The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	1235719	1262011	5516005	tail,holin,transposase,integrase	Enterobacteria_phage(31.25%)	29	1229977:1229991	1262882:1262896
1229977:1229991	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_162829202.1|1235719_1236933_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000800629.1|1238165_1239017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1239116_1239323_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1239645_1240851_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1240852_1242166_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1242162_1243794_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1243794_1244193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1244290_1244704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171878244.1|1245099_1246536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1246611_1246947_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1246949_1247705_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1248034_1248601_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1248575_1249187_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1249183_1249849_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1249845_1250469_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1250721_1251465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1251550_1251718_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1252125_1253979_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1254128_1254344_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1254348_1254693_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1255049_1255430_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1255426_1255774_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1256391_1256661_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1256821_1257244_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1257372_1258431_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1258509_1259160_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1259342_1259933_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1260434_1260683_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1261528_1262011_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1262882:1262896	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	1539359	1603452	5516005	holin,capsid,tail,portal,lysis,transposase,integrase	Escherichia_phage(61.33%)	76	1543754:1543777	1603575:1603598
WP_000950857.1|1539359_1539929_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1539928_1540396_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1540382_1541063_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1541072_1542209_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1542383_1543541_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1543754:1543777	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1543972_1545142_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1545125_1545308_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1545368_1545620_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1545607_1545841_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_032210541.1|1545984_1546365_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	99.2	2.6e-52
WP_001291842.1|1546400_1546613_-	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000163446.1|1546572_1547199_-	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_000809302.1|1547195_1547627_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000203835.1|1547682_1548321_-	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	100.0	5.5e-119
WP_000628764.1|1548676_1549573_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	100.0	1.2e-172
WP_001289954.1|1550086_1551034_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1551030_1551252_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1551350_1551632_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1551642_1551834_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1551806_1551989_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000187067.1|1551985_1552666_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.1	1.8e-131
WP_000459721.1|1552662_1553613_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1553629_1553911_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|1553931_1554213_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|1554224_1554437_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_001369605.1|1554507_1555182_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|1555437_1556223_-	Rha family phage regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|1556839_1557793_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1557789_1559259_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1559353_1560067_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1560162_1560366_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|1560536_1560731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1560897_1561275_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|1561268_1562789_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|1562778_1563750_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|1563749_1564199_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1564206_1564770_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1564766_1564961_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1564953_1565388_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|1565636_1565789_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1566171_1567131_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1567142_1567412_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_171878245.1|1567897_1569835_+	DUF1737 domain-containing protein	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
WP_000143458.1|1569971_1570151_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1570191_1570464_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1570540_1570756_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1570760_1571294_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1571608_1572151_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1572150_1572300_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082653.1|1572307_1572772_+|lysis	lysis protein	lysis	A0A1U9AJA1	Stx1_converting_phage	100.0	4.5e-78
WP_000738505.1|1572803_1573097_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1573246_1573450_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086076.1|1573505_1574312_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1574292_1575999_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1575998_1578143_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1578300_1579308_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1579331_1580546_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1580601_1580991_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1581040_1581502_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1581485_1582049_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1582048_1582699_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_064234923.1|1582695_1584591_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1584592_1584862_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1585003_1585192_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1585486_1587112_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1587108_1588377_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1588391_1588670_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1588675_1589293_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1589383_1590118_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1590350_1590491_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1590547_1590949_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1591042_1591699_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1591701_1592148_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1592157_1592409_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_162829202.1|1592936_1594149_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000331678.1|1595067_1603452_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
1603575:1603598	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	1849013	1954398	5516005	holin,protease,tail,portal,tRNA,terminase,integrase	Enterobacteria_phage(49.38%)	118	1931589:1931603	1956461:1956475
WP_000569336.1|1849013_1849940_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1849944_1850676_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1850656_1850764_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1850823_1851525_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1851545_1852832_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1852865_1853120_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1853138_1853273_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1853276_1853519_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1853606_1853969_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1853965_1854322_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1854655_1854832_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1854833_1855781_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1855777_1855999_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1856097_1856379_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1856389_1856581_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1856553_1856736_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1856735_1857413_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1857409_1858195_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1858200_1858497_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1858572_1858863_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1859366_1860974_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1861080_1861773_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1862136_1862676_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1862672_1863692_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1863688_1864390_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1864386_1864671_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1864898_1865096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1865139_1865421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1865511_1865613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1865609_1866065_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1866064_1866235_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774507.1|1866227_1866518_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_001099712.1|1866514_1866877_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1866873_1867014_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1867099_1867534_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1867782_1867935_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