The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	684985	769006	5545879	plate,transposase,protease,holin,tail,head	Shigella_phage(53.66%)	97	NA	NA
WP_162829202.1|684985_686199_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001136459.1|686588_689105_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000044758.1|689133_689829_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001045434.1|689908_690493_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000534351.1|691649_692441_-	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_000098025.1|693272_693749_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000022766.1|693915_694776_-	tagatose-bisphosphate aldolase subunit KbaY	NA	NA	NA	NA	NA
WP_001114858.1|694788_695943_-	AgaS family sugar isomerase	NA	NA	NA	NA	NA
WP_001301829.1|696293_697427_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_000948824.1|697423_697858_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001295548.1|697875_698754_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_000406214.1|698743_699523_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_001301475.1|699533_700007_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000681927.1|700029_701310_-	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_000072187.1|701558_702368_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_000347273.1|702422_702887_-	type II toxin-antitoxin system ribonuclease toxin YhaV	NA	NA	NA	NA	NA
WP_001302819.1|702886_703222_-	type II toxin-antitoxin system antitoxin PrlF	NA	NA	NA	NA	NA
WP_001273776.1|703370_704942_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_000599636.1|705316_706651_+	galactarate/glucarate/glycerate transporter GarP	NA	NA	NA	NA	NA
WP_000077537.1|706901_707432_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|707622_707871_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|707872_709963_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|710033_710966_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|710968_711190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|711202_711457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|711458_711740_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|711736_712009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|712013_712307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|712318_712849_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|712946_713489_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|713492_714026_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000977060.1|714543_715095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|715091_715277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|715315_715648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|715640_715838_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|715827_716124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|716120_716630_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|716699_717125_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_115449162.1|717196_717697_+	lysozyme	NA	I7HDJ5	Xanthomonas_virus	41.2	1.0e-27
WP_115801859.1|717731_718160_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|718143_718362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|718371_718599_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|718579_718888_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|718884_719175_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|719177_719759_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|719758_721423_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|721422_723012_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|722995_724321_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|724439_724913_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|725089_726214_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|726213_727161_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_115447593.1|727204_727651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|727647_728067_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|728063_728624_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|728624_728870_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|728866_730369_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|730377_730743_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|730757_731234_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|731360_733436_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|733422_734772_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|734755_735880_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|735869_736484_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|736476_736914_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|736913_737996_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301579.1|737986_738547_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.0e-44
WP_024017776.1|738546_739458_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	43.1	1.1e-30
WP_001473653.1|739492_740014_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	6.0e-47
WP_000904930.1|740569_741130_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_115449796.1|741229_743269_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.2	9.5e-274
WP_000144787.1|743415_743598_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|743633_743879_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001443803.1|744489_744690_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528257.1|744643_745381_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.5	5.8e-104
WP_001058227.1|745528_746299_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_001303675.1|746328_747219_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_001301934.1|747315_748461_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
WP_000484640.1|749089_750277_-	YhaC family protein	NA	NA	NA	NA	NA
WP_000675739.1|750298_750838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145832.1|751093_751438_-	DNA-binding transcriptional activator TdcR	NA	NA	NA	NA	NA
WP_000104211.1|751626_752565_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_000548347.1|752663_753653_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_000107723.1|753674_755006_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_001301837.1|755031_756240_+	propionate kinase	NA	NA	NA	NA	NA
WP_000861740.1|756273_758568_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.3e-157
WP_000719990.1|758581_758971_+	enamine/imine deaminase	NA	NA	NA	NA	NA
WP_000622104.1|759042_760407_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000401586.1|760681_762013_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_000460512.1|762040_763351_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_001295544.1|763484_763649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633573.1|763671_764373_-	pirin family protein	NA	NA	NA	NA	NA
WP_001041009.1|764477_765374_+	DNA-binding transcriptional regulator YhaJ	NA	NA	NA	NA	NA
WP_001198807.1|765424_765781_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000384145.1|766021_766387_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000531208.1|766678_767665_-	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
WP_000603618.1|767734_768217_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000096086.1|768312_768612_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_000785722.1|768601_769006_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	1259908	1283433	5545879	tail,transposase,holin,integrase	Enterobacteria_phage(33.33%)	27	1251554:1251568	1284304:1284318
1251554:1251568	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1259908_1261114_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1261115_1262429_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1262425_1264057_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1264057_1264456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1264553_1264967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150573.1|1265362_1266637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1266712_1267048_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1267050_1267806_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1268141_1268708_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1268682_1269294_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1269290_1269956_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1269952_1270576_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1270828_1271572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1271657_1271825_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1272232_1274086_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1274235_1274451_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1274455_1274800_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1275156_1275537_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1275533_1275881_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1276381_1277595_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1277812_1278082_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1278242_1278665_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1278794_1279853_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1279931_1280582_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1280764_1281355_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1281856_1282105_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1282950_1283433_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1284304:1284318	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	1561012	1566438	5545879	integrase	Enterobacteria_phage(50.0%)	6	1550000:1550016	1568634:1568650
1550000:1550016	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1561012_1561582_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1561581_1562049_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1562035_1562716_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1562725_1563862_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1564036_1565194_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1565505_1566438_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1568634:1568650	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	1812058	1918567	5545879	terminase,transposase,tRNA,protease,holin,tail,portal	Enterobacteria_phage(60.24%)	117	NA	NA
WP_000569336.1|1812058_1812985_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1812989_1813721_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1813701_1813809_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1813868_1814570_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1814590_1815877_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_149008366.1|1815910_1816153_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	86.0	9.6e-16
