protein	NA	NA	NA	NA	NA
WP_001223350.1|2109607_2111698_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|2113150_2113369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|2114002_2114338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2114483_2115697_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	2226829	2311295	5454413	terminase,integrase,holin,protease,capsid,transposase,tail,tRNA,head,lysis,portal	Enterobacteria_phage(38.6%)	86	2229113:2229127	2274471:2274485
WP_000074985.1|2226829_2227948_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2227916_2228186_-	excisionase	NA	NA	NA	NA	NA
2229113:2229127	attL	TTCTGGCTCGTTTTG	NA	NA	NA	NA
WP_113560831.1|2229590_2230691_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	93.4	2.3e-189
WP_001230444.1|2230757_2231357_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_171507008.1|2231421_2232735_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	1.9e-81
WP_001023356.1|2232736_2233006_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|2233112_2233202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2233221_2235570_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001303921.1|2241869_2242145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2242205_2243567_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2243930_2244794_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2244777_2245914_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2246163_2247390_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2247438_2248560_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_001475683.1|2248808_2250038_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.1e-131
WP_000953272.1|2250402_2250591_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001475684.1|2250648_2251806_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_024166339.1|2251798_2252119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024166340.1|2252125_2252425_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001475689.1|2252421_2254239_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	7.5e-129
WP_001475690.1|2254526_2254772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024166341.1|2254768_2255179_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024166342.1|2255189_2255462_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475693.1|2255587_2255812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001475695.1|2256108_2257266_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001475696.1|2257321_2257879_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_001475697.1|2257880_2259092_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	2.5e-189
WP_016241300.1|2259088_2259427_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_000134111.1|2259423_2259720_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145908.1|2259719_2260160_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_024166058.1|2260143_2260326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2260448_2260805_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_024166343.1|2260788_2262450_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	3.4e-277
WP_001475705.1|2262463_2262745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157949236.1|2263025_2263184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2263527_2264988_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2264987_2265659_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423713.1|2265827_2267198_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
WP_001301618.1|2267201_2267843_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2267878_2268985_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2269038_2269500_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2269509_2270163_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2270334_2271585_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741343.1|2271698_2272841_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2272830_2273067_-	excisionase	NA	NA	NA	NA	NA
WP_032301315.1|2273334_2273433_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	82.8	1.0e-05
WP_001097228.1|2273429_2274119_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2274440_2274746_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
2274471:2274485	attR	TTCTGGCTCGTTTTG	NA	NA	NA	NA
WP_001180487.1|2274732_2275209_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_001228695.1|2275425_2275608_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738495.1|2275698_2275992_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2276283_2276694_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2276979_2277186_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2277350_2277545_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2277933_2278479_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_113588165.1|2278453_2280379_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198153.1|2280375_2280582_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2280578_2282180_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2282160_2283480_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2283489_2283822_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2283877_2284903_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_171880467.1|2284944_2285343_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	97.7	1.3e-62
WP_000752995.1|2285354_2285708_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2285719_2286298_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2286294_2286690_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2286697_2287438_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2287453_2287876_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2287857_2288292_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840324.1|2288284_2290834_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|2290830_2291160_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2291159_2291858_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2291863_2292607_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2292543_2293176_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_113556567.1|2293236_2296635_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_001230336.1|2296701_2297301_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000885630.1|2300280_2300862_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2300981_2301872_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2301890_2302397_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2302433_2302934_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2303012_2303195_-	general stress protein	NA	NA	NA	NA	NA
WP_162829202.1|2304032_2305245_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001171554.1|2305521_2305902_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2305898_2306246_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2306295_2307834_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2308670_2310155_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2310341_2311295_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	2509918	2594379	5454413	terminase,portal,integrase,holin,protease,tail,tRNA,transposase	Escherichia_phage(41.27%)	90	2532877:2532902	2592446:2592471
WP_162829202.1|2509918_2511131_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000800183.1|2511518_2512157_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001302107.1|2513110_2514031_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000817685.1|2514168_2515068_+	DNA-binding transcriptional regulator PgrR	NA	NA	NA	NA	NA
WP_000683035.1|2515403_2517017_+	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000559900.1|2517067_2518099_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000605090.1|2518342_2518600_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2518649_2519600_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2519751_2520504_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945010.1|2520698_2521214_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