1868738_1870685_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1870822_1871002_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1871042_1871288_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1871365_1871581_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001056806.1|1872387_1872957_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1872956_1873103_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1873330_1873516_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1874033_1874510_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1874506_1876630_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1876626_1876839_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1876838_1878341_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1878285_1880310_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1880397_1880724_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1880716_1880998_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1881000_1881624_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1881636_1882035_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1882042_1882795_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1882808_1883231_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1883257_1883566_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_053905572.1|1883609_1886255_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000847298.1|1886251_1886581_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|1886580_1887279_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|1887289_1888033_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|1887978_1888608_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_072616999.1|1888848_1892328_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.3	0.0e+00
WP_001230508.1|1892395_1892995_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878246.1|1893059_1894229_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	97.4	1.2e-84
WP_001023396.1|1894230_1894500_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1894660_1895077_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1895158_1895800_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1895961_1896210_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1896724_1898410_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1898406_1899126_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1899172_1899643_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1899684_1900146_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1900270_1902274_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1902270_1903407_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1903399_1904131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1904149_1905679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1905689_1906778_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1908018_1908336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1908397_1912027_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001457618.1|1918984_1921018_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_001005448.1|1921149_1922259_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1922520_1922802_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1923093_1923636_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1923723_1924398_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1924413_1926894_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1926904_1927939_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1928020_1928359_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134627.1|1928576_1929434_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1929554_1929827_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1929936_1930251_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1930260_1930608_-	hypothetical protein	NA	NA	NA	NA	NA
1931589:1931603	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1931658_1931898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1932231_1933020_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1933016_1933817_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1933881_1934700_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1934751_1935498_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1935471_1936437_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1936433_1937438_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1937434_1938712_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1938968_1940021_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1940319_1941174_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1941202_1942465_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1942474_1942927_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1942957_1943242_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1943245_1944601_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1944648_1945689_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1945788_1946568_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1946649_1947549_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1947954_1948272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1948536_1949550_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1949665_1949965_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1950086_1950362_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1950372_1950543_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217673.1|1950539_1951040_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1951103_1951328_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1951327_1951627_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1951629_1951854_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1951850_1952126_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1952115_1954398_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1956461:1956475	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	1958494	1984734	5516005	holin,tail,capsid,portal,tRNA,lysis,terminase,head,plate	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1958494_1959529_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156836.1|1959528_1961301_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.5	0.0e+00
WP_001085951.1|1961474_1962329_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.9	4.3e-135
WP_001248594.1|1962387_1963461_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1963464_1964208_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1964307_1964817_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1964816_1965020_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1965023_1965305_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1965304_1965802_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1965816_1966242_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1966229_1966655_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1966626_1966800_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1966762_1967230_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1967222_1967675_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_171878247.1|1967741_1968377_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.1e-111
WP_000127153.1|1968373_1968739_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	90.1	1.9e-52
WP_001121479.1|1968743_1969652_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1969644_1970256_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1970252_1971572_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1971571_1972174_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1972145_1972589_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1972609_1973020_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1973050_1973644_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1973703_1974894_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1974906_1975425_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1975481_1975757_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1975789_1975909_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1975901_1978349_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1978363_1978843_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1978842_1980006_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1980087_1980306_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1980579_1981941_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|1982088_1982421_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1982611_1983334_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1983330_1984734_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	2067958	2204649	5516005	holin,protease,capsid,tail,portal,lysis,transposase,terminase,head,integrase	Stx2-converting_phage(42.06%)	162	2064576:2064590	2166093:2166107
2064576:2064590	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_171878248.1|2067958_2068921_+|integrase	integrase family protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	4.6e-186
WP_162829202.1|2068960_2070174_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132739.1|2070430_2070622_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2070703_2071048_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2071235_2071586_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|2071582_2071939_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_001289954.1|2072452_2073400_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|2073396_2073618_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|2073716_2073998_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|2074008_2074200_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|2074172_2074355_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_171878249.1|2074351_2075032_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	99.1	1.3e-131
WP_000100845.1|2075028_2075814_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995487.1|2075819_2076116_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2076190_2076334_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2076302_2076467_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2076539_2076908_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2077090_2077342_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2077400_2077673_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2077650_2077833_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2078401_2078923_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2079424_2080120_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2080195_2080411_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2080552_2080849_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2080881_2081043_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2081029_2081851_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2081847_2083224_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2083294_2083573_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2083705_2083921_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2083931_2084168_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2084124_2084571_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2084567_2085095_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2085091_2085274_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|2085548_2086307_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_000849633.1|2086562_2087243_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2087317_2088040_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2088039_2088645_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2088641_2089313_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2089303_2089792_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2090441_2091401_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2091412_2091682_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2091978_2092302_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_171878250.1|2092545_2094483_+	DUF1737 domain-containing protein	NA	A0A0P0ZDW4	Stx2-converting_phage	99.5	0.0e+00