WP_162829202.1|1816075_1817288_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000556583.1|1817497_1817632_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1817635_1817878_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1817965_1818328_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1818324_1818681_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1819014_1819191_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1819192_1820140_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1820136_1820358_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1820456_1820738_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1820748_1820940_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1820912_1821095_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1821094_1821772_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1821768_1822554_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1822559_1822856_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1822931_1823075_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1823043_1823208_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1823280_1823649_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1823909_1824491_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1824507_1824780_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1825292_1825844_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1825850_1826132_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1826254_1826902_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1827010_1827229_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1827343_1827640_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000788906.1|1828600_1829302_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1829298_1829589_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1829659_1829938_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1830070_1830286_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1830296_1830533_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1830489_1830936_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1830932_1831460_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1831456_1831633_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1831635_1832037_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1831996_1832206_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1832198_1832804_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1832800_1832995_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1832987_1833422_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1833928_1834876_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1834885_1835155_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1835665_1837612_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1837749_1837929_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1837969_1838215_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1838292_1838508_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1838512_1839046_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1839316_1839886_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1839885_1840032_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1840259_1840445_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1840656_1840929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1840961_1841438_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1841434_1843558_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1843554_1843767_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1843766_1845269_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_171880354.1|1846175_1847389_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001097065.1|1848638_1848965_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1848957_1849239_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1849241_1849865_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1849877_1850276_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1850283_1851036_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1851049_1851472_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1851498_1851807_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1851850_1854496_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1854492_1854822_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|1854821_1855520_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|1855530_1856274_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1856219_1856849_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151121034.1|1857089_1860563_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001228289.1|1860630_1861230_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1861294_1862608_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1862609_1862879_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1863246_1863495_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1864009_1865695_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1865691_1866411_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1866457_1866928_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1866969_1867431_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_162829206.1|1867614_1868827_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_001302810.1|1870868_1872005_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1871997_1872729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1872747_1874277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1874287_1875376_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1876616_1876934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1876995_1880625_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1887582_1889616_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1889747_1890857_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1891118_1891400_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1891691_1892234_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1892321_1892996_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001301545.1|1895502_1896537_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1896618_1896957_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134626.1|1897174_1898038_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_171880355.1|1898158_1898431_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1898540_1898855_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1898864_1899212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1900262_1900502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1900835_1901624_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1901620_1902421_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1902485_1903304_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434031.1|1903355_1904102_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1904075_1905041_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1905037_1906042_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1906038_1907316_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1907572_1908625_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1908923_1909778_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1909806_1911069_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1911078_1911531_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1911561_1911846_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1911849_1913205_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1913252_1914293_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1914392_1915172_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1915253_1916153_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1916558_1916876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1917205_1918567_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 5
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	2016580	2090291	5545879	terminase,capsid,transposase,holin,integrase,tail,portal,head	Escherichia_phage(36.17%)	69	2016087:2016102	2074478:2074493
2016087:2016102	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|2016580_2017794_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2018165_2020313_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2021760_2023299_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2023348_2023696_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2023692_2024073_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2024434_2024980_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2024976_2025720_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2025731_2026811_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2026872_2027808_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2028264_2029182_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2029283_2030234_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2032620_2033337_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2033679_2035134_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2035235_2036552_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2036865_2037918_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829202.1|2043393_2044606_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2047964_2048762_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2048997_2050020_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2050019_2050223_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2050281_2052753_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2052848_2053037_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2053033_2053222_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2053702_2053855_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2054129_2054774_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2054871_2055099_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2055095_2055521_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2055589_2056627_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2056538_2057081_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2057115_2057814_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2057835_2058060_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2058056_2058413_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2058445_2058598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2058594_2058906_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2059032_2059596_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2059705_2059810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2059996_2060209_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2060376_2060655_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2060656_2061706_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2061718_2062078_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2062074_2062764_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2063397_2063826_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2064303_2066154_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2066235_2067449_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2067759_2067975_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2067979_2068324_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2068374_2068908_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2069063_2069246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2069258_2069390_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2069617_2069803_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2070329_2070644_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2070725_2070950_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2071344_2071854_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2073736_2073943_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2073939_2075532_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2074478:2074493	