WP_000062967.1|2521224_2522751_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156433.1|2522787_2524233_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|2524232_2525543_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|2525718_2526627_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|2526956_2527520_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_001475860.1|2527540_2528773_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|2529027_2530011_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123710.1|2530488_2531862_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	4.3e-52
WP_001157382.1|2531990_2532926_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2532877:2532902	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_001358842.1|2532977_2534213_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_000079604.1|2534214_2534430_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2534529_2534718_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000166318.1|2534961_2535771_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
WP_162829202.1|2536706_2537920_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001358843.1|2539850_2540126_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.2e-44
WP_000258918.1|2540200_2540377_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	70.7	6.3e-17
WP_000560228.1|2540370_2540592_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000935601.1|2540638_2541487_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.8	1.7e-54
WP_001169149.1|2541915_2542068_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|2542448_2542913_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|2543017_2543293_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|2543276_2543699_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_162829202.1|2544198_2545412_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000788990.1|2545888_2546635_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_171507006.1|2546656_2547427_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	3.7e-85
WP_001141093.1|2547442_2547835_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_000206794.1|2547891_2548476_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2548591_2548696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024166322.1|2548884_2549106_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	58.9	9.1e-13
WP_000132062.1|2549225_2550095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615960.1|2550339_2550732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687438.1|2550925_2551099_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.4e-16
WP_000940306.1|2551158_2551758_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
WP_000228035.1|2551757_2552048_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	7.4e-47
WP_001475548.1|2552044_2552599_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	4.8e-71
WP_171507004.1|2554140_2556087_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.7	0.0e+00
WP_000143458.1|2556222_2556402_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290233.1|2556442_2556688_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|2556764_2556980_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_171507005.1|2556984_2557518_+	glycoside hydrolase family protein	NA	A0A1I9LJR4	Stx_converting_phage	98.9	6.7e-102
WP_171507003.1|2557784_2558354_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.0e-104
WP_000539792.1|2558353_2558500_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2558727_2558913_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373410.1|2559389_2559866_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077621.1|2559862_2560870_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|2561031_2562270_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|2562262_2562487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|2562546_2563128_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|2563108_2563828_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|2563820_2564045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|2564037_2564631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|2564827_2565070_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|2565066_2566881_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|2567168_2567414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|2567410_2567833_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860403.1|2568490_2570380_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|2570637_2570919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102415.1|2572411_2572624_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|2572623_2574126_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|2574070_2576095_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2576182_2576509_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2576501_2576783_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2576785_2577409_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2577421_2577820_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2577827_2578580_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2578593_2579016_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2579042_2579351_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_171507001.1|2579394_2582040_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|2582036_2582366_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001473433.1|2582365_2583064_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_000194802.1|2583074_2583818_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_063075060.1|2583763_2584393_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_171880469.1|2584633_2588110_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_001475600.1|2588178_2588802_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.5e-68
WP_171880470.1|2588866_2590180_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023406.1|2590181_2590451_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_122988840.1|2590561_2590639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2590853_2591867_+	peptidase M85	NA	NA	NA	NA	NA
WP_001295593.1|2592670_2593105_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
2592446:2592471	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_000837955.1|2593245_2594379_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	2775560	2936203	5454413	terminase,portal,integrase,holin,protease,capsid,tail,head,transposase	Enterobacteria_phage(29.37%)	189	2782792:2782851	2914289:2915598
WP_000214712.1|2775560_2775764_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2775799_2777260_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2777348_2778632_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2778763_2779006_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000343700.1|2779055_2780264_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001121225.1|2780413_2781064_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2781774_2782350_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2782463_2782733_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
2782792:2782851	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|2782845_2784058_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171880472.1|2784098_2785265_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.7e-54
WP_171506997.1|2785255_2785360_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	93.3	2.4e-08
WP_113556620.1|2785424_2786024_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	1.8e-100
WP_000573391.1|2787161_2787608_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2787604_2787955_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2787964_2788291_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_113556565.1|2790493_2790715_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	3.0e-32
WP_113560761.1|2790759_2792685_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	96.7	0.0e+00
WP_171506996.1|2792748_2794410_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.2	0.0e+00
