The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	1220988	1244579	5519312	holin,integrase,transposase,tail	Enterobacteria_phage(33.33%)	27	1212634:1212648	1245450:1245464
1212634:1212648	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1220988_1222194_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222195_1223509_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223505_1225137_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225137_1225536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225633_1226047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526871.1|1226442_1227783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227858_1228194_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228196_1228952_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229287_1229854_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229828_1230440_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230436_1231102_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231098_1231722_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231974_1232718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232803_1232971_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233378_1235232_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235381_1235597_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235601_1235946_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236302_1236683_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236679_1237027_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237527_1238741_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238958_1239228_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239388_1239811_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239940_1240999_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241077_1241728_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241910_1242501_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1243002_1243251_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244096_1244579_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245450:1245464	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	1522158	1527584	5519312	integrase	Enterobacteria_phage(50.0%)	6	1511146:1511162	1529780:1529796
1511146:1511162	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522158_1522728_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522727_1523195_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523181_1523862_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523871_1525008_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525182_1526340_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526651_1527584_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529780:1529796	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	1774517	1881017	5519312	holin,terminase,tRNA,tail,transposase,protease,portal	Enterobacteria_phage(60.24%)	117	NA	NA
WP_000569336.1|1774517_1775444_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1775448_1776180_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1776160_1776268_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1776327_1777029_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1777049_1778336_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_149008366.1|1778369_1778612_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	86.0	9.6e-16
WP_162829202.1|1778534_1779747_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000556583.1|1779956_1780091_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1780094_1780337_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1780424_1780787_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1780783_1781140_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1781473_1781650_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1781651_1782599_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1782595_1782817_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1782915_1783197_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1783207_1783399_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1783371_1783554_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1783553_1784231_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1784227_1785013_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1785018_1785315_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1785390_1785534_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1785502_1785667_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1785739_1786108_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1786368_1786950_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1786966_1787239_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1787751_1788303_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1788309_1788591_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1788713_1789361_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1789469_1789688_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1789802_1790099_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000788906.1|1791059_1791761_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1791757_1792048_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000127.1|1792118_1792397_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103678.1|1792529_1792745_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1792755_1792992_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1792948_1793395_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1793391_1793919_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1793915_1794092_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1794094_1794496_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1794455_1794665_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1794657_1795263_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1795259_1795454_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1795446_1795881_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1796387_1797335_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1797344_1797614_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1798124_1800071_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1800208_1800388_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1800428_1800674_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1800751_1800967_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1800971_1801505_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1801775_1802345_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1802344_1802491_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1802718_1802904_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1803115_1803388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1803420_1803897_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1803893_1806017_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1806013_1806226_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1806225_1807728_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_162829202.1|1808634_1809848_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001097065.1|1811097_1811424_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1811416_1811698_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1811700_1812324_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1812336_1812735_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1812742_1813495_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1813508_1813931_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1813957_1814266_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1814309_1816955_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1816951_1817281_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|1817280_1817979_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|1817989_1818733_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1818678_1819308_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_171877666.1|1819548_1823025_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	91.2	0.0e+00
WP_001228289.1|1823092_1823692_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1823756_1825070_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1825071_1825341_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1825708_1825957_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1826471_1828157_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1828153_1828873_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1828919_1829390_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1829431_1829893_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_162829206.1|1830076_1831289_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_001302810.1|1833330_1834467_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1834459_1835191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1835209_1836739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1836749_1837838_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1839078_1839396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1839457_1843087_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1850044_1852078_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1852209_1853319_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1853580_1853862_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1854153_1854696_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1854783_1855458_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001301545.1|1857964_1858999_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1859080_1859419_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1859636_1860488_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1860608_1860881_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1860990_1861305_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1861314_1861662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1862712_1862952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1863285_1864074_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1864070_1864871_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1864935_1865754_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434031.1|1865805_1866552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1866525_1867491_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1867487_1868492_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1868488_1869766_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1870022_1871075_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_021497400.1|1871373_1872228_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1872256_1873519_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1873528_1873981_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1874011_1874296_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1874299_1875655_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1875702_1876743_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1876842_1877622_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1877703_1878603_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1879008_1879326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1879655_1881017_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	1979030	2052753	5519312	holin,terminase,capsid,integrase,head,tail,transposase,portal	Enterobacteria_phage(33.33%)	70	1978537:1978552	2036940:2036955