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2075521_2077027_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2077063_2077411_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2077468_2077735_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2077716_2078457_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2078470_2078902_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2078928_2079342_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|2079322_2081902_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|2081898_2082228_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2082227_2082926_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2082936_2083680_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2083625_2084255_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_149888716.1|2084495_2087975_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|2088042_2088642_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_070479928.1|2088706_2090020_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2090021_2090291_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	2147871	2167854	5545879	tail,transposase,integrase	Enterobacteria_phage(75.0%)	28	2160990:2161003	2170996:2171009
WP_032161728.1|2147871_2149005_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2148955_2149279_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2149436_2150621_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2150620_2151133_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2151187_2151553_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2151561_2151717_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2154519_2155008_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2155164_2155737_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2155780_2156311_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2157402_2157717_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2157721_2158681_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2158757_2161580_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2160990:2161003	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2161586_2161952_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2161948_2162566_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2162577_2162877_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2162873_2163140_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2163136_2163340_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2163363_2163780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2163872_2163986_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2163982_2164225_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2164236_2164515_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2164525_2164876_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2164897_2165101_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2165172_2165310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2165399_2165804_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2165819_2166470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2166499_2166847_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2166852_2167854_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2170996:2171009	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	2488400	2552465	5545879	capsid,terminase,protease,holin,tail,portal,lysis,head	Stx2-converting_phage(36.0%)	73	NA	NA
WP_001260835.1|2488400_2489222_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2489321_2489405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2489497_2489833_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2490229_2491483_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2491589_2492483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2492617_2493838_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2493962_2494658_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2494610_2495903_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2496060_2496675_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2496717_2497572_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2497573_2498191_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2498201_2500625_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2500685_2503112_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2503310_2503616_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2503723_2504434_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2504436_2504997_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2505031_2505373_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2505507_2505834_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2506822_2507074_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2507146_2509618_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2509710_2509902_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2509898_2510087_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2510487_2510652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2510655_2510874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2510945_2511245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2511597_2511876_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2511877_2512069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2512089_2512461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2512558_2512861_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2512857_2513283_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2513305_2514268_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2514274_2515015_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2515825_2516221_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2516277_2516862_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2516977_2517082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2517270_2517483_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2517650_2517929_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001217455.1|2518992_2519352_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2519348_2520038_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2520678_2521107_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2521585_2523436_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2523875_2524091_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2524095_2524440_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2524490_2525024_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_171880377.1|2525524_2525932_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	98.5	2.6e-66
WP_000095736.1|2526294_2526522_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2526563_2526929_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2527218_2527782_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2527778_2529440_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2529503_2531441_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2531485_2531707_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2531652_2534232_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2534234_2534561_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2534570_2534921_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2534917_2535364_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2535360_2535705_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|2535770_2536487_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|2536492_2536867_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2536962_2537172_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171880359.1|2537224_2540305_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	93.3	0.0e+00
WP_000807964.1|2540297_2540639_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|2540638_2541337_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|2541347_2542091_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|2542036_2542669_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|2542859_2543387_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|2543520_2547018_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|2547088_2547688_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|2547752_2549066_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|2549067_2549337_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|2549449_2550025_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2550097_2550727_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2550808_2551450_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2552030_2552465_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	2727037	2834392	5545879	capsid,terminase,transposase,tRNA,holin,tail,portal,head	Escherichia_phage(39.67%)	133	NA	NA
