The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	1220929	1244430	5593140	transposase,integrase,tail,holin	Enterobacteria_phage(33.33%)	27	1212575:1212589	1245301:1245315
1212575:1212589	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1220929_1222135_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222136_1223450_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223446_1225078_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225078_1225477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225574_1225988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024180907.1|1226383_1227634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227709_1228045_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228047_1228803_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229138_1229705_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229679_1230291_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230287_1230953_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1230949_1231573_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231825_1232569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232654_1232822_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233229_1235083_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235232_1235448_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235452_1235797_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236153_1236534_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236530_1236878_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237378_1238592_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238809_1239079_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239239_1239662_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239791_1240850_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1240928_1241579_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241761_1242352_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242853_1243102_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1243947_1244430_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245301:1245315	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	1522008	1527434	5593140	integrase	Enterobacteria_phage(50.0%)	6	1510996:1511012	1529630:1529646
1510996:1511012	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522008_1522578_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522577_1523045_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523031_1523712_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523721_1524858_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525032_1526190_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526501_1527434_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529630:1529646	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	1773053	1875612	5593140	portal,tRNA,holin,protease,tail,terminase	Enterobacteria_phage(65.06%)	118	NA	NA
WP_000569336.1|1773053_1773980_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1773984_1774716_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774696_1774804_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774863_1775565_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1775585_1776872_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1776905_1777160_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1777178_1777313_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1777316_1777559_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1777646_1778009_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1778005_1778362_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001304101.1|1778695_1778872_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001289954.1|1778873_1779821_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1779817_1780039_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1780137_1780419_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1780429_1780621_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1780593_1780776_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1780775_1781453_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1781449_1782235_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1782240_1782537_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1782612_1782756_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1782724_1782889_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1782961_1783330_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1783590_1784172_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1784188_1784461_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1784973_1785525_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1785531_1785813_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1785935_1786583_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1786691_1786910_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1787024_1787321_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1787353_1788292_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1788288_1788990_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1788986_1789277_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1789347_1789626_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1789758_1789974_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1789984_1790221_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1790177_1790624_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1790620_1791148_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1791144_1791321_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1791323_1791725_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1791684_1791894_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1791886_1792492_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1792488_1792683_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1792675_1793110_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1793616_1794564_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1794573_1794843_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1795353_1797300_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1797437_1797617_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1797657_1797903_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1797980_1798196_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1798200_1798734_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1799004_1799574_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1799573_1799720_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1799947_1800133_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1800344_1800617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1800649_1801126_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1801122_1803246_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1803242_1803455_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1803454_1804957_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097065.1|1807012_1807339_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1807331_1807613_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1807615_1808239_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1808251_1808650_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1808657_1809410_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1809423_1809846_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1809872_1810181_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1810224_1812870_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1812866_1813196_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1813195_1813894_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1813904_1814648_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1814593_1815223_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1815463_1816639_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1816590_1818936_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1819003_1819603_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_001302809.1|1819667_1820981_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1820982_1821252_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1821619_1821868_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1822382_1824068_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1824064_1824784_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1824830_1825301_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1825342_1825804_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087234.1|1825910_1827929_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1827925_1829062_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1829054_1829786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1829804_1831334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1831344_1832433_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1833673_1833991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1834052_1837682_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1844639_1846673_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1846804_1847914_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1848175_1848457_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1848748_1849291_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1849378_1850053_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1850068_1852549_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1852559_1853594_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1853675_1854014_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1854231_1855083_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1855203_1855476_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1855585_1855900_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1855909_1856257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1857307_1857547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1857880_1858669_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1858665_1859466_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1859530_1860349_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1860400_1861147_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1861120_1862086_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1862082_1863087_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1863083_1864361_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1864617_1865670_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1865968_1866823_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1866851_1868114_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1868123_1868576_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1868606_1868891_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1868894_1870250_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1870297_1871338_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1871437_1872217_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1872298_1873198_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1873603_1873921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1874250_1875612_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	1973625	2044709	5593140	portal,head,capsid,holin,integrase,tail,transposase,terminase	Enterobacteria_phage(33.33%)	71	1973132:1973147	2028898:2028913