1978537:1978552	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1979030_1980244_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1980615_1982763_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1984210_1985749_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1985798_1986146_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1986142_1986523_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1986884_1987430_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1987426_1988170_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1988181_1989261_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1989322_1990258_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1990714_1991632_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1991733_1992684_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1995070_1995787_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1996129_1997584_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1997685_1999002_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1999315_2000368_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829202.1|2005843_2007056_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2010414_2011212_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2011447_2012470_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2012469_2012673_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2012731_2015203_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2015298_2015487_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2015483_2015672_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2016152_2016305_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2016579_2017224_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2017321_2017549_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2017545_2017971_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2018039_2019077_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143019.1|2018988_2019531_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_021497521.1|2019564_2020275_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	8.6e-73
WP_000702797.1|2020296_2020521_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2020517_2020874_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2020906_2021059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2021055_2021367_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2021493_2022057_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2022166_2022271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2022457_2022670_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2022837_2023116_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2023117_2024167_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2024179_2024539_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2024535_2025225_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2025858_2026287_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2026764_2028615_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2028696_2029910_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2030220_2030436_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2030440_2030785_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2030835_2031369_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2031524_2031707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2031719_2031851_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2032078_2032264_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2032790_2033105_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2033186_2033411_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2033805_2034315_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2034286_2036215_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2036198_2036405_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2036401_2037994_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2036940:2036955	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2037983_2039489_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2039525_2039873_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2039930_2040197_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2040178_2040919_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2040932_2041364_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2041390_2041804_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_171877667.1|2041784_2044364_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_000847298.1|2044360_2044690_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2044689_2045388_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2045398_2046142_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2046087_2046717_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_024748476.1|2046957_2050437_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|2050504_2051104_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268835.1|2051168_2052482_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|2052483_2052753_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
>prophage 5
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	2111380	2131629	5519312	integrase,transposase,tail	Enterobacteria_phage(75.0%)	28	2124765:2124778	2134771:2134784
WP_162829202.1|2111380_2112593_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132765.1|2112730_2113054_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2113211_2114396_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2114395_2114908_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2114962_2115328_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2115336_2115492_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2118294_2118783_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2118939_2119512_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2119555_2120086_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2121177_2121492_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2121496_2122456_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2122532_2125355_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2124765:2124778	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2125361_2125727_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2125723_2126341_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2126352_2126652_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2126648_2126915_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2126911_2127115_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2127138_2127555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2127647_2127761_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2127757_2128000_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2128011_2128290_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2128300_2128651_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2128672_2128876_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2128947_2129085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2129174_2129579_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2129594_2130245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2130274_2130622_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2130627_2131629_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2134771:2134784	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	2453490	2546576	5519312	holin,terminase,capsid,head,tail,transposase,protease,portal	Stx2-converting_phage(36.67%)	99	NA	NA
WP_001260835.1|2453490_2454312_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2454411_2454495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2454587_2454923_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2455319_2456573_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2456679_2457573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2457707_2458928_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2459052_2459748_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2459700_2460993_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2461150_2461765_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2461807_2462662_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2462663_2463281_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2463291_2465715_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2465775_2468202_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2468400_2468706_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2468813_2469524_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2469526_2470087_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2470121_2470463_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2470597_2470924_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2471912_2472164_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2472236_2474708_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2474800_2474992_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2474988_2475177_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2475577_2475742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2475745_2475964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2476035_2476335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2476687_2476966_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2476967_2477159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2477179_2477551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2477648_2477951_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2477947_2478373_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2478395_2479358_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2479364_2480105_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2480915_2481311_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2481367_2481952_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2482067_2482172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2482360_2482573_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2482740_2483019_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2483020_2484070_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_162829202.1|2484360_2485574_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001059381.1|2485751_2486441_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2487080_2487509_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2487987_2489838_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2490277_2490493_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2490497_2490842_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2490892_2491426_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2491696_2492266_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2492265_2492412_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2492639_2492825_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2493249_2493477_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2493518_2493884_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2494172_2494736_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2494732_2496394_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2496457_2498395_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2498439_2498661_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2498606_2501186_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2501188_2501515_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2501524_2501875_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2501871_2502318_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2502314_2502659_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|2502724_2503441_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|2503446_2503821_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2503916_2504126_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212898.1|2504178_2507421_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2507413_2507755_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2507754_2508453_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