The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	1225823	1239262	5530739	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1225823_1226435_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1226431_1227097_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1227093_1227717_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1227969_1228713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1228798_1228966_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1229373_1231227_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1231376_1231592_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1231596_1231941_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1232297_1232678_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1232674_1233022_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1233641_1233911_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_163332151.1|1234071_1234488_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	95.7	3.0e-73
WP_001301665.1|1234624_1235683_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_097209403.1|1235761_1236412_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1236594_1237185_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1237686_1237935_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1238779_1239262_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	1516846	1570039	5530739	portal,protease,transposase,capsid,tail,integrase,holin,lysis	Escherichia_phage(29.17%)	72	1521241:1521264	1577773:1577796
WP_000950857.1|1516846_1517416_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1517415_1517883_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1517869_1518550_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1518559_1519696_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1519870_1521028_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1521241:1521264	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1521459_1522629_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1522612_1522795_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1522855_1523107_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000763383.1|1524500_1524722_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1524820_1525102_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1525112_1525304_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_064032105.1|1525276_1525459_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	2.0e-26
WP_000186844.1|1525455_1526136_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_016241376.1|1526132_1526918_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|1526923_1527220_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1527295_1527439_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1527407_1527572_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167595.1|1527763_1528234_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024231298.1|1528237_1528570_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	97.3	4.6e-53
WP_032250460.1|1528923_1529328_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	9.6e-69
WP_000028392.1|1529324_1529957_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1530063_1530279_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1530398_1530692_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_064234920.1|1531592_1532294_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1532290_1532581_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1532651_1532930_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1533062_1533278_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1533288_1533525_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1533481_1533928_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153270.1|1533924_1534452_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1534448_1534631_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001502725.1|1535134_1536907_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001108081.1|1537488_1538055_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_064032103.1|1538029_1538641_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_000144764.1|1538637_1538832_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1538824_1539259_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1539765_1540713_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1540722_1540992_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064032101.1|1541495_1543436_+	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000143458.1|1543572_1543752_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1543792_1544065_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1544141_1544357_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1544361_1544895_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1545209_1545752_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1545751_1545901_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_064032098.1|1545908_1546346_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	96.6	1.2e-69
WP_000839224.1|1546548_1547046_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1547042_1547300_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001086076.1|1547703_1548510_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1548490_1550197_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1550196_1552341_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1552498_1553506_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1553529_1554744_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1554799_1555189_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1555238_1555700_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1555683_1556247_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_064032097.1|1556246_1556897_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	1.3e-120
WP_064234923.1|1556893_1558789_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1558790_1559060_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1559201_1559390_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1559684_1561310_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1561306_1562575_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1562589_1562868_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1562873_1563491_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1563581_1564316_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1564548_1564689_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1564745_1565147_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1565240_1565897_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1565899_1566346_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1566355_1566607_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012455.1|1566617_1567883_+	hypothetical protein	NA	A0A1U9AJC6	Stx1_converting_phage	100.0	2.4e-206
WP_162829202.1|1568826_1570039_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
1577773:1577796	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	1822942	1898709	5530739	portal,protease,transposase,tail,terminase,tRNA,holin	Enterobacteria_phage(53.42%)	84	NA	NA
WP_000569336.1|1822942_1823869_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1823873_1824605_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1824585_1824693_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1824752_1825454_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1825474_1826761_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1826794_1827049_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1827067_1827202_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1827205_1827448_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1827535_1827898_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1827894_1828251_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1828584_1828761_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1828762_1829710_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1829706_1829928_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1830026_1830308_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1830318_1830510_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1830482_1830665_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1830664_1831342_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1831338_1832124_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1832129_1832426_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1832501_1832792_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1833295_1834903_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1835009_1835702_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1836065_1836605_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1836601_1837621_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1837617_1838319_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1838315_1838600_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1838827_1839025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1839068_1839350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1839440_1839542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1839538_1839994_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1839993_1840164_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1840156_1840447_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1840443_1840806_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1840802_1840943_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1841028_1841463_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1841711_1841864_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1842667_1844614_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1844751_1844931_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1844971_1845217_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1845294_1845510_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001056806.1|1846316_1846886_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1846885_1847032_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1847259_1847445_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1847962_1848439_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1848435_1850559_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1850555_1850768_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1850767_1852270_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1852214_1854239_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1854326_1854653_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1854645_1854927_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1854929_1855553_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1855565_1855964_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1855971_1856724_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1856737_1857160_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_163332214.1|1857186_1857285_+	hypothetical protein	NA	Q687F4	Enterobacteria_phage	96.9	1.5e-12