WP_000958372.1|2794406_2794970_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000279786.1|2795259_2795625_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|2795666_2795852_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|2795981_2796122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2796478_2796703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2796767_2796974_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2797201_2797348_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2797347_2797917_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2798187_2798721_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|2798771_2799116_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2799120_2799336_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001289717.1|2799411_2799681_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|2799718_2799901_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000143000.1|2800048_2801986_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	77.1	1.3e-293
WP_000935548.1|2802782_2803841_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2803990_2804188_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2804429_2804960_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2804968_2805328_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_024183341.1|2805340_2806387_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2806388_2806667_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2806736_2806994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2807214_2807427_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2807705_2808464_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2809162_2809327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2809323_2809905_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2810091_2810634_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000705621.1|2811556_2812108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2812091_2812319_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2812395_2812803_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2813067_2813367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2813439_2813658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2813680_2814088_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2814065_2814299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2814292_2814460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2814857_2815046_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2815042_2815234_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2815326_2817798_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2817862_2818111_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2818088_2819219_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_001345079.1|2820530_2821181_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2822687_2823278_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2823461_2824109_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2824245_2824392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2824819_2825098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2825437_2825818_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2825814_2826162_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2826211_2827750_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2828715_2829285_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2829350_2830262_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2830368_2830491_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2832086_2833412_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2834438_2834708_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_113556641.1|2834709_2836023_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	4.6e-80
WP_001228290.1|2836174_2836774_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_126446136.1|2836841_2840315_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_126446220.1|2840561_2841194_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.4	1.2e-97
WP_113576411.1|2841139_2841883_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.7e-148
WP_072619016.1|2841893_2842592_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2842591_2842933_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001475672.1|2842925_2846168_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001030063.1|2846523_2846898_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|2846903_2847620_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133388.1|2847685_2848030_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2848026_2848473_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2848469_2848820_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2848829_2849156_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_069197361.1|2851357_2851579_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	94.5	2.7e-33
WP_126446139.1|2851623_2853561_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001457603.1|2853624_2855286_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|2855282_2855846_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2856136_2856502_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2856543_2856771_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2857195_2857381_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2857608_2857755_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2857754_2858324_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_032343426.1|2858594_2859128_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	7.4e-101
WP_000731241.1|2859178_2859523_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2859527_2859743_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_001410869.1|2860182_2860719_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.9	3.4e-98
WP_001059381.1|2863195_2863885_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217457.1|2863881_2864241_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001265161.1|2864253_2865303_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2865304_2865583_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2865750_2865963_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2866151_2866256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2866371_2866956_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2867012_2867408_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000450876.1|2867423_2868194_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.7	2.0e-83
WP_000788938.1|2868219_2868960_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2868966_2869929_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2869951_2870377_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2870373_2870676_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169686.1|2870773_2871145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2871165_2871357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2871358_2871637_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001240334.1|2871989_2872289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171904.1|2872361_2872580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2872583_2872748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2873148_2873337_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2873333_2873525_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171880473.1|2873617_2876089_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	4.2e-58
WP_000005552.1|2876161_2876413_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001120551.1|2877903_2878146_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2878307_2878949_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2879030_2879660_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2879732_2880308_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2880421_2880691_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_113556585.1|2880961_2881561_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_171880474.1|2881628_2885105_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.1	0.0e+00
WP_063075060.1|2885345_2885975_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_000194802.1|2885920_2886664_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_171880475.1|2886674_2887373_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.8	4.0e-131