1973132:1973147	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1973625_1974839_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1975210_1977358_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1978805_1980344_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1980393_1980741_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1980737_1981118_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1981479_1982025_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1982021_1982765_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1982776_1983856_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1983917_1984853_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1985309_1986227_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1986328_1987279_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1989665_1990382_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1990724_1992179_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1992280_1993597_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1993910_1994963_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1995224_2003207_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2003696_2004494_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2004729_2005752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2005751_2005955_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2006013_2008485_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2008580_2008769_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2008765_2008954_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2009434_2009587_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2009861_2010506_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2010603_2010831_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2010827_2011253_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2011321_2012359_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2012270_2012813_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2012847_2013546_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2013567_2013792_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2013788_2014145_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2014177_2014330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2014326_2014638_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2014764_2015328_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2015437_2015542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2015728_2015941_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2016108_2016387_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2016388_2017438_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2017450_2017810_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2017806_2018496_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2019129_2019558_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2020035_2021886_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_024165672.1|2022178_2022394_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2022398_2022743_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2022793_2023327_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2023482_2023665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2023677_2023809_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2024036_2024222_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2024748_2025063_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2025144_2025369_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2025763_2026273_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2026244_2028173_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2028156_2028363_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2028359_2029952_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2028898:2028913	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2029941_2031447_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2031483_2031831_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2031888_2032155_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2032136_2032877_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2032890_2033322_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2033348_2033762_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2033742_2035605_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_001304129.1|2035556_2036321_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.0	3.3e-134
WP_000847298.1|2036317_2036647_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2036646_2037345_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2037355_2038099_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|2038044_2038674_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|2038914_2040090_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|2040041_2042393_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2042460_2043060_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171880439.1|2043124_2044438_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001023407.1|2044439_2044709_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	2102289	2122272	5593140	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2115408:2115421	2125414:2125427
WP_032161728.1|2102289_2103423_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2103373_2103697_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2103854_2105039_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2105038_2105551_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2105605_2105971_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2105979_2106135_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2108937_2109426_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2109582_2110155_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2110198_2110729_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2111820_2112135_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2112139_2113099_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2113175_2115998_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2115408:2115421	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2116004_2116370_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2116366_2116984_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2116995_2117295_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2117291_2117558_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2117554_2117758_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2117781_2118198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2118290_2118404_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2118400_2118643_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2118654_2118933_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2118943_2119294_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2119315_2119519_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2119590_2119728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2119817_2120222_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2120237_2120888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2120917_2121265_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2121270_2122272_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2125414:2125427	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	2151674	2247008	5593140	portal,holin,protease,lysis,tail,tRNA,terminase	Enterobacteria_phage(45.16%)	104	NA	NA
WP_001025318.1|2151674_2153408_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302537.1|2153623_2154190_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185748.1|2154203_2154950_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214277.1|2155337_2156438_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_000176813.1|2156462_2158892_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564730.1|2159056_2160028_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2160024_2160768_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2160808_2161204_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_171880451.1|2161256_2162033_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.4e-71
WP_000063650.1|2162037_2163324_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|2163357_2163612_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001484100.1|2163803_2164175_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_000720006.1|2164215_2165043_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001365075.1|2165412_2165985_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000553977.1|2165990_2166173_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_000147364.1|2166371_2166572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387836.1|2166568_2167270_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000800140.1|2167418_2168108_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000944728.1|2168264_2168498_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090254.1|2168579_2169287_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000587259.1|2169395_2170058_+	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_000621233.1|2170054_2170288_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_001247844.1|2170274_2171183_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000988196.1|2171193_2172072_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_000203852.1|2172068_2173469_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_001065352.1|2173465_2173723_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202271.1|2173774_2174764_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001204809.1|2174782_2175163_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917741.1|2175378_2175576_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000483505.1|2175727_2176786_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_150225361.1|2177168_2178128_+	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	99.7	4.8e-175
WP_000738080.1|2178139_2178409_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_171880440.1|2178919_2180866_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.1	0.0e+00
WP_000143462.1|2181001_2181181_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|2181221_2181467_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2181544_2181760_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087729.1|2181764_2182298_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_000539792.1|2183142_2183289_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082574.1|2183296_2183764_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_106913692.1|2183913_2184162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348556.1|2184217_2184694_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_171880441.1|2184690_2186814_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.9	0.0e+00
WP_000102415.1|2186810_2187023_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974567.1|2187022_2188525_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_122993997.1|2188514_2190494_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.8	0.0e+00
WP_001097065.1|2190581_2190908_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|2190900_2191182_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974967.1|2191184_2191808_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.0	1.2e-99
WP_000682716.1|2191820_2192219_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2192226_2192979_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479061.1|2192992_2193415_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000532073.1|2193441_2193750_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918243.1|2193793_2196439_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|2196435_2196765_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001365123.1|2196764_2197463_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_171880442.1|2197473_2198217_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.3e-147
WP_150225312.1|2198162_2198795_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	1.6e-102
WP_150385481.1|2199040_2202532_+	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.0	0.0e+00
WP_001233064.1|2202602_2203202_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.0	5.9e-107
WP_106913681.1|2203266_2204580_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_001023407.1|2204581_2204851_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_122988840.1|2204961_2205039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993326.1|2205253_2206267_+	peptidase M85	NA	NA	NA	NA	NA
WP_001261931.1|2206638_2206887_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_000891621.1|2207204_2207771_-	hydrolase	NA	NA	NA	NA	NA