WP_000998048.1|1857318_1858857_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1858906_1859254_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1859250_1859631_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_097331591.1|1859681_1859945_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	95.1	1.1e-36
WP_151589247.1|1859988_1862634_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1862630_1862960_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|1862959_1863658_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|1863668_1864412_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|1864357_1864987_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_171879498.1|1865227_1868707_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_001230459.1|1868773_1869373_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268879.1|1869437_1870607_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001023396.1|1870608_1870878_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1871038_1871455_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1871536_1872178_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1872339_1872588_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1873102_1874788_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1874784_1875504_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1875550_1876021_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1876062_1876524_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1876648_1878652_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1878648_1879785_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1879777_1880509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1880527_1882057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1882067_1883156_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1884396_1884714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1884775_1888405_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1894707_1895920_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001457618.1|1896675_1898709_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	1924358	1962425	5530739	portal,capsid,tail,terminase,integrase,tRNA,holin,head,lysis,plate	Escherichia_phage(62.22%)	50	1926139:1926166	1958099:1958126
WP_000807362.1|1924358_1925258_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1925663_1925981_+	hypothetical protein	NA	NA	NA	NA	NA
1926139:1926166	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1926245_1927259_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1927374_1927674_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1927795_1928071_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1928081_1928252_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217673.1|1928248_1928749_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1928812_1929037_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1929036_1929336_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1929338_1929563_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1929559_1929835_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_171879499.1|1929824_1932107_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.2	0.0e+00
WP_000063136.1|1932196_1933420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1933466_1933919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1933918_1935886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1936203_1937238_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1937237_1939010_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1939183_1940038_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1940096_1941170_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1941173_1941917_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1942016_1942526_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1942525_1942729_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1942732_1943014_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1943013_1943511_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1943525_1943951_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1943938_1944364_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1944335_1944509_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1944471_1944939_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1944931_1945384_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1945450_1946086_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1946082_1946430_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1946434_1947343_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1947335_1947947_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1947943_1949263_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1949262_1949865_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1949836_1950280_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1950300_1950711_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1950741_1951335_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1951394_1952585_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1952597_1953116_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1953172_1953448_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1953480_1953600_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1953592_1956040_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1956054_1956534_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1956533_1957697_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1957778_1957997_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1958270_1959632_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1958099:1958126	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1959779_1960112_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1960302_1961025_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1961021_1962425_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	2045649	2188814	5530739	portal,protease,transposase,capsid,tail,terminase,integrase,holin,head,lysis	Stx2-converting_phage(47.33%)	168	2042267:2042281	2146456:2146470
2042267:2042281	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007947.1|2045649_2046828_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|2046808_2047000_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2047081_2047426_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2047613_2047964_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2047960_2048317_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|2048830_2049778_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|2049774_2049996_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|2050094_2050376_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|2050386_2050578_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|2050550_2050733_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|2050729_2051410_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000100845.1|2051406_2052192_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995487.1|2052197_2052494_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2052568_2052712_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2052680_2052845_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2052917_2053286_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2053468_2053720_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2053778_2054051_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2054028_2054211_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2054779_2055301_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_162829202.1|2055482_2056695_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302016.1|2057115_2057811_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2057886_2058102_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2058243_2058540_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2058572_2058734_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2058720_2059542_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2059538_2060915_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2060985_2061264_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2061396_2061612_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_042819913.1|2061622_2061859_+	restriction alleviation protein, Lar family	NA	A0A0P0ZEB1	Stx2-converting_phage	100.0	1.6e-39
WP_097331918.1|2061815_2062262_+	recombination protein NinB	NA	A0A0P0ZEG6	Stx2-converting_phage	100.0	1.4e-81
WP_000153280.1|2062258_2062786_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254258.1|2062782_2062977_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_001502690.1|2063233_2063908_+	phage antirepressor Ant	NA	A0A0P0ZD80	Stx2-converting_phage	100.0	4.7e-129
WP_000924600.1|2063982_2064384_+	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_001563210.1|2064343_2064553_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_001292290.1|2064545_2065268_+	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_001108022.1|2065267_2065873_+	recombination protein NinG	NA	G9L693	Escherichia_phage	100.0	8.6e-98
WP_000144764.1|2065869_2066064_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|2066056_2066491_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649751.1|2067273_2068233_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2068244_2068514_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2068810_2069134_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|2069377_2071315_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2071452_2071632_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2071672_2071945_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2072021_2072237_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2072236_2072734_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2072730_2073168_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2073370_2073868_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2073864_2074122_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2074584_2074812_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2074853_2075219_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2075511_2076075_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001457603.1|2076071_2077733_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_171878371.1|2077796_2079734_+|capsid	phage major capsid protein	capsid	A0A0P0ZE40	Stx2-converting_phage	100.0	0.0e+00