2508463_2509207_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2509152_2509785_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2510126_2511302_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_115801855.1|2511253_2513599_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228304.1|2513666_2514266_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2514417_2515731_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2515732_2516002_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2517028_2518354_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2519951_2520074_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2520180_2521092_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2521157_2521727_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2522692_2524231_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2524280_2524628_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2524624_2525005_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2525344_2525623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2526050_2526197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2526333_2526981_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2527164_2527755_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001079499.1|2531225_2531732_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2531777_2532278_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2532363_2532543_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2532923_2533730_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2533729_2534923_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2534934_2536296_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2536296_2537892_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2537891_2539454_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2539545_2539590_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2539727_2540609_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2540605_2541226_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2541253_2542837_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2543049_2543922_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2543961_2544552_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2544548_2545307_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2545526_2546576_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	2624696	2689240	5519312	holin,terminase,capsid,tRNA,head,tail,transposase	Escherichia_phage(43.08%)	74	NA	NA
WP_162829202.1|2624696_2625910_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|2626769_2628215_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|2628214_2629525_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|2629700_2630609_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|2630938_2631502_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|2631522_2632755_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2633009_2633993_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123746.1|2634470_2635844_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2635972_2636908_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2636959_2638195_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2638196_2638412_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2638511_2638700_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2638737_2638887_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2638942_2639752_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2639744_2642345_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2642446_2642722_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2642796_2642967_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2642966_2643188_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2643629_2644118_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2644114_2644270_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2644280_2644460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2644702_2645122_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2645201_2645456_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2645452_2645875_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2645952_2646741_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2646747_2647494_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2647516_2648278_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2648293_2648716_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|2648821_2649034_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|2649285_2649549_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|2649559_2649721_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2649799_2650045_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2650476_2651628_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2651595_2652585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2652584_2653976_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000940319.1|2654475_2655075_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|2655074_2655365_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2655361_2655916_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2656477_2656909_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_021497500.1|2657483_2659337_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|2659486_2659702_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|2659706_2660051_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|2660101_2660635_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|2660908_2661604_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|2661698_2661830_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|2662052_2662238_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|2662638_2662965_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|2663096_2663297_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|2663338_2663704_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|2663992_2664556_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|2664552_2666214_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|2666277_2668215_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|2668259_2668481_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2671007_2671334_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|2671343_2671694_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|2671690_2672137_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|2672133_2672478_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|2672546_2673263_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|2673268_2673643_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|2673738_2673948_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212768.1|2673999_2677080_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_000807964.1|2677072_2677414_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|2677413_2678112_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|2678122_2678866_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_171877669.1|2678811_2679444_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	1.0e-96
WP_000649829.1|2679634_2680162_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|2680295_2683793_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|2683863_2684463_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|2684527_2685841_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|2685842_2686112_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|2686224_2686800_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2686872_2687502_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2687583_2688225_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2688805_2689240_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	2863754	2961684	5519312	holin,terminase,capsid,integrase,head,tail,transposase,portal	Escherichia_phage(30.48%)	124	2906938:2906951	2962563:2962576
WP_000214712.1|2863754_2863958_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2863993_2865454_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2865542_2866826_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2866957_2867200_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143808.1|2867361_2868003_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|2868084_2868714_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2868786_2869362_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|2869475_2869745_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2869746_2870970_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2871034_2871634_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_161512810.1|2871701_2875181_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_072147834.1|2875421_2876051_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2875996_2876740_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|2876750_2877449_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2877448_2877778_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2877774_2880387_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2880367_2880781_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2880807_2881230_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2881243_2881996_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2882003_2882399_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2882395_2882929_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2882943_2883297_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2883308_2883707_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2883748_2884774_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2884829_2885162_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2885171_2886491_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2886471_2888073_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2888069_2888276_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|2888272_2890198_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|2890172_2890718_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001303940.1|2891104_2891329_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2891410_2891725_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2892250_2892436_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2892658_2892805_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2892804_2893374_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2893645_2894179_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2894229_2894574_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2894578_2894794_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2895232_2897083_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2897560_2897992_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2898442_2899156_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2899291_2899489_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2899713_2900268_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2900330_2900636_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2900648_2901698_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2901699_2901972_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2902093_2902438_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2902557_2902770_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2903003_2903561_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2903562_2903781_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2903908_2904220_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2904212_2904440_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2904436_2904718_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2904750_2905467_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2905500_2905962_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2905954_2906998_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