WP_000143458.1|2094620_2094800_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2094840_2095113_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2095189_2095405_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2095404_2095902_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2095898_2096336_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2096538_2097036_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2097032_2097290_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2097752_2097980_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2098021_2098387_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958365.1|2098678_2099242_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_001457603.1|2099238_2100900_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_001502569.1|2100963_2102901_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.1	0.0e+00
WP_001063023.1|2102945_2103167_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|2105531_2105858_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2105867_2106218_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2106214_2106661_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2106657_2107002_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2107060_2107777_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2107782_2108157_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2108252_2108462_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171878251.1|2108514_2111757_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_000807954.1|2111749_2112091_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2112090_2112789_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2112805_2113126_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2113233_2113407_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2113477_2114401_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001457600.1|2114455_2115193_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.6	9.1e-150
WP_143366697.1|2115138_2115771_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	1.5e-105
WP_151547373.1|2116008_2119491_+	DUF1983 domain-containing protein	NA	A0A0P0ZDT4	Stx2-converting_phage	99.5	0.0e+00
WP_001230459.1|2119557_2120157_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878252.1|2120221_2121490_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	89.1	8.5e-71
WP_001023452.1|2121491_2121761_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2121901_2122777_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2123001_2123652_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2124975_2126142_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2126260_2126734_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2126932_2127991_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2128162_2128492_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2128592_2128775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2129263_2129377_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2129389_2129584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2130042_2130411_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2130484_2130706_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2130768_2131245_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2131259_2131739_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2131820_2132642_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2132862_2133273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2133288_2133972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2134107_2135178_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2135174_2136080_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2136076_2136874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2138799_2140338_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2140387_2140735_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2140731_2141112_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2141473_2142019_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2142015_2142759_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2142770_2143850_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2143911_2144847_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2145303_2146221_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2146322_2147273_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2147390_2149034_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2149659_2150376_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2150718_2152173_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2152274_2153591_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2153904_2154957_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_148713421.1|2155218_2163201_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001302302.1|2163690_2164488_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2164723_2165746_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2165745_2165949_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2166007_2168479_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2166093:2166107	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2168574_2168763_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2168759_2168948_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2169428_2169581_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2169855_2170500_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2170597_2170825_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2170821_2171247_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_137049448.1|2171315_2172359_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	82.8	7.7e-86
WP_072143023.1|2172270_2172813_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2172847_2173546_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2173567_2173792_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2173788_2174145_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2174177_2174330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2174326_2174638_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2174764_2175328_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2175437_2175542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2175728_2175941_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2176108_2176387_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2176388_2177438_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2177450_2177810_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2177806_2178496_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2180035_2181886_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_024165672.1|2182175_2182391_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2182395_2182740_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2182790_2183324_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2183479_2183662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2183674_2183806_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2184033_2184219_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2184745_2185060_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2185141_2185366_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2185760_2186270_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001442367.1|2186241_2186526_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	63.6	1.6e-25
WP_000259002.1|2188140_2188347_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2188343_2189936_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2189925_2191431_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2191467_2191815_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2191872_2192139_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2192120_2192861_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2192874_2193306_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2193332_2193746_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2193726_2195589_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_134790849.1|2195540_2196305_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|2196301_2196631_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_171878253.1|2196630_2197329_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.4e-128
WP_171878254.1|2197339_2198083_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.8e-146
WP_064562156.1|2198028_2198658_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_072616999.1|2198898_2202378_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.3	0.0e+00
WP_001230508.1|2202445_2203045_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878255.1|2203109_2204378_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	93.8	6.7e-76
WP_001023452.1|2204379_2204649_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
>prophage 6
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	2262166	2283465	5516005	integrase,transposase,tail	Enterobacteria_phage(72.0%)	29	2276601:2276614	2286607:2286620
WP_050543672.1|2262166_2263246_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