WP_001063023.1|2079778_2080000_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|2082526_2082853_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2082862_2083213_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2083209_2083656_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2083652_2083997_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2084055_2084772_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2084777_2085152_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2085247_2085457_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2085509_2088752_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2088744_2089086_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2089085_2089784_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2089800_2090121_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2090228_2090402_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2090472_2091396_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_171878373.1|2091450_2092188_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	100.0	3.1e-150
WP_171878402.1|2092133_2092766_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.5	2.4e-106
WP_171878374.1|2093004_2096487_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	100.0	0.0e+00
WP_001230459.1|2096553_2097153_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878375.1|2097217_2098531_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	100.0	4.3e-86
WP_001023352.1|2098532_2098802_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000491542.1|2098941_2099817_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2100041_2100692_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2102016_2103183_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2103301_2103775_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2103973_2105032_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2105203_2105533_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2105633_2105816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2106304_2106418_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2106430_2106625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2107083_2107452_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2107525_2107747_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2107809_2108286_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2108300_2108780_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2108861_2109683_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2109903_2110314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001502562.1|2110329_2111013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2111148_2112219_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2112215_2113121_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2113117_2113999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2113982_2115196_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2115567_2117715_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2119162_2120701_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2120750_2121098_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2121094_2121475_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2121836_2122382_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2122378_2123122_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2123133_2124213_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2124274_2125210_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2125666_2126584_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2126685_2127636_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2127753_2129397_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2130022_2130739_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_097209405.1|2131081_2132536_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2132637_2133954_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2134267_2135320_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2135581_2143564_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2144053_2144851_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2145086_2146109_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2146108_2146312_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2146370_2148842_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2146456:2146470	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2148937_2149126_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2149122_2149311_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2149791_2149944_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2150218_2150863_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2150960_2151188_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2151184_2151610_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2151678_2152716_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2152627_2153170_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2153204_2153903_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2153924_2154149_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2154145_2154502_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2154534_2154687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2154683_2154995_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2155121_2155685_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2155794_2155899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2156085_2156298_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2156465_2156744_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2156745_2157795_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2157807_2158167_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2158163_2158853_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2160392_2162243_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2162324_2163538_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2163849_2164065_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2164069_2164414_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2164464_2164998_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2165153_2165336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2165348_2165480_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2165707_2165893_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2166419_2166734_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2166815_2167040_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235421.1|2167434_2167710_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|2167785_2168166_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2168162_2168510_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2168559_2170098_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_171879500.1|2170325_2170646_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	63.6	1.4e-25
WP_000259002.1|2172260_2172467_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_097209410.1|2172463_2174056_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	3.3e-181
WP_001254002.1|2174045_2175551_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2175587_2175935_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2175992_2176259_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2176240_2176981_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2176994_2177426_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2177452_2177866_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151589304.1|2177846_2180426_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847298.1|2180422_2180752_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2180751_2181450_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|2181460_2182204_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|2182149_2182779_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_171879498.1|2183019_2186499_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_001230459.1|2186565_2187165_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878378.1|2187229_2188543_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001023407.1|2188544_2188814_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	2246332	2266318	5530739	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	2259454:2259467	2269460:2269473
WP_032161583.1|2246332_2247469_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2247419_2247743_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2247900_2249085_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2249084_2249597_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2249651_2250017_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2250025_2250181_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2252983_2253472_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2253628_2254201_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2254244_2254775_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2255866_2256181_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2256185_2257145_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2257221_2260044_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2259454:2259467	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2260050_2260416_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2260412_2261030_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2261041_2261341_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2261337_2261604_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2261600_2261804_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2261827_2262244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2262336_2262450_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2262446_2262689_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2262700_2262979_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2262989_2263340_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2263361_2263565_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2263636_2263774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2263863_2264268_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2264283_2264934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2264963_2265311_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2265316_2266318_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2269460:2269473	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	2585575	2646584	5530739	protease,capsid,tail,terminase,holin,head	Stx2-converting_phage(40.43%)	70	NA	NA
WP_001260835.1|2585575_2586397_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2586496_2586580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2586672_2587008_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2587404_2588658_-	MFS transporter	NA	NA	NA	NA	NA