WP_000847298.1|2887372_2887702_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_113556568.1|2887698_2890311_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2890291_2890705_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2890731_2891154_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2891167_2891920_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2891927_2892323_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2892319_2892853_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2892867_2893221_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_001475715.1|2893232_2893631_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	97.7	2.3e-62
WP_000063265.1|2893672_2894698_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2894753_2895086_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2895095_2896415_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_126446145.1|2896395_2897985_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.9	1.2e-303
WP_000198153.1|2897981_2898188_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2898184_2900110_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2900084_2900630_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2901016_2901241_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2901322_2901637_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2902162_2902348_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2902570_2902717_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2902716_2903286_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2903556_2904090_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|2904140_2904485_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2904489_2904705_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_171880476.1|2907480_2907918_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	95.9	3.1e-65
WP_000301797.1|2908368_2909082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2909217_2909415_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2909639_2910194_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|2910202_2910562_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2910574_2911624_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2911625_2911898_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2912019_2912364_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2912483_2912696_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2912929_2913487_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2913488_2913707_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289672.1|2913834_2914146_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	3.9e-54
WP_050554342.1|2914138_2914354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2914342_2915555_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072095801.1|2916150_2916261_-	transporter	NA	NA	NA	NA	NA
2914289:2915598	attR	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAGCGGGCGATTCGTATGGTTCTGGAAAGTCAGGATGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGTGGGCTCACCAGCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCACGACGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_000836042.1|2916318_2917338_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001358608.1|2917349_2918564_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_001358609.1|2918769_2919096_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2919230_2919572_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2919606_2920167_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2920169_2920880_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2920987_2921293_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041701.1|2921491_2923918_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	8.0e-211
WP_001414236.1|2923978_2926402_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000213028.1|2926412_2927030_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526515.1|2927031_2927886_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2927928_2928543_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071525082.1|2928700_2929993_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|2929945_2930641_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225255.1|2930765_2931986_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|2932120_2933014_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091829.1|2933120_2934374_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743952.1|2934770_2935106_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2935198_2935282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|2935381_2936203_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	3225561	3288965	5454413	terminase,integrase,plate,capsid,transposase,tail,tRNA,head,portal	Enterobacteria_phage(69.05%)	73	3230708:3230723	3258485:3258500
WP_001025318.1|3225561_3227295_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001358627.1|3227471_3227960_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3228079_3228472_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3228471_3230550_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278931.1|3230542_3231691_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
3230708:3230723	attL	ACCAATCTCCGCATGT	NA	NA	NA	NA
WP_000983602.1|3231892_3232537_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3232547_3232937_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3232951_3234001_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3234003_3234864_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3234882_3236484_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3236529_3238191_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3238333_3238837_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3238857_3240822_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3240826_3241753_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3241749_3242637_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3242763_3243342_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3243344_3243695_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3244474_3244903_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089028.1|3244963_3246334_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3246308_3247109_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3247275_3248262_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3248276_3249791_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3249860_3250850_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3251646_3252150_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3252229_3252481_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3252595_3252682_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3252944_3253268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3253438_3253936_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3253972_3254212_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3254403_3255615_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3255676_3256342_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3256698_3257700_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3257705_3258053_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3258082_3258733_-	hypothetical protein	NA	NA	NA	NA	NA
3258485:3258500	attR	ACCAATCTCCGCATGT	NA	NA	NA	NA
WP_000786773.1|3258748_3259153_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3259242_3259380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3259451_3259655_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3259676_3260027_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3260037_3260316_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3260327_3260570_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3260566_3260680_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3260772_3261189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3261212_3261416_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3261412_3261679_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3261675_3261975_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|3261986_3262604_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|3262600_3262966_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123459.1|3262972_3265795_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