2906938:2906951	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|2907066_2907492_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2907475_2907718_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2908109_2908448_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2908740_2908893_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2908904_2909543_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2909543_2909753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2910317_2910506_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2910502_2910691_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2910783_2912028_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2912738_2912981_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2913943_2914324_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2914320_2914668_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2914717_2916256_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2916838_2917489_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023362.1|2918888_2919158_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2919159_2920383_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2920447_2921047_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2921114_2921330_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_038425866.1|2921332_2924593_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001152128.1|2924780_2925218_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2925217_2925559_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212897.1|2925551_2928632_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_001453698.1|2928684_2928894_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2928989_2929364_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_060722693.1|2929369_2930086_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_000133388.1|2930151_2930496_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2930492_2930939_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2930935_2931286_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2931295_2931622_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063094.1|2934147_2934369_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2934413_2936351_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2936414_2938076_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2938072_2938636_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2938925_2939291_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2939332_2939560_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2939984_2940170_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2940397_2940544_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2940543_2941113_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2941383_2941917_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2941967_2942312_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2942316_2942532_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2942681_2944535_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2945331_2946390_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2946540_2946738_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2946979_2947510_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2947518_2947878_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2947890_2948937_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2948938_2949217_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2949286_2949544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2949764_2949977_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2950255_2951014_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2951712_2951877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2951873_2952455_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2952641_2953184_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2953095_2954136_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2954107_2954659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2954642_2954870_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2954946_2955354_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2955617_2955917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2955989_2956208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2956230_2956638_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2956615_2956849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2956842_2956986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2957322_2957511_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2957507_2957699_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2957791_2960263_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2960327_2960576_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2960553_2961684_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2962563:2962576	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 9
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	3008086	3180290	5519312	holin,terminase,capsid,lysis,integrase,tRNA,head,tail,transposase,protease,portal	Enterobacteria_phage(31.67%)	197	3040796:3040811	3186947:3186967
WP_001299679.1|3008086_3009343_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3009556_3010180_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3010179_3011031_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3011181_3012129_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3012253_3013933_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3013987_3014266_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3014543_3015128_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3015244_3016336_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3019157_3020228_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3020238_3020871_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3020881_3022300_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3024331_3024532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3024639_3025662_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3025661_3026642_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3026638_3027397_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3028215_3029070_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3029095_3031066_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3031115_3031370_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3032218_3033431_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3033619_3034231_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3034330_3035245_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3035340_3037077_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3037468_3038539_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3038548_3039847_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3040209_3041742_+	SpoVR family protein	NA	NA	NA	NA	NA
3040796:3040811	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3041793_3042513_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3040796:3040811	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3042734_3044276_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3044421_3044952_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3044997_3046266_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3046265_3046685_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3047057_3047969_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3048175_3048637_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3048713_3049373_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3049444_3049738_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3049749_3049908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3049978_3050380_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3050482_3050851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3051370_3052066_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3052089_3052902_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3052905_3053172_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3054337_3055551_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3055724_3056309_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3056807_3057761_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3057947_3059432_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3059734_3061273_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3061322_3061670_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3061666_3062047_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3062122_3062371_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3062427_3063096_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3063593_3063776_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3063854_3064355_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3064391_3064898_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3064916_3065807_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3065926_3066508_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3066507_3069423_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3069487_3070087_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3070153_3073552_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3073612_3074245_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3074181_3074925_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3074930_3075629_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3075628_3075958_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3075954_3078504_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3078496_3078931_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3078912_3079335_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3079350_3080091_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3080098_3080494_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3080490_3081069_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3081080_3081434_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3081445_3081844_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3081885_3082911_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3082966_3083299_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3083308_3084628_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3084608_3086210_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3086206_3086413_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3086409_3088335_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3088309_3088855_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3089243_3089438_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3089602_3089809_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3090094_3090505_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3090796_3091090_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3091180_3091363_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3091579_3092056_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3092042_3092348_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3092669_3093359_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3093355_3093496_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3093492_3093855_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3093851_3094142_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3094134_3094305_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3094304_3094760_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3095261_3096788_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3096845_3096968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3097032_3097365_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3097432_3097735_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3097731_3098433_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3099357_3099594_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3099583_3100726_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3100839_3102090_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3102261_3102915_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3102924_3103386_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3103439_3104546_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3104581_3105223_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3105226_3106597_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3106515:3106530	