WP_001258683.1|2208080_2209853_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|2209970_2210423_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2210451_2211192_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2211226_2211748_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|2211749_2212352_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|2212422_2212488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2212626_2213238_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2213246_2214257_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|2214502_2215288_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2215284_2216040_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001303192.1|2216118_2217051_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2217066_2218389_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448391.1|2218508_2219480_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091169.1|2219610_2221053_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|2221180_2222050_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301737.1|2222387_2223863_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|2224097_2225909_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2225945_2226587_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173471.1|2226642_2227821_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2227954_2228245_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2228311_2228668_+	protein YebF	NA	NA	NA	NA	NA
WP_000024742.1|2228994_2229654_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936917.1|2229862_2231923_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944243.1|2231919_2232582_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_000011656.1|2232605_2233262_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2233363_2233594_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2233732_2234107_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2234110_2234983_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2234995_2235337_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|2235732_2236389_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|2236389_2236581_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2236685_2236922_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|2237039_2238479_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2238559_2241193_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2241161_2242445_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2242574_2243072_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431368.1|2243168_2243867_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2243886_2245935_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2246126_2247008_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	2487951	2605292	5593140	portal,head,capsid,holin,protease,tail,transposase,terminase	Enterobacteria_phage(33.33%)	143	NA	NA
WP_001260835.1|2487951_2488773_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2488872_2488956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2489048_2489384_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2489780_2491034_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2491140_2492034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2492168_2493389_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2493513_2494209_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2494161_2495454_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2495611_2496226_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2496268_2497123_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2497124_2497742_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2497752_2500176_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2500236_2502663_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2502861_2503167_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2503274_2503985_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2503987_2504548_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2504582_2504924_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2505058_2505385_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2506373_2506625_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2506697_2509169_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2509261_2509453_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2509449_2509638_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2510038_2510203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2510206_2510425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2510496_2510796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2511148_2511427_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2511428_2511620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2511640_2512012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2512109_2512412_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2512408_2512834_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2512856_2513819_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2513825_2514566_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2515376_2515772_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2515828_2516413_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2516528_2516633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2516821_2517034_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2517201_2517480_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2517481_2518531_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2518543_2518903_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2518899_2519589_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2520227_2520656_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2521134_2522985_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2523424_2523640_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2523644_2523989_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2524039_2524573_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2524843_2525413_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2525412_2525559_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2525786_2525972_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2526396_2526624_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2526665_2527031_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2527320_2527884_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2527880_2529542_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2529605_2531543_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2531587_2531809_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_171880443.1|2531754_2534334_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.6	0.0e+00
WP_000125988.1|2534336_2534663_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2534672_2535023_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2535019_2535466_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2535462_2535807_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2535872_2536589_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2536603_2536978_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2537073_2537283_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|2537330_2540573_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|2540565_2540907_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2540906_2541605_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2541615_2542359_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2542304_2542937_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2543278_2544454_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|2546820_2547420_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2547484_2548708_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2548709_2548979_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2550378_2551029_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2551611_2553150_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2553199_2553547_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2553543_2553924_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2554886_2555129_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001206148.1|2555306_2556602_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|2556621_2556873_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000048585.1|2556942_2559414_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|2559507_2559699_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2559695_2559884_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|2560451_2560661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2560661_2561300_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|2561311_2561464_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000362153.1|2561729_2562149_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2562249_2562531_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|2562514_2562940_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|2562962_2563931_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|2563937_2564678_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450862.1|2564707_2565478_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001141099.1|2565493_2565886_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_024182342.1|2565882_2566179_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
WP_001018050.1|2566175_2566457_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
WP_001005870.1|2566449_2566704_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	96.4	3.3e-43
WP_001002668.1|2566696_2567008_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_000256992.1|2567135_2567354_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_171880444.1|2567355_2567892_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	54.8	2.8e-60
WP_000787530.1|2567891_2568287_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000128514.1|2568515_2568728_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001341388.1|2568895_2569174_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265151.1|2569175_2570225_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
WP_001217425.1|2570237_2570597_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064874.1|2570593_2571262_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_032316733.1|2571965_2573816_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024180155.1|2574254_2574470_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2574474_2574819_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992148.1|2574869_2575403_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2575673_2576243_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2576242_2576389_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2576611_2576797_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2577322_2577637_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2577718_2577943_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2578329_2578875_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2578849_2580775_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2580771_2580978_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2580974_2582576_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2582556_2583876_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2583885_2584218_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2584273_2585299_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2585340_2585739_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2585750_2586104_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2586118_2586652_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2586648_2587044_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2587051_2587804_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2587817_2588240_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2588266_2588680_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2588660_2591273_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2591269_2591599_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2591598_2592297_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2592307_2593051_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|2592996_2593626_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|2593866_2595042_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|2594993_2597345_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2597412_2598012_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2598076_2599300_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2599301_2599571_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2599684_2600260_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2600332_2600962_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2601043_2601685_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2601846_2602089_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2602220_2603504_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2603592_2605053_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2605088_2605292_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	2787259	2895621	5593140	portal,head,capsid,tRNA,holin,protease,lysis,tail,transposase,terminase	Escherichia_phage(46.96%)	129	NA	NA