WP_001502517.1|2588764_2589658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2589792_2591013_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2591137_2591833_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2591785_2593078_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2593235_2593850_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2593892_2594747_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2594748_2595366_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2595376_2597800_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2597860_2600287_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2600485_2600791_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2600898_2601609_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2601611_2602172_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2602206_2602548_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2602682_2603009_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2603997_2604249_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2604321_2606793_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2606885_2607077_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2607073_2607262_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2607662_2607827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2607830_2608049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2608120_2608420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2608772_2609051_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2609052_2609244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2609264_2609636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2609733_2610036_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2610032_2610458_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2610480_2611443_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2611449_2612190_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2613000_2613396_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2613452_2614037_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2614152_2614257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2614445_2614658_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2614825_2615104_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2615105_2616155_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2616167_2616527_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2616523_2617213_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2617850_2618279_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_021497626.1|2618757_2620608_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_029785460.1|2621042_2621258_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|2621262_2621607_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992137.1|2621657_2622191_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2622461_2623031_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2623030_2623177_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2623404_2623590_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2624014_2624242_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2624283_2624649_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2624938_2625502_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2625498_2627160_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2627223_2629161_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2629205_2629427_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|2631954_2632281_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2632290_2632641_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573364.1|2632637_2633084_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.8e-76
WP_000133372.1|2633080_2633425_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275508.1|2633490_2634207_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2634212_2634587_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|2634682_2634892_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_171879502.1|2634939_2638182_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2638174_2638516_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_059214312.1|2638515_2639214_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_072616989.1|2639224_2639968_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.1	3.0e-145
WP_140439088.1|2639913_2640546_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_171878386.1|2640794_2644268_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230471.1|2644335_2644935_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_171878387.1|2644999_2646313_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	1.1e-76
WP_001023356.1|2646314_2646584_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
>prophage 8
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	2830328	2888069	5530739	portal,protease,capsid,tail,terminase,integrase,tRNA,holin,head,lysis	Enterobacteria_phage(43.86%)	74	2836986:2837001	2891629:2891644
WP_000214712.1|2830328_2830532_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2830567_2832028_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2832116_2833400_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2833531_2833774_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2833935_2834577_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2834658_2835288_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2835360_2835936_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2836049_2836319_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_171879504.1|2836320_2837634_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
2836986:2837001	attL	TCGTTGCATCCCTGGC	NA	NA	NA	NA
WP_001230459.1|2837698_2838298_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878389.1|2838364_2841748_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
WP_064562156.1|2841988_2842618_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_054191786.1|2842563_2843307_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_072617001.1|2843317_2844016_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|2844015_2844345_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_151589247.1|2844341_2846987_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|2847030_2847339_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_001502385.1|2847365_2847788_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	9.7e-72
WP_000235090.1|2847801_2848554_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2848561_2848957_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2848953_2849487_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2849501_2849855_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2849866_2850265_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2850306_2851332_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2851387_2851720_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2851729_2853049_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2853029_2854631_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2854627_2854834_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024251565.1|2854830_2856756_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|2856730_2857276_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|2857664_2857859_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2858023_2858230_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2858515_2858926_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2859217_2859511_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|2859601_2859784_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|2860000_2860477_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|2860463_2860769_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|2861090_2861780_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|2861776_2861917_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|2861913_2862276_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|2862272_2862563_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2862555_2862726_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|2862725_2863181_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|2863682_2865209_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|2865266_2865389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|2865453_2865786_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2865853_2866156_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_171878380.1|2866152_2866854_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	8.4e-129
WP_000088655.1|2867778_2868015_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|2868004_2869147_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|2869260_2870511_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|2870682_2871336_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2871345_2871807_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|2871860_2872967_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|2873002_2873644_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2873647_2875018_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|2875186_2875858_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|2875857_2877318_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|2877933_2878215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001502340.1|2878228_2879890_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	4.9e-276
WP_000113645.1|2879873_2880230_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|2880352_2880535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145906.1|2880518_2880959_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000134114.1|2880958_2881255_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001020669.1|2881251_2881590_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000267608.1|2881586_2882798_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504047.1|2882799_2883372_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001137338.1|2883411_2884569_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_001132080.1|2884860_2885085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233311.1|2885210_2885483_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126670.1|2885495_2885906_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001294169.1|2885915_2886221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080642.1|2886217_2886469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833614.1|2886671_2888069_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
2891629:2891644	attR	TCGTTGCATCCCTGGC	NA	NA	NA	NA
>prophage 9
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	2891502	2958032	5530739	capsid,tail,terminase,integrase,tRNA,holin,head	Stx2-converting_phage(32.79%)	76	2887383:2887399	2936122:2936138
2887383:2887399	attL	ATTTTTCACCTGCTCAC	NA	NA	NA	NA