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3106765_3107437_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3106515:3106530	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3107436_3108897_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3109753_3110035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|3110048_3111710_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|3111693_3112050_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3112173_3112356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3112339_3112780_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3112779_3113076_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3113072_3113411_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3113407_3114619_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3114620_3115193_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3115232_3116390_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3116682_3116907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3117031_3117304_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3117314_3117725_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3117721_3117973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3118343_3120476_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3120472_3120772_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3120777_3121020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3121009_3121201_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3121200_3121386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3121378_3121576_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3121601_3122345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3122402_3122591_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3122955_3124185_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3124433_3125555_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3125603_3126830_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3127079_3128216_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3128199_3129063_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3129426_3130788_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3130848_3131124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3133432_3136834_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3137424_3139773_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3139792_3139882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3139894_3140131_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3140076_3140814_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3140867_3141746_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3142048_3142159_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3142268_3142523_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3142539_3143238_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3143237_3143579_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3143571_3146814_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3146866_3147076_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3147171_3147546_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3147551_3148268_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3148326_3148671_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3148667_3149114_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3149110_3149461_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3149470_3149797_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3149876_3152378_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063094.1|3152323_3152545_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|3152589_3154527_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3154590_3156252_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3156248_3156812_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3157101_3157467_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3157508_3157694_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3157823_3157964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3158320_3158545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3158609_3158816_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3159043_3159190_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3159189_3159759_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3160029_3160563_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3160613_3160958_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3160962_3161178_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3161253_3161523_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3161560_3161743_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3161890_3163828_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3164142_3164310_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3164906_3165728_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3165724_3166099_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3166111_3167161_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3167162_3167441_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3167608_3167821_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3168009_3168114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3168229_3168817_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3168819_3169011_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3169012_3169450_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3169436_3169754_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3169707_3170025_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3170014_3170317_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3170313_3170595_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3170627_3171344_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3171377_3171920_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3171831_3172869_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3172937_3173363_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3173346_3173670_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3173794_3174271_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3174586_3174739_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3174853_3175369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3175501_3175891_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3175952_3176222_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3176190_3177309_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3177475_3178270_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3178266_3179313_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3179468_3180290_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3186947:3186967	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	3285787	3349622	5519312	integrase,transposase,protease	Escherichia_phage(23.53%)	60	3337538:3337553	3355438:3355453
WP_162829197.1|3285787_3287000_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
WP_001287881.1|3287594_3287786_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3287838_3288072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3288167_3288791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3288879_3289389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3289846_3290305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3291658_3292783_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3293512_3293710_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3293775_3293991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3294635_3294815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3294866_3295061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3295841_3296177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3296809_3297028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3298480_3300571_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000301248.1|3301892_3302468_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3302536_3303115_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3303163_3304204_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3304226_3304682_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3304704_3305862_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3305861_3306443_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3306765_3307824_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3307833_3308976_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3308968_3309742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3309743_3310823_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3310822_3311779_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3311789_3312998_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3313015_3313483_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3313743_3314073_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3314059_3314401_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3315343_3316957_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3316987_3317338_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3317334_3317760_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000097913.1|3318904_3319078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001415512.1|3320375_3320768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3321639_3321780_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3322081_3322345_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3323556_3324174_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3324185_3324860_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3324860_3325325_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3325334_3327038_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3327030_3327351_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3327359_3327662_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3327752_3328451_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3328831_3329107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3329331_3330951_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3331043_3331403_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3332088_3332379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3332402_3332654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3332701_3333307_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_162829202.1|3335089_3336303_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3336388_3336736_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998081.1|3336785_3338324_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
3337538:3337553	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000136079.1|3338742_3338919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3339080_3341441_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3341595_3342159_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335698.1|3342979_3344365_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3344583_3344781_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3345007_3345304_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3346415_3348233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3348419_3349622_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3355438:3355453	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