WP_000214712.1|2727037_2727241_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2727276_2728737_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2728825_2730109_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2730240_2730483_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143808.1|2730644_2731286_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|2731367_2731997_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2732069_2732645_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|2732758_2733028_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2733029_2734253_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2734317_2734917_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_161512810.1|2734984_2738464_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_072147834.1|2738704_2739334_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2739279_2740023_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|2740033_2740732_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2740731_2741061_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2741057_2743670_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2743650_2744064_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2744090_2744513_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2744526_2745279_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2745286_2745682_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2745678_2746212_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2746226_2746580_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2746591_2746990_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2747031_2748057_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2748112_2748445_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2748454_2749774_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2749754_2751356_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2751352_2751559_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|2751555_2753481_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|2753455_2754001_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001303940.1|2754387_2754612_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2754693_2755008_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2755533_2755719_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2755941_2756088_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2756087_2756657_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2756928_2757462_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2757512_2757857_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2757861_2758077_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2758515_2760366_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2760843_2761275_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2761725_2762439_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2762574_2762772_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2762996_2763551_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2763613_2763919_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2763931_2764981_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2764982_2765255_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2765376_2765721_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2765840_2766053_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2766286_2766844_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2766845_2767064_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2767191_2767503_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2767495_2767723_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2767719_2768001_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2768033_2768750_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2768783_2769245_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2769237_2770281_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2770349_2770775_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2770758_2771001_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2771392_2771731_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2772023_2772176_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2772187_2772826_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2772826_2773036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2773600_2773789_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2773785_2773974_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2774066_2775311_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2776021_2776264_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2777226_2777607_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2777603_2777951_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2778000_2779539_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2780121_2780772_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023362.1|2782171_2782441_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2782442_2783666_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2783730_2784330_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2784397_2784613_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_038425866.1|2784615_2787876_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001152128.1|2788063_2788501_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2788500_2788842_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171880361.1|2788834_2791915_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_001453698.1|2791966_2792176_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2792271_2792646_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2792651_2793368_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2793436_2793781_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2793777_2794224_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2794220_2794571_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2794580_2794907_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2797433_2797655_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2797699_2799637_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2799700_2801362_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2801358_2801922_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2802210_2802576_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2802617_2802818_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2802949_2803276_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2803676_2803862_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2804084_2804216_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2804310_2805006_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2805279_2805813_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2805863_2806208_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2806212_2806428_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2806577_2808431_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2809005_2809437_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2809998_2810553_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2810549_2810840_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2810839_2811439_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2811938_2813330_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2813329_2814319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2814286_2815438_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2815869_2816115_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2816193_2816355_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2816365_2816629_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2816880_2817093_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2817198_2817621_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2817636_2818398_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2818420_2819167_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2819173_2819962_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2820039_2820462_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2820458_2820713_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2820792_2821212_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2821454_2821634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2821644_2821800_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2821796_2822285_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2822726_2822948_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2822947_2823118_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2823192_2823468_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2823569_2826170_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2826162_2826972_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2827027_2827177_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2827214_2827403_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2827502_2827718_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2827719_2828955_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2829006_2829942_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2830070_2831444_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2831921_2832905_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2833159_2834392_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	2919338	2994794	5545879	capsid,terminase,transposase,protease,holin,integrase,tail,portal,head	Stx2-converting_phage(37.5%)	84	2934840:2934867	2994931:2994958
WP_000422055.1|2919338_2920388_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2920607_2921366_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2921362_2921953_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2921992_2922865_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2923077_2924661_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2924688_2925309_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2925305_2926187_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2926324_2926369_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2926460_2928023_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2928022_2929618_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2929618_2930980_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2930991_2932185_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2932184_2932991_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2933371_2933551_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2933636_2934137_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2934182_2934689_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2934840:2934867	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2938159_2938750_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2938933_2939581_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2939717_2939864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2940291_2940570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2940909_2941290_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2941286_2941634_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2941683_2943222_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2944187_2944757_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2944822_2945734_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2945840_2945963_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2947560_2948886_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2949912_2950182_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2950183_2951497_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2951648_2952248_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2952315_2954661_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2954612_2955788_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2956129_2956762_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2956707_2957451_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2957461_2958160_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2958159_2958501_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2958493_2961736_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2961783_2961993_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2962088_2962463_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2962477_2963194_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2963259_2963604_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2963600_2964047_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2964043_2964394_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2964403_2964730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2964732_2967