WP_001295593.1|2787259_2787694_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2788274_2788916_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2788997_2789627_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2789699_2790275_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2790387_2790657_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2790658_2791972_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2792036_2792636_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2792706_2796204_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2796337_2796865_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2797055_2797688_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2797633_2798377_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2798387_2799086_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2799085_2799427_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2799419_2802500_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2802551_2802761_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2802856_2803231_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2803236_2803953_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2804021_2804366_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2804362_2804809_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2804805_2805156_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2805165_2805492_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2808018_2808240_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2808284_2810222_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2810285_2811947_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2811943_2812507_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2812795_2813161_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2813202_2813403_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2813534_2813861_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2814261_2814447_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2814669_2814801_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2814895_2815591_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2815864_2816398_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2816448_2816793_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2816797_2817013_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2817162_2819016_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2819590_2820022_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2820583_2821138_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2821134_2821425_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2821424_2822024_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2822523_2823915_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000365100.1|2824417_2824663_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2824741_2824903_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2824913_2825177_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2825428_2825641_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2825746_2826169_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2826184_2826946_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2826968_2827715_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2827721_2828510_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2828587_2829010_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2829006_2829261_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2829340_2829760_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2830002_2830182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2830192_2830348_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2830344_2830833_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2831274_2831496_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2831495_2831666_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2831740_2832016_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2832117_2834718_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2834710_2835520_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2835575_2835725_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2835762_2835951_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2836050_2836266_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2836267_2837503_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_122988840.1|2839411_2839489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101703.1|2839599_2839869_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_045904098.1|2839870_2841184_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001216293.1|2841248_2841872_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_171880445.1|2841939_2845416_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.1	0.0e+00
WP_069905658.1|2845656_2846286_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_001365018.1|2846231_2846975_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	2.7e-149
WP_001426561.1|2846985_2847684_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847306.1|2847683_2848013_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000918271.1|2848009_2850655_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000532075.1|2850698_2851007_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|2851033_2851456_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|2851469_2852222_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2852229_2852628_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2852640_2853264_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2853266_2853548_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2853540_2853867_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114429.1|2853954_2855979_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974576.1|2855923_2857426_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.8	5.4e-290
WP_000102415.1|2857425_2857638_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077608.1|2857634_2859758_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|2859754_2860231_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_100209512.1|2860263_2860536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082574.1|2860685_2861153_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000539792.1|2861160_2861307_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_000087729.1|2862151_2862685_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072899.1|2862689_2862905_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2862982_2863228_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143462.1|2863268_2863448_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_171880446.1|2863583_2865530_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.5	0.0e+00
WP_000640170.1|2867071_2867626_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_000228018.1|2867622_2867913_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000940340.1|2867912_2868512_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000687447.1|2868571_2868745_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.2e-17
WP_000818166.1|2868973_2869459_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|2869477_2869657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|2869865_2870078_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_001278450.1|2870266_2870371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206794.1|2870486_2871071_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001141093.1|2871127_2871520_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_050923614.1|2871535_2872306_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_000788990.1|2872327_2873074_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000899743.1|2873080_2873938_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000702023.1|2873950_2874373_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000171139.1|2874356_2874632_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|2874736_2875201_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_001169149.1|2875581_2875734_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000935601.1|2876162_2877011_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.8	1.7e-54
WP_000560228.1|2877057_2877279_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000258918.1|2877272_2877449_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	70.7	6.3e-17
WP_001358843.1|2877523_2877799_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.2e-44
WP_000105091.1|2877900_2880573_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	80.6	0.0e+00
WP_000166318.1|2880565_2881375_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
WP_001302840.1|2881618_2881807_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2881906_2882122_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_024185869.1|2882123_2883359_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	6.7e-238
WP_001157382.1|2883410_2884346_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123746.1|2884474_2885848_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2885880_2886051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2886325_2887309_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2887563_2888796_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|2888816_2889380_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000885454.1|2889709_2890618_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444937.1|2890793_2892104_+	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_001156434.1|2892103_2893549_+	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_162829202.1|2894408_2895621_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 9
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	2973742	3092580	5593140	portal,head,capsid,holin,integrase,protease,tail,transposase,terminase	Stx2-converting_phage(27.84%)	138	2989244:2989271	3092717:3092744