>prophage 11
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	3409077	3562013	5519312	holin,bacteriocin,terminase,capsid,integrase,head,tail,transposase,protease,portal	Escherichia_phage(34.59%)	177	3508560:3508575	3563778:3563793
WP_001028088.1|3409077_3409572_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3409592_3410921_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3411003_3411111_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203859.1|3412100_3412730_+	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_000763353.1|3412777_3412999_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3412995_3413280_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3413757_3414165_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3414164_3414560_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3414793_3415006_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3415125_3415470_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_001507013.1|3416020_3424402_-	hypothetical protein	NA	A0A1I9LJU4	Stx_converting_phage	100.0	0.0e+00
WP_000012450.1|3424471_3425737_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3425747_3425999_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3426008_3426455_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3426457_3427114_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3427207_3427609_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3427665_3427806_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3428038_3428773_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3428863_3429481_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3429486_3429765_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3429779_3431048_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3431044_3432670_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3432964_3433153_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3433292_3433562_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3433563_3435501_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3435497_3436148_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3436147_3436711_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3436694_3437156_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3437205_3437595_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3437650_3438865_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3438888_3439896_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3440053_3442198_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_024179565.1|3442197_3443904_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_001086069.1|3443884_3444691_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3444746_3444950_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3445099_3445393_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3445483_3445669_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3445896_3446043_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3446042_3446612_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3446882_3447416_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3447420_3447636_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3447712_3447985_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3448025_3448205_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3448339_3450277_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3450763_3451033_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3451044_3452004_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001507023.1|3452787_3453222_-	phage antitermination Q family protein	NA	A0A0P0ZCW9	Stx2-converting_phage	100.0	2.8e-82
WP_000144764.1|3453214_3453409_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3453405_3454011_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_162829202.1|3454175_3455389_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032248203.1|3455440_3456046_-	phage antirepressor KilAC domain-containing protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	2.3e-106
WP_000335902.1|3456197_3457247_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_000153280.1|3457428_3457956_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3457952_3458399_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3458355_3458592_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3458602_3458818_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3458950_3459229_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|3459299_3459590_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|3459586_3460288_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|3460284_3461223_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|3461255_3461552_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3461690_3461918_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3461996_3462704_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3462764_3463106_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3463173_3463635_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3463628_3464675_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3464677_3464842_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|3465330_3465714_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_162829202.1|3465823_3467037_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001143921.1|3467139_3467556_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	2.2e-76
WP_000065377.1|3467706_3468075_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|3468147_3468312_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|3468280_3468424_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3468499_3468796_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3468801_3469587_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3469583_3470261_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3470260_3470443_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3470415_3470607_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3470617_3470899_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3470997_3471219_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_021497462.1|3471215_3471989_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	100.0	2.3e-143
WP_000797281.1|3472140_3472329_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3472330_3472546_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3472547_3472766_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3472767_3473055_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3474030_3474330_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3474415_3474700_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3474752_3476063_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3476059_3476638_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3476658_3476886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3476923_3478165_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3479972_3480893_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3480892_3481198_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3481351_3481951_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3481947_3484494_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3484493_3485666_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3485795_3486488_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3486460_3487489_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|3490387_3491461_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3491509_3491644_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3491671_3491902_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3491876_3492065_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3492075_3492288_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3492573_3492786_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3493227_3493533_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3493639_3494284_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3494280_3495027_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3495026_3497123_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3497168_3498308_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3498295_3498742_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3498761_3500942_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3501061_3502366_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3502445_3502538_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3502550_3503687_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3503698_3505243_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3505376_3506234_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3506230_3506629_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3506625_3507213_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3507209_3507917_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3507935_3509729_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3508560:3508575	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3509725_3510844_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3513117_3513387_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001230444.1|3514766_3515366_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3515433_3518907_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3519040_3519568_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3519758_3520391_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_171877668.1|3520336_3521080_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	1.6e-149
WP_001151078.1|3521090_3521789_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3521788_3522118_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|3522114_3524694_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|3524674_3525088_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3525114_3525546_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3525559_3526300_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3526281_3526548_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3526605_3526953_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_021497451.1|3526989_3528495_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	6.1e-100