312_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|2967257_2967479_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2967523_2969461_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|2969524_2971186_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|2971182_2971746_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2972035_2972401_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2972442_2972670_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2973094_2973280_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2973507_2973654_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2973653_2974223_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2974493_2975027_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2975077_2975422_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2975426_2975642_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2975791_2977645_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2978441_2979500_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2979650_2979848_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2980089_2980620_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2980628_2980988_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2981000_2982047_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2982048_2982327_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2982396_2982654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2982874_2983087_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2983365_2984124_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2984822_2984987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2984983_2985565_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2985751_2986294_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2986205_2987246_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2987217_2987769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2987752_2987980_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2988056_2988464_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2988727_2989027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2989099_2989318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2989340_2989748_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2989725_2989959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2989952_2990096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2990432_2990621_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2990617_2990809_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2990901_2993373_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2993437_2993686_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2993663_2994794_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2994931:2994958	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	3041196	3210770	5545879	capsid,terminase,transposase,tRNA,protease,holin,integrase,tail,portal,lysis,head	Enterobacteria_phage(32.2%)	196	3072593:3072608	3217427:3217447
WP_001299679.1|3041196_3042453_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3042666_3043290_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3043289_3044141_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3044291_3045239_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3045363_3047043_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3047097_3047376_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3047653_3048238_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3048354_3049446_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3052267_3053338_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3053348_3053981_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3053991_3055410_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3057441_3057642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3057749_3058772_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3058771_3059752_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3059748_3060507_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3061325_3062180_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3062205_3064176_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3064225_3064480_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020150.1|3064680_3065415_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3065416_3066028_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3066127_3067042_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3067137_3068874_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3069265_3070336_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3070345_3071644_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3072006_3073539_+	SpoVR family protein	NA	NA	NA	NA	NA
3072593:3072608	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3073590_3074310_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3072593:3072608	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3074531_3076073_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3076218_3076749_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3076794_3078063_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3078062_3078482_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3078854_3079766_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3079972_3080434_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3080510_3081170_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3081241_3081535_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3081546_3081705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3081775_3082177_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3082279_3082648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3083167_3083863_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3083886_3084699_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3084702_3084969_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3086204_3086789_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3087287_3088241_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3088427_3089912_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3090214_3091753_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3091802_3092150_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3092146_3092527_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3092602_3092851_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3092907_3093576_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3094073_3094256_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3094334_3094835_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3094871_3095378_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3095396_3096287_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3096406_3096988_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3096987_3099903_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3099967_3100567_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3100633_3104032_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3104092_3104725_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3104661_3105405_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3105410_3106109_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3106108_3106438_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3106434_3108984_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3108976_3109411_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3109392_3109815_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3109830_3110571_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3110578_3110974_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3110970_3111549_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3111560_3111914_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3111925_3112324_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3112365_3113391_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3113446_3113779_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3113788_3115108_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3115088_3116690_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3116686_3116893_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3116889_3118815_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3118789_3119335_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3119723_3119918_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3120082_3120289_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3120574_3120985_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3121276_3121570_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3121660_3121843_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3122059_3122536_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3122522_3122828_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3123149_3123839_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3123835_3123976_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3123972_3124335_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3124331_3124622_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3124614_3124785_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3124784_3125240_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3125741_3127268_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3127325_3127448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3127512_3127845_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3127912_3128215_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3128211_3128913_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3129837_3130074_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3130063_3131206_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3131319_3132570_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3132741_3133395_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3133404_3133866_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3133919_3135026_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3135061_3135703_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3135706_3137077_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3136995:3137010	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3137245_3137917_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3136995:3137010	