WP_162829202.1|2263248_2264462_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132765.1|2264566_2264890_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2265047_2266232_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2266231_2266744_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2266798_2267164_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2267172_2267328_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2270130_2270619_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2270775_2271348_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2271391_2271922_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2273013_2273328_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2273332_2274292_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2274368_2277191_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2276601:2276614	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2277197_2277563_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2277559_2278177_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2278188_2278488_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2278484_2278751_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2278747_2278951_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2278974_2279391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2279483_2279597_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2279593_2279836_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2279847_2280126_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2280136_2280487_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2280508_2280712_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2280783_2280921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2281010_2281415_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2281430_2282081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2282110_2282458_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2282463_2283465_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2286607:2286620	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	2602762	2717279	5516005	holin,protease,capsid,tail,portal,transposase,terminase,head	Escherichia_phage(28.44%)	139	NA	NA
WP_001260835.1|2602762_2603584_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2603683_2603767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2603859_2604195_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091830.1|2604591_2605845_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2605951_2606845_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2606979_2608200_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2608324_2609020_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2608972_2610265_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_171878258.1|2610422_2611037_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
WP_000526515.1|2611079_2611934_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213031.1|2611935_2612553_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	6.1e-75
WP_001414236.1|2612563_2614987_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2615047_2617474_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2617672_2617978_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2618085_2618796_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2618798_2619359_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2619393_2619735_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2619869_2620196_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2621184_2621436_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2621508_2623980_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2624072_2624264_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2624260_2624449_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2624849_2625014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2625017_2625236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2625307_2625607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2625959_2626238_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2626239_2626431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2626451_2626823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2626920_2627223_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2627219_2627645_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2627667_2628630_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2628636_2629377_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2630187_2630583_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_032165369.1|2630639_2631224_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001278450.1|2631339_2631444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2631632_2631845_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2632012_2632291_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2632292_2633342_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2633354_2633714_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2633710_2634400_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2635037_2635466_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2635944_2637795_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2638234_2638450_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2638454_2638799_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2638849_2639383_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2639653_2640223_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2640222_2640369_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2640596_2640782_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2641206_2641434_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2641475_2641841_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_171878259.1|2642130_2642694_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	5.2e-89
WP_001301491.1|2642690_2644352_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2644415_2646353_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2646397_2646619_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2649145_2649472_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2649481_2649832_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2649828_2650275_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2650271_2650616_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2650674_2651391_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2651396_2651771_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2651866_2652076_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|2652128_2655371_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|2655363_2655705_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2655704_2656142_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_171878260.1|2656329_2659590_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2659592_2659808_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2659875_2660475_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878261.1|2660539_2661763_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001023362.1|2661764_2662034_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2662147_2662723_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2663432_2664083_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2664665_2666204_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612556.1|2666253_2666601_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171554.1|2666597_2666978_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2667940_2668183_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2668893_2670138_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2670230_2670419_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2670415_2670604_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2671168_2671378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2671378_2672017_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2672028_2672181_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2672473_2672812_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2673203_2673446_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2673429_2673855_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2673923_2674967_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2674959_2675421_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2675454_2676171_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2676203_2676485_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2676481_2676709_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2676701_2677013_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2677140_2677359_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2677360_2677918_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2678151_2678364_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2678483_2678828_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2678949_2679222_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2679223_2680273_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2680285_2680591_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2680653_2681208_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2681432_2681630_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2681765_2682479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2682929_2683361_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2683838_2685689_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2686127_2686343_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2686347_2686692_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2686742_2687276_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2687546_2688116_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2688115_2688262_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2688484_2688670_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2689195_2689510_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2689591_2689816_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2690202_2690748_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2690722_2692648_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2692644_2692851_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2692847_2694449_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2694429_2695749_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001457523.1|2695758_2696091_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000063265.1|2696146_2697172_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2697213_2697612_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753003.1|2697623_2697977_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	93.2	6.6e-58
WP_000975020.1|2697991_2698525_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2698521_2698917_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_171878262.1|2698924_2699698_+	Ig domain-containing protein	NA	Q687F6	Enterobacteria_phage	96.1	3.1e-132
WP_000479046.1|2699711_2700134_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2700160_2700574_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032166593.1|2700554_2703167_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.3	0.0e+00
WP_000847298.1|2703163_2703493_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2703492_2704191_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_171878254.1|2704201_2704945_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.8e-146
WP_064562156.1|2704890_2705520_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_072616999.1|2705760_2709240_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.3	0.0e+00
WP_171878263.1|2709973_2711287_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	5.5e-81