WP_000686547.1|3265871_3266831_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|3266835_3267150_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000193206.1|3267232_3268075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068331.1|3268071_3268611_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087821.1|3269259_3270306_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_000613756.1|3270305_3272057_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262671.1|3272211_3273048_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	6.0e-150
WP_001055110.1|3273071_3274124_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.0e-194
WP_000632345.1|3274169_3274970_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063103.1|3275071_3275566_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|3275565_3275766_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000072328.1|3276088_3276481_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000780536.1|3276477_3276885_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
WP_000920594.1|3277022_3277490_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356352.1|3277482_3278118_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_001476003.1|3278129_3278696_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_001067548.1|3278713_3279043_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111937.1|3279046_3279943_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	1.6e-153
WP_000071706.1|3279935_3280466_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
WP_000108494.1|3280468_3282628_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	6.0e-109
WP_000631344.1|3282624_3283527_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_001414827.1|3283535_3284114_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
WP_000954203.1|3284157_3284730_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3284886_3285375_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_162829202.1|3287752_3288965_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 10
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	3330698	3391119	5454413	terminase,portal,holin,capsid,tail,head,transposase	Escherichia_phage(30.0%)	68	NA	NA
WP_001302088.1|3330698_3332393_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|3332563_3332746_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922685.1|3332824_3333742_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|3333914_3334835_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786001.1|3334823_3335294_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	9.9e-33
WP_001157255.1|3335274_3336693_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000365585.1|3336759_3337455_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001358628.1|3338424_3339075_+	porin	NA	Q1MVN1	Enterobacteria_phage	64.6	9.4e-58
WP_001476010.1|3339035_3339437_+	porin	NA	Q1MVN1	Enterobacteria_phage	58.4	2.5e-24
WP_162829202.1|3339439_3340653_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000218228.1|3341521_3342373_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826732.1|3342480_3343839_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
WP_001339045.1|3343838_3344510_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|3344642_3345056_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740078.1|3345163_3346168_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240083.1|3346168_3346804_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007753.1|3347060_3347711_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|3348053_3348584_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_010917831.1|3350699_3351713_+	Tir-cytoskeleton coupling protein TccP	NA	NA	NA	NA	NA
WP_001023385.1|3351837_3352107_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	100.0	4.4e-46
WP_113560698.1|3352108_3353422_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	100.0	3.2e-81
WP_001230412.1|3353486_3354086_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_126446178.1|3354152_3357626_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	100.0	0.0e+00
WP_000649829.1|3357759_3358287_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_171507024.1|3358477_3359110_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	3.0e-109
WP_000194802.1|3359055_3359799_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001365123.1|3359809_3360508_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847302.1|3360507_3360837_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
WP_113556599.1|3360833_3363413_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
WP_000533402.1|3363393_3363807_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3363833_3364265_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3364278_3365019_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3365000_3365267_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3365324_3365672_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3365708_3367214_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3367203_3368796_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3368792_3368999_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3370883_3371393_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3371757_3371982_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3372063_3372378_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3372904_3373090_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3373317_3373449_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3373461_3373644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3373799_3374333_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731192.1|3374383_3374728_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_024165672.1|3374732_3374948_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000023255.1|3375240_3377091_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001692436.1|3378630_3379320_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	50.7	1.5e-58
WP_000904141.1|3379316_3379676_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3379688_3380738_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3380739_3381018_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3381185_3381398_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3381584_3381689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3381798_3382362_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3382488_3382800_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3382796_3382949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3382981_3383338_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3383334_3383559_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3383580_3384279_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|3384313_3384856_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_137049448.1|3384767_3385811_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	82.8	7.7e-86
WP_000693816.1|3385879_3386305_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3386301_3386529_-	cell division protein	NA	NA	NA	NA	NA
WP_000444615.1|3386626_3387271_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3387545_3387698_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3388178_3388367_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3388363_3388552_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3388647_3391119_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
>prophage 11
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	3531257	3645202	5454413	terminase,holin,capsid,tail,tRNA,head,lysis,transposase	Stx2-converting_phage(72.0%)	109	NA	NA
WP_000476014.1|3531257_3532619_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3532948_3533266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3533671_3534571_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3534652_3535432_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3535531_3536572_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|3536619_3537975_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823278.1|3537978_3538263_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3538293_3538746_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3538755_3540018_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3540046_3540901_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3541199_3542252_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859145.1|3542508_3543786_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3543782_3544787_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3544783_3545749_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3545722_3546469_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001358655.1|3546520_3547339_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.1	5.5e-23