WP_000422055.1|2973742_2974792_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2975011_2975770_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2975766_2976357_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2976396_2977269_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2977481_2979065_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2979092_2979713_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2979709_2980591_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2980728_2980773_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2980864_2982427_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2982426_2984022_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2984022_2985384_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2985395_2986589_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2986588_2987395_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2987775_2987955_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2988040_2988541_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2988586_2989093_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2989244:2989271	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001261931.1|2989822_2990071_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|2990442_2991456_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2991670_2991748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|2991858_2992128_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_106913681.1|2992129_2993443_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_001233064.1|2993507_2994107_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.0	5.9e-107
WP_150385481.1|2994177_2997669_-	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.0	0.0e+00
WP_150225312.1|2997914_2998547_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	1.6e-102
WP_171880442.1|2998492_2999236_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.3e-147
WP_001365123.1|2999246_2999945_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847298.1|2999944_3000274_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|3000270_3002916_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|3002959_3003268_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479061.1|3003294_3003717_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000235090.1|3003730_3004483_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3004490_3004889_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974967.1|3004901_3005525_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.0	1.2e-99
WP_001281347.1|3005527_3005809_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|3005801_3006128_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_122993997.1|3006215_3008195_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.8	0.0e+00
WP_000974567.1|3008184_3009687_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|3009686_3009899_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077608.1|3009895_3012019_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|3012015_3012492_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3012966_3013152_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|3013670_3014204_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|3014240_3014798_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_000284506.1|3014801_3015017_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3015093_3015366_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143462.1|3015406_3015586_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_136858096.1|3015721_3017668_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.4	0.0e+00
WP_000483509.1|3018262_3019321_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917733.1|3019472_3019670_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000762902.1|3019896_3020718_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|3020714_3021089_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265189.1|3021101_3022151_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_024177817.1|3022152_3022422_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001452497.1|3022475_3022703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|3022926_3023298_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|3023290_3023608_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|3023710_3023923_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211435.1|3024137_3024686_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000215514.1|3025033_3025219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537579.1|3025278_3026037_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
WP_157837342.1|3026071_3026614_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020565.1|3026525_3027566_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_000705370.1|3027537_3028089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3028072_3028300_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3028377_3028785_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|3028974_3029130_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|3029289_3029508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|3029511_3029676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3030073_3030262_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3030258_3030447_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|3030539_3032984_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|3033048_3033297_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|3033274_3034405_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_001144877.1|3037861_3038452_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3038635_3039283_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3039419_3039566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3039993_3040272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3040611_3040992_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3040988_3041336_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3041385_3042924_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3043889_3044459_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3044524_3045436_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3045542_3045665_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3047262_3048588_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3049614_3049884_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3049885_3051199_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3051350_3051950_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000514792.1|3052017_3055494_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001152128.1|3055681_3056119_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|3056118_3056460_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212897.1|3056452_3059533_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_001453698.1|3059585_3059795_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3059890_3060265_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275500.1|3060270_3060987_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_000133388.1|3061045_3061390_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3061386_3061833_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3061829_3062180_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3062189_3062516_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_115442542.1|3062518_3065098_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063094.1|3065043_3065265_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|3065309_3067247_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3067310_3068972_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3068968_3069532_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3069821_3070187_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3070228_3070456_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3070880_3071066_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3071293_3071440_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3071439_3072009_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3072279_3072813_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3072863_3073208_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3073212_3073428_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3073577_3075431_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3076227_3077286_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3077436_3077634_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3077875_3078406_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3078414_3078774_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3078786_3079833_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3079834_3080113_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3080182_3080440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3080660_3080873_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3081151_3081910_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3082608_3082773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3082769_3083351_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3083537_3084080_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3083991_3085032_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3085003_3085555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3085538_3085766_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3085842_3086250_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3086513_3086813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3086885_3087104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3087126_3087534_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3087511_3087745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|3087738_3087882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3088218_3088407_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3088403_3088595_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3088687_3091159_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3091223_3091472_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3091449_3092580_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3092717:3092744	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	3138982	3313106	5593140	portal,head,capsid,holin,integrase,protease,lysis,tail,tRNA,transposase,terminase	Enterobacteria_phage(32.5%)	197	3171692:3171707	3319763:3319783
WP_001299679.1|3138982_3140239_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3140452_3141076_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3141075_3141927_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3142077_3143025_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3143149_3144829_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3144883_3145162_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3145439_3146024_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3146140_3147232_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3150053_3151124_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3151134_3151767_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3151777_3153196_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3155227_3155428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3155535_3156558_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3156557_3157538_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3157534_3158293_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3159111_3159966_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3159991_3161962_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3162011_3162266_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3163114_3164327_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3164515_3165127_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3165226_3166141_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3166236_3167973_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3168364_3169435_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3169444_3170743_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3171105_3172638_+	SpoVR family protein	NA	NA	NA	NA	NA