WP_001023407.1|2711288_2711558_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2711671_2712247_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2712319_2712949_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2713030_2713672_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2713833_2714076_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2714207_2715491_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2715579_2717040_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2717075_2717279_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	2988885	3061724	5516005	holin,protease,capsid,tail,transposase,terminase,head,integrase	Stx2-converting_phage(38.89%)	81	3004387:3004414	3061861:3061888
WP_000422055.1|2988885_2989935_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2990154_2990913_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001286316.1|2990909_2991500_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2991539_2992412_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2992624_2994208_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2994235_2994856_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2994852_2995734_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2995871_2995916_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2996007_2997570_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2997569_2999165_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2999165_3000527_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|3000538_3001732_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3001731_3002538_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3002918_3003098_+	general stress protein	NA	NA	NA	NA	NA
WP_001056499.1|3003183_3003684_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3003729_3004236_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3004387:3004414	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|3005549_3006200_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3007706_3008297_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3008480_3009128_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3009264_3009411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3009838_3010117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3010456_3010837_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3010833_3011181_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3011230_3012769_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|3014416_3015742_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3016768_3017038_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3017039_3018353_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3018504_3019104_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3019171_3021517_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3021468_3022644_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3022986_3023619_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3023564_3024308_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|3024318_3025017_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|3025016_3025358_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878251.1|3025350_3028593_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|3028645_3028855_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3028950_3029325_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3029330_3030047_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3030105_3030450_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3030446_3030893_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3030889_3031240_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3031249_3031576_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|3034102_3034324_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3034368_3036306_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3036369_3038031_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171878259.1|3038027_3038591_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	5.2e-89
WP_000279786.1|3038879_3039245_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3039286_3039514_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3039938_3040124_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3040351_3040498_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3040497_3041067_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3041337_3041871_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3041921_3042266_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3042270_3042486_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|3042635_3044489_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935548.1|3045285_3046344_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3046494_3046692_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3046933_3047464_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3047472_3047832_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3047844_3048891_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3048892_3049171_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3049240_3049498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3049718_3049931_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3050209_3050968_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3051666_3051831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3051827_3052409_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3052595_3053138_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3053049_3054090_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3054061_3054613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3054596_3054824_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3054900_3055308_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3055572_3055872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3055944_3056163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3056185_3056593_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3056570_3056804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3056797_3056965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449203.1|3057362_3057551_+	division inhibition protein dicB	NA	NA	NA	NA	NA
WP_001090200.1|3057547_3057739_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3057831_3060303_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3060367_3060616_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3060593_3061724_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3061861:3061888	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	3108419	3214785	5516005	holin,protease,tail,capsid,portal,tRNA,lysis,transposase,terminase,head,integrase	Enterobacteria_phage(49.06%)	110	3144284:3144299	3208688:3208703
WP_001299679.1|3108419_3109676_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3109889_3110513_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3110512_3111364_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3111514_3112462_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3112586_3114266_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3114320_3114599_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3114876_3115461_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3115577_3116669_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3117512_3120398_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3120497_3122417_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3122644_3123715_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3123725_3124358_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3124368_3125787_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3127818_3128019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3128126_3129149_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3129148_3130129_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3130125_3130884_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3131702_3132557_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3132582_3134553_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3134602_3134857_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020151.1|3135057_3135789_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3135790_3136402_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3136501_3137416_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3137511_3139248_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3139405_3140619_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3140956_3142027_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3142036_3143335_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3143697_3145230_+	SpoVR family protein	NA	NA	NA	NA	NA
3144284:3144299	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3145281_3146001_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3146222_3147764_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3147909_3148440_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3148485_3149754_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3149753_3150173_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3150545_3151457_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3151663_3152125_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3152201_3152861_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3152932_3153226_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3153237_3153396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3153466_3153868_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3153970_3154339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3154858_3155554_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3155577_3156390_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3156393_3156660_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3157898_3158483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3158981_3159935_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3160121_3161606_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3161908_3163447_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3163496_3163844_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3163840_3164221_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3164296_3164545_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3164601_3165270_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3165767_3165950_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3166028_3166529_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3166565_3167072_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3167090_3167981_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3168100_3168682_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3168681_3171597_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3171661_3172261_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3172327_3175726_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3175786_3176419_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3176355_3177099_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3177104_3177803_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3177802_3178132_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3178128_3180678_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3180670_3181105_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3181086_3181509_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3181524_3182265_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3182272_3182668_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000752995.1|3183253_3183607_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3183618_3184017_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3184058_3185084_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001457523.1|3185139_3185472_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000123254.1|3185481_3186801_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3186781_3188383_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3188379_3188586_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3188582_3190508_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453560.1|3190482_3191028_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.2	4.4e-93