WP_000085269.1|2891502_2892732_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_001301987.1|2892980_2894102_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2894150_2895377_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2895626_2896763_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|2896746_2897610_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|2897973_2899335_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|2899395_2899671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|2901979_2905381_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|2905971_2908320_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2908339_2908429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|2908441_2908678_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967274.1|2908623_2909361_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_000835336.1|2909414_2910293_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|2910595_2910706_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|2910815_2911070_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|2911086_2911785_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|2911784_2912126_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2912118_2915361_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2915408_2915618_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2915713_2916088_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_021569169.1|2916102_2916819_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	99.2	1.0e-126
WP_000133388.1|2916877_2917222_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2917218_2917665_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2917661_2918012_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2918022_2918349_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2920875_2921097_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|2921141_2923079_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_171878384.1|2923142_2924804_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2924800_2925364_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|2925654_2926020_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000074667.1|2926061_2926289_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|2926713_2926899_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2927126_2927273_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_171878383.1|2927272_2927827_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.8	2.5e-99
WP_000992168.1|2928097_2928631_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_000731236.1|2928681_2929026_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_029785460.1|2929030_2929246_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_171879505.1|2929680_2931531_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000466957.1|2932101_2932533_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_024175525.1|2932711_2932933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735807.1|2932985_2933210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001502553.1|2933695_2934238_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.1e-75
WP_000228020.1|2934234_2934525_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_001502554.1|2934524_2935124_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000687443.1|2935183_2935357_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_000818161.1|2935557_2936043_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|2936061_2936241_-	hypothetical protein	NA	NA	NA	NA	NA
2936122:2936138	attR	ATTTTTCACCTGCTCAC	NA	NA	NA	NA
WP_024175526.1|2936451_2936664_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	4.0e-26
WP_001278450.1|2936852_2936957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072616987.1|2937072_2937735_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	54.5	9.5e-74
WP_001365170.1|2938248_2939133_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	81.6	9.6e-138
WP_000172332.1|2939129_2939615_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	5.7e-68
WP_001502613.1|2939611_2940340_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	54.8	4.3e-51
WP_072616986.1|2940326_2941079_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.6	1.8e-76
WP_097209397.1|2941100_2941847_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	8.1e-114
WP_001428773.1|2941853_2942642_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_024231359.1|2942719_2943142_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.7e-68
WP_001053423.1|2943125_2943401_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	3.4e-41
WP_000753628.1|2943508_2943970_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_001502432.1|2944367_2944523_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.0e-08
WP_001502431.1|2944524_2944887_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	77.5	1.7e-08
WP_001502430.1|2944876_2945056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097209398.1|2945468_2946320_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	66.0	1.8e-64
WP_000560228.1|2946366_2946588_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_065336296.1|2946587_2946758_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_001502427.1|2946831_2947107_+	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	5.2e-42
WP_001502426.1|2947208_2949809_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	5.1e-248
WP_001502425.1|2949801_2950611_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_001302840.1|2950854_2951043_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079602.1|2951142_2951358_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	2.3e-37
WP_001358842.1|2951359_2952595_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_001502424.1|2952646_2953582_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	7.7e-146
WP_000123746.1|2953710_2955084_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2955116_2955287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2955561_2956545_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2956799_2958032_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	3041673	3117203	5530739	protease,transposase,capsid,tail,terminase,integrase,holin,head	Stx2-converting_phage(39.29%)	84	3057175:3057202	3117340:3117367
WP_000422055.1|3041673_3042723_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3042942_3043701_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3043697_3044288_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3044327_3045200_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3045412_3046996_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3047023_3047644_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3047640_3048522_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3048659_3048704_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3048795_3050358_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3050357_3051953_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|3051953_3053315_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|3053326_3054520_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3054519_3055326_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3055706_3055886_+	general stress protein	NA	NA	NA	NA	NA
WP_001056499.1|3055971_3056472_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3056517_3057024_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3057175:3057202	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|3058337_3058988_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3060494_3061085_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3061268_3061916_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3062052_3062199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3062626_3062905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3063244_3063625_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3063621_3063969_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3064014_3065553_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3066518_3067088_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3067153_3068065_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3068171_3068294_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3069891_3071217_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3072243_3072513_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3072514_3073828_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3073979_3074579_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3074646_3076992_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3076943_3078119_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3078461_3079094_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3079039_3079783_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_059214312.1|3079793_3080492_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000807954.1|3080491_3080833_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878385.1|3080825_3084068_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.1	0.0e+00
WP_001513217.1|3084115_3084325_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|3084420_3084795_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3084800_3085517_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133372.1|3085582_3085927_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573364.1|3085923_3086370_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.8e-76
WP_001007905.1|3086366_3086717_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3086727_3087054_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3089580_3089802_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|3089846_3091784_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_171878391.1|3091847_3093509_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958416.1|3093505_3094069_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3094358_3094724_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3094765_3094993_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3095417_3095603_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3095830_3095977_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3095976_3096546_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3096816_3097350_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3097400_3097745_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3097749_3097965_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|3098114_3099968_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935548.1|3100764_3101823_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3101973_3102171_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3102412_3102943_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3102951_3103311_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3103323_3104370_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3104371_3104650_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3104719_3104977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3105197_3105410_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3105688_3106447_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3107145_3107310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3107306_3107888_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3108074_3108617_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3108528_3109569_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3109540_3110092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3110075_3110303_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3110379_3110787_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3111051_3111351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3111423_3111642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3111664_3112072_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3112049_3112283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3112276_3112444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3112841_3113030_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3113026_3113218_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3113310_3115782_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3115846_3116095_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3116072_3117203_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3117340:3117367	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 11