3171692:3171707	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3172689_3173409_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3171692:3171707	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3173630_3175172_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3175317_3175848_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3175893_3177162_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3177161_3177581_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3177953_3178865_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3179071_3179533_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3179609_3180269_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3180340_3180634_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3180645_3180804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3180874_3181276_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3181378_3181747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3182266_3182962_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3182985_3183798_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3183801_3184068_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3185233_3186447_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3186620_3187205_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3187703_3188657_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3188843_3190328_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3190630_3192169_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3192218_3192566_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3192562_3192943_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3193018_3193267_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3193323_3193992_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3194489_3194672_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3194750_3195251_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3195287_3195794_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3195812_3196703_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3196822_3197404_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3197403_3200319_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3200383_3200983_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3201049_3204448_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3204508_3205141_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3205077_3205821_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3205826_3206525_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3206524_3206854_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3206850_3209400_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3209392_3209827_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3209808_3210231_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3210246_3210987_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000138832.1|3211709_3213434_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_000975100.1|3213792_3214371_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3214382_3214736_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3214747_3215146_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3215187_3216213_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3216268_3216601_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3216610_3217930_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3217910_3219512_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3219508_3219715_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3219711_3221637_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3221611_3222157_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3222545_3222740_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3222904_3223111_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3223396_3223807_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3224098_3224392_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3224482_3224665_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3224881_3225358_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3225344_3225650_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3225971_3226661_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3226657_3226798_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3226794_3227157_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3227153_3227444_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3227436_3227607_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3227606_3228062_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3228563_3230090_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3230147_3230270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3230334_3230667_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3230734_3231037_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3231033_3231735_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3232659_3232896_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3232885_3234028_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3234141_3235392_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3235563_3236217_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3236226_3236688_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3236741_3237848_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3237883_3238525_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3238528_3239899_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3239817:3239832	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3240067_3240739_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3239817:3239832	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3240738_3242199_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3243055_3243337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|3243350_3245012_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|3244995_3245352_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3245475_3245658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3245641_3246082_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3246081_3246378_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3246374_3246713_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3246709_3247921_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3247922_3248495_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3248534_3249692_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3249984_3250209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3250333_3250606_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3250616_3251027_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3251023_3251275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3251645_3253778_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3253774_3254074_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3254079_3254322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3254311_3254503_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3254502_3254688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3254680_3254878_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3254903_3255647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3255704_3255893_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3256257_3257487_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3257735_3258857_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3258905_3260132_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3260381_3261518_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3261501_3262365_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3262728_3264090_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3264150_3264426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3266734_3270136_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3270726_3273075_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3273094_3273184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3273196_3273433_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3273378_3274116_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3274169_3275048_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3275350_3275461_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3275570_3275825_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3275841_3276540_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3276539_3276881_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3276873_3280116_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3280168_3280378_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3280473_3280848_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3280853_3281570_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3281628_3281973_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3281969_3282416_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3282412_3282763_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3282772_3283099_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171880447.1|3283178_3285194_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	79.5	0.0e+00
WP_001063099.1|3285139_3285361_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3285405_3287343_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3287406_3289068_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3289064_3289628_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3289917_3290283_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3290324_3290510_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3290639_3290780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3291136_3291361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3291425_3291632_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3291859_3292006_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3292005_3292575_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3292845_3293379_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|3293429_3293774_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284518.1|3293778_3293994_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3294069_3294339_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3294376_3294559_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3294706_3296644_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3296958_3297126_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3297722_3298544_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3298540_3298915_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3298927_3299977_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3299978_3300257_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3300424_3300637_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3300825_3300930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3301045_3301633_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3301635_3301827_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3301828_3302266_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3302252_3302570_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3302523_3302841_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3302830_3303133_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3303129_3303411_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3303443_3304160_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3304193_3304736_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3304647_3305685_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3305753_3306179_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3306162_3306486_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3306610_3307087_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3307402_3307555_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3307669_3308185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3308317_3308707_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3308768_3309038_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3309006_3310125_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3310291_3311086_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3311082_3312129_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3312284_3313106_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3319763:3319783	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	3540587	3691673	5593140	portal,bacteriocin,capsid,head,holin,integrase,protease,tail,transposase,terminase	Escherichia_phage(47.01%)	178	3638219:3638234	3693438:3693453