WP_001300120.1|3191416_3191611_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3191775_3191982_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3192267_3192678_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3192969_3193263_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3193353_3193536_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3193752_3194229_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3194215_3194521_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3194842_3195532_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3195528_3195669_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3195665_3196028_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3196024_3196315_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3196307_3196478_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3196477_3196933_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3197434_3198961_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3199018_3199141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3199205_3199538_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3199605_3199908_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3199904_3200606_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3201530_3201767_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3201756_3202899_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3203012_3204263_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3204434_3205088_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3205097_3205559_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3205612_3206719_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3206754_3207396_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3207399_3208770_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3208688:3208703	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3208938_3209610_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3209609_3211070_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3211670_3211952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3212207_3212750_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3212955_3213369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3213381_3213717_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3213729_3214785_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	3220877	3278226	5516005	holin,tail,capsid,portal,terminase,head,integrase	Enterobacteria_phage(26.79%)	71	3263793:3263813	3284883:3284903
WP_000085256.1|3220877_3222107_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3222355_3223477_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3223525_3224752_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3225001_3226138_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3226121_3226985_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3227348_3228710_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3228770_3229046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3231354_3234756_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3235346_3237695_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3237714_3237804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3237816_3238053_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967274.1|3237998_3238736_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_000835336.1|3238789_3239668_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3239970_3240081_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3240190_3240445_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_101972849.1|3240461_3241160_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	8.1e-132
WP_000807954.1|3241159_3241501_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3241493_3244736_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3244783_3244993_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3245088_3245463_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3245477_3246194_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3246259_3246604_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3246600_3247047_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3247043_3247394_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3247403_3247730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|3247732_3250312_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3250257_3250479_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3250523_3252461_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3252524_3254186_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171878265.1|3254182_3254746_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	2.3e-89
WP_000279796.1|3255037_3255403_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3255444_3255630_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3255759_3255900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3256256_3256481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3256545_3256752_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3256979_3257126_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3257125_3257695_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3257965_3258499_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3258549_3258894_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3258898_3259114_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3259189_3259459_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3259496_3259679_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3259826_3261764_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3262078_3262246_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3262842_3263664_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3263660_3264035_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3263793:3263813	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3264047_3265097_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3265098_3265377_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3265544_3265757_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3265945_3266050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3266165_3266753_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3266755_3266947_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3266948_3267386_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3267372_3267690_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3267643_3267961_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3267950_3268253_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3268249_3268531_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3268563_3269280_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3269313_3269856_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001457513.1|3269767_3270805_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3270873_3271299_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3271282_3271606_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3271730_3272207_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3272522_3272675_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3272789_3273305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3273437_3273827_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3273888_3274158_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3274126_3275245_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3275411_3276206_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3276202_3277249_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3277404_3278226_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3284883:3284903	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	3540009	3595616	5516005	holin,protease,capsid,tail,portal,transposase,head,integrase	Escherichia_phage(27.27%)	63	3541944:3541959	3597381:3597396
WP_000003653.1|3540009_3540597_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3540593_3541301_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3541319_3543113_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3541944:3541959	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3543109_3544228_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3546501_3546771_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_171878266.1|3546772_3548086_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230466.1|3548150_3548750_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_000515110.1|3548817_3552291_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3552424_3552952_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3553142_3553775_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3553720_3554464_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3554474_3555173_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3555172_3555502_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_134790849.1|3555498_3556263_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_001455418.1|3556214_3558077_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|3558057_3558471_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3558497_3558929_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3558942_3559683_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3559664_3559931_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3559988_3560336_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3560372_3561878_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_117005694.1|3561867_3563460_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.5e-181