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	3164077	3315812	5530739	portal,protease,transposase,capsid,tail,terminase,integrase,tRNA,holin,head	Escherichia_phage(30.43%)	170	3301379:3301399	3322469:3322489
WP_001299679.1|3164077_3165334_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3165547_3166171_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3166170_3167022_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3167172_3168120_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3168244_3169924_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3169978_3170257_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3170534_3171119_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3171235_3172327_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3173170_3176056_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3176155_3178075_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3178302_3179373_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3179383_3180016_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3180026_3181445_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3183476_3183677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3183784_3184807_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3184806_3185787_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3185783_3186542_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3187360_3188215_+	ModD protein	NA	NA	NA	NA	NA
WP_001502371.1|3188240_3190211_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3190260_3190515_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171878392.1|3191363_3192576_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	1.6e-167
WP_001295616.1|3192764_3193376_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3193475_3194390_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3194485_3196222_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3197634_3198705_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3198714_3200013_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3200375_3201908_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3201959_3202679_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3202900_3204442_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3204587_3205118_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3205163_3206432_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3206431_3206851_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3207223_3208135_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3208341_3208803_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3208879_3209539_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3209610_3209904_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3209915_3210074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3210144_3210546_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3210648_3211017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3211536_3212232_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3212255_3213068_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3213071_3213338_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3214576_3215161_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3215659_3216613_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3216799_3218284_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3218586_3220125_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3220170_3220518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3220514_3220895_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3220970_3221219_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3221275_3221944_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3222441_3222624_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3222702_3223203_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3223239_3223746_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3223764_3224655_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3224774_3225356_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_001301660.1|3225355_3226906_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	57.2	4.3e-40
WP_071536264.1|3226866_3226962_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_162829202.1|3227022_3228235_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001230336.1|3229648_3230248_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3230314_3233713_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3233773_3234406_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3234342_3235086_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3235091_3235790_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3235789_3236119_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3236115_3238665_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3238657_3239092_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3239073_3239496_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3239511_3240252_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3240259_3240655_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000752995.1|3241240_3241594_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3241605_3242004_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3242045_3243071_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3243126_3243459_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3243468_3244788_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3244768_3246370_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3246366_3246573_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|3246569_3248495_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3248469_3249015_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3249401_3249626_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3249707_3250022_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3250547_3250733_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3250955_3251102_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3251101_3251671_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3251941_3252475_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3252525_3252870_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|3252874_3253090_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|3253528_3255379_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3255856_3256288_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3256738_3257452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3257587_3257785_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3258009_3258564_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3258626_3258932_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3258944_3259994_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3259995_3260268_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3260389_3260734_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3260853_3261066_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3261299_3261857_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3261858_3262077_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3262204_3262516_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3262508_3262736_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3262732_3263014_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3263046_3263763_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3263796_3264258_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_162829202.1|3264773_3265986_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001120551.1|3266274_3266517_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3267479_3267860_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612606.1|3267856_3268204_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_000998048.1|3268249_3269788_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3270370_3271021_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_122994186.1|3271730_3272306_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	1.6e-56
WP_001023362.1|3272419_3272689_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_071805583.1|3272690_3273914_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001230508.1|3273978_3274578_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000514789.1|3274645_3278122_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.4	0.0e+00