WP_001028088.1|3540587_3541082_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3541102_3542431_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3542513_3542621_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203825.1|3543579_3544209_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3544256_3544478_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3544474_3544759_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3545236_3545644_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3545643_3546039_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3546272_3546485_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3546604_3546949_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000331690.1|3547499_3555881_-	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3555950_3557216_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3557226_3557478_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3557487_3557934_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3557936_3558593_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3558686_3559088_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3559144_3559285_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3559517_3560252_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3560342_3560960_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3560965_3561244_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3561258_3562527_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3562523_3564149_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3564443_3564632_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3564771_3565041_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3565042_3566980_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3566976_3567627_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3567626_3568190_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3568173_3568635_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3568684_3569074_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3569129_3570344_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3570367_3571375_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3571532_3573677_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3573676_3575383_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3575363_3576170_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3576578_3576872_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3576962_3577148_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3577375_3577522_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3577521_3578091_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3578361_3578895_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3578899_3579115_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3579191_3579464_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3579504_3579684_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000224729.1|3579818_3580088_-	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
WP_162829202.1|3580145_3581358_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738068.1|3583556_3583826_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3583837_3584797_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3585580_3586015_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3586007_3586202_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3586198_3586804_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|3586803_3587526_-	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|3587600_3588335_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|3588609_3588792_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3588788_3589316_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3589312_3589759_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3589715_3589952_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3589962_3590178_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3590310_3590589_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|3590659_3590929_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|3590928_3592365_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|3592354_3593254_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|3593246_3593393_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|3593425_3593722_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|3593863_3594079_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3594154_3594850_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3595351_3595873_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3596441_3596624_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3596601_3596874_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3596932_3597184_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3597366_3597735_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3597807_3597972_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3597940_3598084_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3598158_3598455_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3598460_3599246_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|3599242_3599923_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|3599919_3600102_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|3600074_3600266_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_077632356.1|3600276_3600558_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	98.9	5.5e-47
WP_000774248.1|3600656_3600878_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|3600874_3601648_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|3601799_3601988_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3601989_3602205_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3602206_3602425_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3602426_3602714_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3603689_3603989_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3604074_3604359_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3604411_3605722_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3605718_3606297_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3606317_3606545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3606582_3607824_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3609631_3610552_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3610551_3610857_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3611010_3611610_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3611606_3614153_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3614152_3615325_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3615454_3616147_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3616119_3617148_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|3617230_3619975_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|3620046_3621120_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3621168_3621303_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3621330_3621561_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3621535_3621724_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3621734_3621947_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3622232_3622445_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3622886_3623192_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3623298_3623943_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3623939_3624686_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3624685_3626782_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3626827_3627967_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3627954_3628401_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3628420_3630601_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3630720_3632025_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3632104_3632197_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3632209_3633346_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3633357_3634902_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3635035_3635893_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3635889_3636288_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3636284_3636872_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3636868_3637576_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3637594_3639388_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3638219:3638234	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3639384_3640503_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3642776_3643046_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3643047_3644361_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3644425_3645025_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3645092_3648566_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3648699_3649227_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3649417_3650050_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3649995_3650739_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3650749_3651448_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3651447_3651777_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082449.1|3651773_3654353_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000533402.1|3654333_3654747_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3654773_3655205_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3655218_3655959_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3655940_3656207_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3656264_3656612_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3656648_3658154_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3658143_3659736_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3659732_3659939_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3659922_3661851_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3662114_3663653_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3663702_3664050_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3664046_3664427_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3664502_3664778_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3665528_3665735_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3665990_3666263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3666422_3666956_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3667176_3667290_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3667511_3667697_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_171880448.1|3668224_3668539_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3669895_3671746_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3672513_3673227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3673847_3674666_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3674817_3675189_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3675178_3675550_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3675562_3676612_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3676613_3676892_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3677059_3677215_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3677316_3677454_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3677819_3678593_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3678944_3679358_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3679373_3680144_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3680165_3680912_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3680918_3682010_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3682088_3682544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3682750_3683176_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3683159_3683432_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3683540_3683942_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3683969_3684161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3684160_3684448_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3684725_3684881_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3685022_3685412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3685598_3685784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3686357_3686546_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3686542_3686734_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3686827_3689299_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3689366_3689609_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3689586_3690606_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3691013_3691673_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3693438:3693453	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	3922610	3960707	5593140	portal,holin,integrase,protease,lysis,tail,terminase	Enterobacteria_phage(51.16%)	50	3922195:3922209	3960781:3960795