WP_000259002.1|3563456_3563663_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3565824_3567363_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3567412_3567760_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3567756_3568137_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3568212_3568488_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829202.1|3569366_3570579_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171878276.1|3570563_3570758_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.7	1.2e-16
WP_000138558.1|3571013_3571286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3571445_3571979_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3572199_3572313_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3572534_3572720_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3573247_3573562_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3573838_3575689_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3576456_3577170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3577790_3578609_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3578760_3579132_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3579121_3579493_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3579505_3580555_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3580556_3580835_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3581002_3581158_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3581259_3581397_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3581762_3582536_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3582887_3583301_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3583316_3584087_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3584108_3584855_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3584861_3585953_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3586031_3586487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3586693_3587119_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3587102_3587375_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3587483_3587885_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3587912_3588104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3588103_3588391_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3588668_3588824_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3588965_3589355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3589541_3589727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3590300_3590489_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3590485_3590677_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3590770_3593242_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3593309_3593552_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3593529_3594549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3594956_3595616_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3597381:3597396	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	3826545	3866207	5516005	holin,protease,tail,portal,lysis,transposase,terminase	Enterobacteria_phage(48.84%)	50	NA	NA
WP_001247925.1|3826545_3827244_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3827474_3828356_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3828524_3828686_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3829182_3830202_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3830235_3831216_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3831392_3831662_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3831663_3832980_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3833039_3833639_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3833709_3837123_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3837183_3837792_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3837728_3838472_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3838477_3839176_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3839185_3839515_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_171878267.1|3841088_3842302_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001161009.1|3843864_3844194_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3844202_3844589_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3844649_3845393_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3845403_3845805_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3845801_3846380_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3846391_3846667_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3846659_3846983_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3847069_3849097_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3849041_3849377_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3849498_3850623_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3850550_3850763_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934141.1|3850759_3852862_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3852861_3853353_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3854027_3854180_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3854167_3854635_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3854631_3855129_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3855128_3855344_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3855486_3855885_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3855965_3856124_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3856209_3856953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3857136_3857826_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3857840_3857963_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3858300_3859260_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3859471_3860137_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3860133_3860754_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3860746_3860917_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3860913_3861096_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3861793_3862474_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3862470_3862653_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3862625_3862817_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3862827_3863109_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3863207_3863429_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3863639_3864242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3864484_3864652_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3864691_3864910_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_162829202.1|3864993_3866207_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 13
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	4411735	4464868	5516005	tail,transposase,integrase	Escherichia_phage(30.43%)	55	4434510:4434569	4460841:4462150
WP_000998048.1|4411735_4413274_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4413323_4413671_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4413667_4414048_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4414311_4414575_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4414574_4414715_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4414784_4414976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4415800_4416343_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4416417_4417005_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4417062_4417731_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4417756_4420282_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_171878272.1|4420271_4421915_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4421883_4422594_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4422906_4423236_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4423483_4424098_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4424515_4425205_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_171878273.1|4425201_4426158_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667044.1|4426154_4428353_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4428362_4429319_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4429497_4430625_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4430766_4431825_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4432070_4432973_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4433675_4433954_-	hypothetical protein	NA	NA	NA	NA	NA
4434510:4434569	attL	TGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|4434551_4435765_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000687183.1|4436255_4437155_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4437830_4438787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4438919_4441253_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4441266_4441590_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4441589_4441811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4441807_4442365_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4442361_4442622_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4443555_4444308_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4444304_4444856_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4444861_4445134_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4445543_4446110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4446109_4446700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4446730_4447363_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4447355_4447814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4447813_4448431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4448403_4448820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4448823_4450005_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4450967_4451711_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4452534_4453308_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4453365_4453920_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4453949_4454444_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4454443_4455037_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4455008_4455452_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4455472_4455868_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4456182_4456494_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251067.1|4457445_4457739_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|4457857_4458058_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4458158_4458872_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_162829202.1|4459644_4460857_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4461184_4461430_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4462499_4463753_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4460841:4462150	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAAACCGGGGCGGTTCATAACCAATTGTATTTATTTTAAAATTAATAGGTGCAACTCACTAAACAACGCAATTCTGATCTCTCGATCACCTCCCAAGCCACACAACCCTGCAAAAAATAAATCTATATAAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTAACACAAATACCACTAGCGGTGATACTAAGCACATCAGCAGGACGCACTAACCACCATGAAGGTGATGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGTGTGTGTGATACGAAACGAAGCATTGGCCGGAAGTGCGAATCCGGATTAGCAGCCAATGTGCCATTGCGGGGTGTTTTCGTTCAGGACTACGACTCCCACACACAACCAAAGCTAACTAACAGGAGAATCCAGATGGATGCACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGATCGGATTCTGGCTTCAACATTTCGCAGGAATGCAACTAAGAGACATTACTGAATCAAAAATTTATTCAGCAATGCAGAAAATGACGAACCGGCGTCATGAGGAAAACTGGAAACTCAGGGCAGAAGCATGCAGAAAAAAAGGGAAACCTGTTCCAGAATACACGCCAAAACCAGCGTCCGTTGCAACGAAGGCTACGCATCTTTCATTTATAAAGGCCCTGCTAAGAGCCGCAGAGCGTGAATGGAAAATGCTCGATAAGGCACCAATTATTAAAGTGCCTCAACCAAAGAATAAACGGATCCGCTGGCTGGAGCCCCATGAAGCACAAAGGCTGATTGATGAATGTCCGGAGCCATTAAAGTCTGTTGTTGAATTTGCACTGGCAACAGGCTTAAGACGCTCGAACATCATCAACCTTGAATGGCAACAAATAGATATGCAGCGCCGGGTGGCATGGATAAACCCGGAAGAGAGTAAATCAAACCGCGCAATTGGCGTTGCGCTGAATGATACTGCATGTCGCGTATTGAAAAAACAAATCGGTAATCATCACCGTTGGGTATTTGTGTACAAGGAAAGCTGTACCAAACCAGACGGAACGAAAGCGCCAACAGTAAGGAAGATGCGGTATGACGCAAACACAGCCTGGAAAGCGGCGCTGAGACGGGCTGGTATTGATGATTTCAGATTTCACGACTTGAGACACACCTGGGCAAGTTGGCTGGTTCAAGCCGGAGTCCCGTTGTCAGTGTTACAGGAAATGGGAGGCTG	NA	NA	NA	NA