WP_000831796.1|3528484_3530077_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3530073_3530280_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3532454_3533993_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3534042_3534390_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3534386_3534767_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3534842_3535118_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3535868_3536075_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3536330_3536603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3536762_3537296_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3537516_3537630_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3537851_3538037_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3538564_3538879_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3540235_3542086_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3542853_3543567_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3544187_3545006_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3545157_3545529_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3545518_3545890_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3545902_3546952_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3546953_3547232_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3547399_3547555_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3547656_3547794_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3548159_3548933_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3549284_3549698_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3549713_3550484_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3550505_3551252_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3551258_3552350_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3552428_3552884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3553090_3553516_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3553499_3553772_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3553880_3554282_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3554309_3554501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3554500_3554788_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3555065_3555221_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3555362_3555752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3555938_3556124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3556697_3556886_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3556882_3557074_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3557167_3559639_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3559706_3559949_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3559926_3560946_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3561353_3562013_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3563778:3563793	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	3850063	3888160	5519312	holin,terminase,lysis,integrase,tail,protease,portal	Enterobacteria_phage(51.16%)	50	3849648:3849662	3888234:3888248
3849648:3849662	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3850063_3850762_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3850992_3851874_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3852043_3852205_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3852701_3853721_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3853754_3854735_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3854911_3855181_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3855182_3856499_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3856558_3857158_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3857228_3860642_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3860702_3861311_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3861247_3861991_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3861996_3862695_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3862704_3863034_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3863033_3866099_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3866070_3866400_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3866408_3866795_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021497327.1|3866855_3867599_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	97.6	2.8e-130
WP_001079422.1|3867609_3868011_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3868007_3868586_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3868597_3868873_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3868865_3869189_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3869275_3871303_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3871247_3871583_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3871704_3872829_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3872756_3872969_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3872965_3875068_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_032248047.1|3875067_3875559_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	5.1e-72
WP_001139679.1|3876233_3876386_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3876373_3876841_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3876837_3877335_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3877334_3877550_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3877692_3878091_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3878171_3878330_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3878415_3879159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3879342_3880032_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3880046_3880169_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3880506_3881466_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3881677_3882343_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3882339_3882960_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3882952_3883123_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3883119_3883302_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3883999_3884680_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3884676_3884859_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3884831_3885023_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3885033_3885315_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3885413_3885635_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3885845_3886448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3886690_3886858_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3886897_3887116_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3887389_3888160_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3888234:3888248	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	4431284	4482890	5519312	integrase,transposase,tail	Enterobacteria_phage(34.78%)	56	4424441:4424457	4480336:4480352
4424441:4424457	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998081.1|4431284_4432823_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4432872_4433220_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4433216_4433597_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4433860_4434124_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4434123_4434264_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4434333_4434525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4435349_4435892_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4435966_4436554_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4436611_4437280_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4437305_4439831_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4439820_4441464_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4441432_4442143_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4442455_4442785_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4443032_4443647_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4444064_4444754_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4444750_4445707_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4445703_4447902_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4447911_4448868_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4449046_4450174_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4450315_4451374_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4451619_4452522_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4453224_4453503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4453669_4454392_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4454490_4455390_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4456065_4457022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4457154_4459488_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4459501_4459825_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4459824_4460046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4460042_4460600_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4460596_4460857_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4461790_4462543_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4462539_4463091_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4463096_4463369_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4463778_4464345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4464344_4464935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4464965_4465598_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4465590_4466049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4466048_4466666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4466638_4467055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4467058_4468240_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4469202_4469946_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4470769_4471543_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4471600_4472155_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4472184_4472595_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4472615_4473059_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4473030_4473624_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4473623_4474418_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4474417_4474729_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4475680_4475974_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4476092_4476293_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4476393_4477107_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4477234_4477624_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4477863_4478109_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4479178_4480432_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4480336:4480352	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4480443_4481547_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4481834_4482890_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP038363	Escherichia coli O157:H7 strain F7349 chromosome, complete genome	5519312	4501676	4524375	5519312	transposase,plate	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_000027427.1|4501676_4502849_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4502929_4503115_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4503029_4503293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4503494_4505255_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4505257_4506394_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356493.1|4507139_4507685_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4507753_4511968_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4512043_4514185_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4514394_4514913_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4515609_4516110_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4516144_4516369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4516419_4517811_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4517901_4518315_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4518318_4520169_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4520132_4521215_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4521239_4522520_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4522516_4523041_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4523043_4524375_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038364	Escherichia coli O157:H7 strain F7349 plasmid pF7349-1, complete sequence	92700	29207	37999	92700	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	25777:25790	32365:32378
25777:25790	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|31911_32250_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|32837_34004_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
32365:32378	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|34003_34975_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|36274_37999_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