WP_000822267.1|3547403_3548204_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3548200_3548989_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3549322_3549562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3550612_3550960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3550969_3551284_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3551393_3551666_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001476100.1|3551786_3552650_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|3552867_3553206_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3553287_3554322_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945389.1|3554332_3556813_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3556828_3557503_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3557590_3558133_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3558424_3558706_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3558967_3560077_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_171880479.1|3560208_3562242_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_162829202.1|3563794_3565007_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000356839.1|3570514_3574147_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3574208_3574526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3575766_3576855_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3576865_3578395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528949.1|3578413_3579145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3579137_3580274_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3580270_3582274_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001358661.1|3582398_3582860_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	4.1e-76
WP_001295430.1|3582901_3583372_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3583418_3584138_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3584134_3585820_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001142084.1|3587436_3590823_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
WP_001023385.1|3593016_3593286_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	100.0	4.4e-46
WP_113560698.1|3593287_3594601_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	100.0	3.2e-81
WP_001230412.1|3594665_3595265_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_171880480.1|3595331_3598805_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	99.7	0.0e+00
WP_000839179.1|3598918_3599323_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3599319_3599667_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099168.1|3599715_3601254_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	100.0	1.0e-296
WP_126446229.1|3601511_3602144_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	99.5	5.7e-100
WP_001356665.1|3602089_3602833_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	3.7e-151
WP_001152217.1|3602843_3603542_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_000807964.1|3603541_3603883_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212828.1|3603875_3607118_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_122993099.1|3607165_3607375_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000710952.1|3607470_3607845_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275504.1|3607859_3608576_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	99.6	4.7e-127
WP_000133388.1|3608634_3608979_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3608975_3609422_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3609418_3609769_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3609779_3610106_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3612632_3612854_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_113576400.1|3612898_3614836_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001358824.1|3614899_3616561_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958400.1|3616557_3617121_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	93.6	4.7e-82
WP_000279796.1|3617415_3617781_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3617822_3618050_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|3618512_3618770_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|3618766_3619264_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_171880481.1|3619466_3619904_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	2.7e-69
WP_113556606.1|3619900_3620398_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	96.4	9.3e-90
WP_000284515.1|3620397_3620613_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290217.1|3620689_3620962_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|3621002_3621182_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_171507015.1|3621317_3623255_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	99.8	0.0e+00
WP_001398907.1|3623498_3623822_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_000738080.1|3624119_3624389_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001476133.1|3624400_3625360_-	Shiga toxin Stx2c subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	100.0	2.1e-175
WP_001476134.1|3625743_3626802_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.7	3.6e-208
WP_000917741.1|3626952_3627150_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000043971.1|3627394_3628426_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
WP_001476136.1|3628496_3628958_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	100.0	3.3e-73
WP_001205471.1|3628979_3629321_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	100.0	1.6e-61
WP_001476137.1|3629338_3630328_-	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	100.0	3.3e-195
WP_001061404.1|3630335_3631133_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767113.1|3631152_3631542_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|3631538_3631865_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001355692.1|3631861_3632515_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_171880482.1|3632514_3633009_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	4.3e-87
WP_000061497.1|3633005_3633824_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCQ6	Stx2-converting_phage	100.0	2.1e-123
WP_000620696.1|3633820_3634045_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001692640.1|3634041_3635193_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.7	6.7e-216
WP_000515856.1|3635189_3635741_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001191670.1|3635733_3635994_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_001358750.1|3636091_3636784_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	1.3e-121
WP_000135680.1|3637562_3637925_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081298.1|3637990_3638815_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
WP_000008181.1|3638942_3639479_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
WP_001242742.1|3639469_3639820_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
WP_000034220.1|3639816_3640623_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	100.0	1.1e-153
WP_000556583.1|3640946_3641081_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_032301456.1|3641107_3641350_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	4.6e-42
WP_000063646.1|3641383_3642670_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_050437876.1|3642705_3643392_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.5e-103
WP_001216963.1|3643451_3643559_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3643539_3644271_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3644275_3645202_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	3890792	3897610	5454413	transposase,integrase	Enterobacteria_phage(42.86%)	7	3881243:3881259	3893207:3893223