WP_001179509.1|3278309_3278747_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|3278746_3279088_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878393.1|3279080_3282323_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|3282370_3282580_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3282675_3283050_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3283064_3283781_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3283846_3284191_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3284187_3284634_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3284630_3284981_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3284990_3285317_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171878394.1|3285396_3287898_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_001063099.1|3287843_3288065_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3288109_3290047_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3290110_3291772_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3291768_3292332_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3292623_3292989_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3293030_3293216_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3293345_3293486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3293842_3294067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3294131_3294338_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3294565_3294712_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3294711_3295281_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3295551_3296085_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3296135_3296480_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3296484_3296700_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3296775_3297045_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3297082_3297265_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3297412_3299350_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3299664_3299832_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3300428_3301250_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3301246_3301621_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3301379:3301399	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3301633_3302683_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3302684_3302963_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3303130_3303343_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3303531_3303636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3303751_3304339_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3304341_3304533_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3304534_3304972_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3304958_3305276_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3305229_3305547_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3305536_3305839_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3305835_3306117_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3306149_3306866_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3306899_3307442_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001457513.1|3307353_3308391_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3308459_3308885_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3308868_3309192_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3309316_3309793_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3310108_3310261_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3310375_3310891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3311023_3311413_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3311474_3311744_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3311712_3312831_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3312997_3313792_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3313788_3314835_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3314990_3315812_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3322469:3322489	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	3572174	3625058	5530739	portal,protease,transposase,capsid,tail,terminase,integrase,holin,head	Escherichia_phage(26.83%)	59	3574109:3574124	3626823:3626838
WP_000003653.1|3572174_3572762_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3572758_3573466_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3573484_3575278_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3574109:3574124	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3575274_3576393_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3578384_3578654_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_171878395.1|3578655_3579969_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.5	1.1e-84
WP_001230508.1|3580033_3580633_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171879509.1|3580700_3584174_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649829.1|3584307_3584835_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3585025_3585658_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3585603_3586347_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3586357_3587056_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3587055_3587385_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_171878397.1|3587381_3589961_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.9	0.0e+00
WP_000533402.1|3589941_3590355_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3590381_3590813_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3590826_3591567_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3591548_3591815_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3591872_3592220_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3592256_3593762_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3593751_3595344_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3595340_3595547_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001442367.1|3597161_3597446_-|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	63.6	1.6e-25
WP_000235436.1|3597417_3597927_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000411791.1|3598677_3598884_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3599139_3599412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3599571_3600105_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3600325_3600439_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3600660_3600846_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3601373_3601688_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3601892_3603106_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3603281_3605132_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3605899_3606613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3607233_3608052_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3608203_3608575_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3608564_3608936_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3608948_3609998_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3609999_3610278_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3610445_3610601_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3610702_3610840_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001151233.1|3612329_3612743_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3612758_3613529_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3613550_3614297_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_072143748.1|3614303_3615395_-	DNA-binding protein	NA	V5URT9	Shigella_phage	71.1	2.5e-135
WP_000273724.1|3615473_3615929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3616135_3616561_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032362955.1|3616544_3616817_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_000986592.1|3616925_3617327_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3617354_3617546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3617545_3617833_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3618110_3618266_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3618407_3618797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3618983_3619169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3619742_3619931_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3619927_3620119_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171879510.1|3620212_3622684_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3622751_3622994_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3622971_3623991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001502226.1|3624398_3625058_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	2.4e-48
3626823:3626838	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	3732278	3743419	5530739	integrase,terminase,capsid	uncultured_Caudovirales_phage(25.0%)	17	3733490:3733504	3744838:3744852
WP_000562896.1|3732278_3733202_-|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000006076.1|3733191_3733353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|3733364_3733853_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
3733490:3733504	attL	GCTTAAACGCGGCAT	NA	NA	NA	NA
WP_001018605.1|3733981_3734143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|3734146_3734341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164427.1|3734471_3734717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761784.1|3735068_3736817_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
WP_000770151.1|3736813_3737113_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_098030807.1|3737118_3737361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098030806.1|3737350_3737542_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	54.2	3.6e-10
WP_098030805.1|3737541_3737727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098030804.1|3737719_3738451_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001075375.1|3738461_3738686_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	62.7	2.1e-17
WP_000775337.1|3738777_3739551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098030803.1|3739547_3740771_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.9	1.6e-127
WP_000410785.1|3741175_3741400_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3741472_3743419_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3744838:3744852	attR	ATGCCGCGTTTAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	3865544	3903402	5530739	portal,protease,tail,terminase,integrase,holin,lysis	Enterobacteria_phage(50.0%)	49	3865129:3865143	3903476:3903490
3865129:3865143	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3865544_3866243_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3866473_3867355_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3867523_3867685_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3868181_3869201_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3869234_3870215_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3870391_3870661_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_001233141.1|3871800_3872400_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_148905702.1|3872470_3875884_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090841.1|3875944_3876553_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3876489_3877233_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3877238_3877937_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3877946_3878276_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3878275_3881341_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3881312_3881642_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3881650_3882037_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3882097_3882841_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3882851_3883253_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3883249_3883828_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3883839_3884115_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3884107_3884431_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3884517_3886545_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3886489_3886825_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3886946_3888071_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3887998_3