WP_001285288.1|4463764_4464868_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 14
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	4948615	5007643	5516005	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4948615_4949968_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4950061_4950613_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4950768_4952142_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4952317_4953316_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4953348_4954344_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4954330_4955353_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205818.1|4955366_4956869_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4957008_4957965_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4958274_4958805_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4958884_4959235_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4959228_4959480_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4959691_4960033_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4960035_4963815_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4963811_4965545_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4965750_4966389_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4966711_4968055_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4968150_4968357_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4968681_4969236_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4969298_4970237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4970448_4971189_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4971378_4973322_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4973439_4973820_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4973908_4974769_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4974876_4975842_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4975949_4976612_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4976656_4978069_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4978377_4978998_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4979215_4979854_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4979988_4981197_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4981204_4981636_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4982258_4983053_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4983123_4983573_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4983614_4983842_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4983846_4984161_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4984167_4984563_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4984889_4985165_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4985293_4985980_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4985979_4986834_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4986843_4987494_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4987507_4987972_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4987981_4988287_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4988302_4989700_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4991226_4991982_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4991978_4992728_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4992909_4993239_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4993387_4993663_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_171878274.1|4993779_4995405_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4995488_4996652_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4996654_4997293_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4997302_4997701_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4997718_4998378_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4998428_4999127_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4999145_4999547_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4999673_5000405_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5000585_5003027_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5003065_5003491_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5003695_5004994_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5005097_5005295_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5005376_5006381_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5006383_5007643_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038366	Escherichia coli O157:H7 strain F6667 chromosome, complete genome	5516005	5144470	5159135	5516005	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	18	5140311:5140326	5157840:5157855
5140311:5140326	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5144470_5145886_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5147117_5147360_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543815.1|5147493_5148531_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5148619_5149717_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5149778_5150027_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5150187_5150829_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5150910_5151540_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5151612_5152185_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5152296_5152566_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5152567_5153881_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5153945_5154545_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5155866_5156403_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5156393_5156744_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5156740_5157025_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5157360_5157558_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5157902_5158184_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5157840:5157855	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5158231_5158405_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5158601_5159135_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038368	Escherichia coli O157:H7 strain F6667 plasmid pF6667-1, complete sequence	93665	0	72962	93665	integrase,transposase	Macacine_betaherpesvirus(26.32%)	62	8752:8770	67105:67123
WP_001302175.1|2588_3464_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|3464_5432_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|5431_6937_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|6938_8162_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|8192_8627_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|8623_9178_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
8752:8770	attL	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
WP_000173396.1|9192_9540_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|9536_10136_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|10132_11110_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|11148_12321_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|12307_12820_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|12877_13711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|13802_14204_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|16093_16609_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|16610_19607_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|19656_21777_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|21780_23220_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|23963_24194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|24314_25055_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25339_26317_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29206_30013_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30735_31949_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32024_32780_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_162829202.1|32930_34143_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000772446.1|34680_35847_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|35846_36818_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|37512_38415_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|38418_38724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|38800_39484_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|39484_39706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|39599_40154_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|40848_41421_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|41516_41819_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|41865_42288_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|42284_42476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|42594_42984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|43471_43702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|43753_45115_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|45161_45725_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001492078.1|45810_46254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|46323_46530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|46555_47008_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|47064_47298_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|47363_49322_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845909.1|49376_49811_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|49807_50569_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|50800_50959_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|53181_53613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|55364_64874_+	toxin B	NA	NA	NA	NA	NA
WP_000998048.1|65700_67239_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
67105:67123	attR	ATCCAGCTGCGCCTGCAGA	NA	NA	NA	NA
WP_000612591.1|67288_67636_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|67632_68013_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000205762.1|69582_70329_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|70387_71248_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|71350_71911_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|72043_72256_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|72500_72962_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