3881243:3881259	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3890792_3891725_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3892036_3893194_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3893368_3894505_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3893207:3893223	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3894514_3895195_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3895181_3895649_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3895648_3896218_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|3896396_3897610_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 13
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	4146317	4239174	5454413	terminase,integrase,holin,capsid,tail,tRNA,head,transposase	Stx2-converting_phage(43.18%)	90	4220641:4220700	4238604:4239217
WP_001302911.1|4146317_4147055_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4147186_4148521_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|4148553_4149435_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189219.1|4149537_4150125_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4150180_4150564_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|4150868_4151558_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|4151605_4152643_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4152849_4153269_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4153337_4154036_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4154067_4156728_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4156841_4158197_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4158242_4158566_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4158562_4159861_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4165634_4168208_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4168337_4169069_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|4169065_4170046_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4170180_4170918_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4171188_4171530_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4171633_4171681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4171779_4172940_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4172982_4174104_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4174114_4175185_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4175394_4175760_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4175909_4176428_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969027.1|4176417_4177644_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4177659_4178142_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4178218_4178566_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4178607_4179375_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4179405_4179954_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4179972_4180221_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4180357_4181719_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4181885_4182677_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4182698_4183985_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4184039_4184633_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4184755_4185634_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|4185719_4187381_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4187529_4187871_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4187932_4188223_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4188212_4188689_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4188820_4189303_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4190148_4190397_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4190898_4191489_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4191671_4192322_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4192400_4193459_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4193588_4194011_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4194171_4194441_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_113556684.1|4195797_4196397_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	6.7e-111
WP_171880484.1|4196463_4199940_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	99.2	0.0e+00
WP_126446232.1|4200186_4200819_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.2	6.7e-101
WP_000967270.1|4200764_4201502_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	99.6	9.1e-150
WP_000835336.1|4201555_4202434_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032301313.1|4202697_4202847_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|4202956_4203211_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001358317.1|4203227_4203926_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807954.1|4203925_4204267_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|4204259_4207502_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|4207553_4207763_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|4207858_4208233_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|4208238_4208955_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|4209022_4209367_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|4209363_4209810_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|4209806_4210157_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|4210166_4210493_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_025380550.1|4213181_4213403_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	3.9e-32
WP_113576423.1|4213447_4215385_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_000958416.1|4217106_4217670_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|4217957_4218323_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|4218364_4218592_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|4219016_4219202_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|4219429_4219576_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056786.1|4219575_4220145_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	4.4e-104
4220641:4220700	attL	CGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAG	NA	NA	NA	NA
WP_000731241.1|4221609_4221954_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4221958_4222174_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_126446192.1|4222323_4224177_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000499458.1|4224584_4224752_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4224837_4225581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4225833_4226457_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4226453_4227119_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223952.1|4227115_4227727_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	96.1	6.5e-93
WP_001108081.1|4227701_4228268_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001417601.1|4229181_4229484_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_064234917.1|4229559_4230846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4231241_4231655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4231752_4232151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|4232151_4233783_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428094.1|4233779_4235093_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4235094_4236300_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001071599.1|4236622_4236829_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000800629.1|4236925_4237777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|4237961_4239174_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
4238604:4239217	attR	CGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
>prophage 14
NZ_CP038374	Escherichia coli O157:H7 strain F3113 chromosome, complete genome	5454413	5295644	5304845	5454413	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_001002036.1|5295644_5296469_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.1	4.5e-89
WP_001171554.1|5296934_5297315_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5297311_5297659_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5297708_5299247_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001303719.1|5299824_5301507_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.8	3.3e-22
WP_001301691.1|5301764_5302388_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	3.5e-17
WP_000135058.1|5302442_5302718_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|5302736_5304845_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