888211_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3888207_3890310_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3890309_3890801_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3891475_3891628_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3891615_3892083_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3892079_3892577_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3892576_3892792_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3892934_3893333_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3893413_3893572_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3893657_3894401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3894584_3895274_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3895288_3895411_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3895748_3896708_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3896919_3897585_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3897581_3898202_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3898194_3898365_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3898361_3898544_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3899241_3899922_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3899918_3900101_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3900073_3900265_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3900275_3900557_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3900655_3900877_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3901087_3901690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3901932_3902100_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3902139_3902358_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3902631_3903402_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3903476:3903490	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	4474390	4520526	5530739	integrase,transposase,plate	uncultured_Caudovirales_phage(30.0%)	41	4473961:4473975	4499610:4499624
4473961:4473975	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4474390_4475572_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000893282.1|4475924_4477178_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4477189_4478293_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4478580_4479636_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4479674_4480076_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4480133_4481378_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4481469_4481928_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4482188_4483646_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4483702_4484260_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4484171_4484438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4484744_4485197_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4485206_4485605_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4485607_4485901_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4485952_4487008_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4487078_4487864_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4487808_4489548_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4490365_4491139_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4491324_4491585_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4491603_4491864_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4492019_4492760_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4492730_4493498_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4493602_4494181_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4494420_4496865_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4496907_4497381_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4497534_4498305_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4498422_4499595_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4499675_4499861_+	protein YncO	NA	NA	NA	NA	NA
4499610:4499624	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4499775_4500039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4500240_4502001_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4502003_4503140_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356493.1|4503885_4504431_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4504499_4506008_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_136720823.1|4507046_4511279_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4511354_4513496_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4513705_4514224_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4514920_4515421_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4515455_4515680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097209396.1|4515730_4517122_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4517212_4517626_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4517629_4519480_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4519443_4520526_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 16
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	4961981	5021009	5530739	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4961981_4963334_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4963427_4963979_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4964134_4965508_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4965683_4966682_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4966714_4967710_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001502142.1|4967696_4968719_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4968732_4970235_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4970374_4971331_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4971640_4972171_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4972250_4972601_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4972594_4972846_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4973057_4973399_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4973401_4977181_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4977177_4978911_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4979116_4979755_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4980077_4981421_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4981516_4981723_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4982047_4982602_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4982664_4983603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4983814_4984555_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4984744_4986688_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4986805_4987186_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4987274_4988135_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4988242_4989208_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4989315_4989978_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4990022_4991435_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4991743_4992364_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4992581_4993220_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4993354_4994563_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4994570_4995002_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4995624_4996419_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4996489_4996939_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4996980_4997208_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4997212_4997527_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4997533_4997929_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4998255_4998531_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4998659_4999346_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4999345_5000200_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5000209_5000860_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5000873_5001338_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5001347_5001653_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5001668_5003066_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5004592_5005348_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5005344_5006094_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5006275_5006605_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5006753_5007029_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5007145_5008771_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5008854_5010018_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5010020_5010659_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5010668_5011067_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5011084_5011744_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5011794_5012493_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5012511_5012913_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5013039_5013771_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5013951_5016393_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5016431_5016857_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5017061_5018360_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5018463_5018661_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5018742_5019747_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5019749_5021009_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038369	Escherichia coli O157:H7 strain F6321 chromosome, complete genome	5530739	5157889	5172554	5530739	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	18	5153730:5153745	5171259:5171274
5153730:5153745	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5157889_5159305_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5160536_5160779_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5160912_5161950_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5162038_5163136_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5163197_5163446_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5163606_5164248_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5164329_5164959_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5165031_5165604_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5165715_5165985_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5165986_5167300_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5167364_5167964_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5169285_5169822_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5169812_5170163_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5170159_5170444_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5170779_5170977_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5171321_5171603_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5171259:5171274	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5171650_5171824_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5172020_5172554_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