3922195:3922209	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3922610_3923309_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3923539_3924421_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3924590_3924752_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3925248_3926268_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3926301_3927282_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3927458_3927728_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3927729_3929046_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3929105_3929705_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3929775_3933189_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3933249_3933858_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3933794_3934538_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3934543_3935242_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3935251_3935581_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3935580_3938646_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3938617_3938947_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3938955_3939342_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3939402_3940146_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3940156_3940558_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3940554_3941133_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3941144_3941420_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3941412_3941736_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3941822_3943850_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3943794_3944130_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3944251_3945376_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3945303_3945516_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3945512_3947615_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3947614_3948106_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3948780_3948933_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3948920_3949388_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3949384_3949882_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3949881_3950097_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3950239_3950638_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3950718_3950877_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3950962_3951706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3951889_3952579_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3952593_3952716_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3953053_3954013_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3954224_3954890_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3954886_3955507_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3955499_3955670_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3955666_3955849_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3956546_3957227_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3957223_3957406_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3957378_3957570_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3957580_3957862_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3957960_3958182_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3958392_3958995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3959237_3959405_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3959444_3959663_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3959936_3960707_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3960781:3960795	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038372	Escherichia coli O157:H7 strain F6294 chromosome, complete genome	5593140	4503815	4598231	5593140	transposase,integrase,tail,plate	Enterobacteria_phage(30.0%)	97	4530339:4530357	4584418:4584436
WP_000998048.1|4503815_4505354_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4505403_4505751_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4505747_4506128_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4506391_4506655_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4506654_4506795_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4506864_4507056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4507880_4508423_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4508497_4509085_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4509142_4509811_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4509836_4512362_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4512351_4513995_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4513963_4514674_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4514986_4515316_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4515563_4516178_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4516595_4517285_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4517281_4518238_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4518234_4520433_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4520442_4521399_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4521577_4522705_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4522846_4523905_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4524150_4525053_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4525755_4526034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4526200_4526923_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4527021_4527921_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4528596_4529553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4529685_4532019_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4530339:4530357	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4532032_4532356_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4532355_4532577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4532573_4533131_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4533127_4533388_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4534321_4535074_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4535070_4535622_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4535627_4535900_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4536309_4536876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4536875_4537466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4537496_4538129_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4538121_4538580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4538579_4539197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4539169_4539586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4539589_4540771_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4541733_4542477_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4543300_4544074_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4544131_4544686_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4544715_4545126_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4545146_4545590_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4545561_4546155_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4546154_4546949_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4546948_4547260_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_162829202.1|4547997_4549211_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_115449996.1|4549216_4549492_-	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	5.0e-37
WP_000251069.1|4549524_4549818_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4549936_4550137_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4550237_4550951_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708827.1|4551078_4551468_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	2.2e-06
WP_001303805.1|4551707_4551953_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4553022_4554276_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4554287_4555391_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4555678_4556734_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4556772_4557174_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4557231_4558476_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4558567_4559026_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4559286_4560744_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4560800_4561358_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4561269_4561536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4561842_4562295_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4562304_4562703_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4562705_4562999_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4563050_4564106_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4564176_4564962_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4564906_4566646_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4567463_4568237_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4568422_4568683_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4568701_4568962_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4569117_4569858_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4569828_4570596_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4570700_4571279_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4571518_4573963_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4574005_4574479_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4574632_4575403_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4575520_4576693_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4576773_4576959_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4576873_4577137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4577338_4579099_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4579101_4580238_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356573.1|4580983_4581541_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4581609_4585824_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
4584418:4584436	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103107.1|4585899_4588041_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|4588250_4588769_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4589465_4589966_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4590000_4590225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4590275_4591667_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4591757_4592171_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4592174_4594025_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4593988_4595071_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4595095_4596376_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4596372_4596897_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4596899_4598231_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038373	Escherichia coli O157:H7 strain F6294 plasmid pF6294-1, complete sequence	92725	29207	37999	92725	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	25777:25790	32365:32378
25777:25790	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|31911_32250_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|32837_34004_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
32365:32378	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|34003_34975_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|36274_37999_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