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3137916_3139377_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3140233_3140515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|3140528_3142190_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|3142173_3142530_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3142653_3142836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3142819_3143260_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3143259_3143556_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3143552_3143891_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3143887_3145099_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3145100_3145673_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3145712_3146870_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3147162_3147387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3147511_3147784_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3147794_3148205_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3148201_3148453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3148823_3150956_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3150952_3151252_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3151257_3151500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3151489_3151681_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3151680_3151866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3151858_3152056_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3152081_3152825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3152882_3153071_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3153435_3154665_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3154913_3156035_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3156083_3157310_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3157559_3158696_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3158679_3159543_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3159906_3161268_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3161328_3161604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3163912_3167314_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001693457.1|3167904_3170253_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3170272_3170362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3170374_3170611_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3170556_3171294_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3171347_3172226_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3172528_3172639_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3172748_3173003_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3173019_3173718_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3173717_3174059_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3174051_3177294_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3177346_3177556_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3177651_3178026_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3178031_3178748_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3178806_3179151_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3179147_3179594_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3179590_3179941_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3179950_3180277_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3180356_3182858_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|3182803_3183025_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|3183069_3185007_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3185070_3186732_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3186728_3187292_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3187581_3187947_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3187988_3188174_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3188303_3188444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3188800_3189025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3189089_3189296_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3189523_3189670_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3189669_3190239_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3190509_3191043_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3191093_3191438_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3191442_3191658_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3191733_3192003_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3192040_3192223_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3192370_3194308_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3194622_3194790_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3195386_3196208_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3196204_3196579_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3196591_3197641_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3197642_3197921_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3198088_3198301_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3198489_3198594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3198709_3199297_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3199299_3199491_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3199492_3199930_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3199916_3200234_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3200187_3200505_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3200494_3200797_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3200793_3201075_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3201107_3201824_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3201857_3202400_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3202311_3203349_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3203417_3203843_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3203826_3204150_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3204274_3204751_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3205066_3205219_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3205333_3205849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3205981_3206371_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3206432_3206702_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3206670_3207789_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3207955_3208750_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3208746_3209793_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3209948_3210770_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3217427:3217447	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	3438245	3588556	5545879	capsid,terminase,transposase,protease,bacteriocin,holin,integrase,tail,portal,head	Escherichia_phage(32.06%)	175	3535102:3535117	3590321:3590336
WP_001028088.1|3438245_3438740_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3438760_3440089_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3440171_3440279_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203859.1|3441268_3441898_+	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_000763353.1|3441945_3442167_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3442163_3442448_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001304215.1|3442434_3442653_+	ead/Ea22-like family protein	NA	A0A1I9LJV0	Stx_converting_phage	100.0	4.4e-36
WP_000426668.1|3443332_3443728_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3443961_3444174_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3444293_3444638_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_001507013.1|3445188_3453570_-	hypothetical protein	NA	A0A1I9LJU4	Stx_converting_phage	100.0	0.0e+00
WP_000012450.1|3453639_3454905_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3454915_3455167_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3455176_3455623_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3455625_3456282_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3456375_3456777_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3456833_3456974_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3457206_3457941_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3458031_3458649_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3458654_3458933_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3458947_3460216_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3460212_3461838_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3462132_3462321_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3462460_3462730_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3462731_3464669_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3464665_3465316_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3465315_3465879_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3465862_3466324_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3466373_3466763_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3466818_3468033_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3468056_3469064_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3469221_3471366_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3471365_3473072_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3473052_3473859_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3474267_3474561_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3474651_3474837_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3475064_3475211_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3475210_3475780_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3476050_3476584_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3476588_3476804_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3476880_3477153_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3477193_3477373_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3477507_3479445_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3479931_3480201_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3480212_3481172_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001507023.1|3481955_3482390_-	phage antitermination Q family protein	NA	A0A0P0ZCW9	Stx2-converting_phage	100.0	2.8e-82
WP_000144764.1|3482382_3482577_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3482573_3483179_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004020.1|3483178_3483901_-	phage antirepressor KilAC domain-containing protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_000335902.1|3484052_3485102_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_000153280.1|3485283_3485811_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001304104.1|3485807_3486254_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|3486210_3486447_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3486457_3486673_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3486805_3487084_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|3487154_3487445_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|3487441_3488143_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|3488139_3489078_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|3489110_3489407_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3489545_3489773_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3489851_3490559_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3490619_3490961_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3491028_3491490_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3491483_3492530_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3492532_3492697_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|3493185_3493569_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3493627_3494098_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|3494248_3494617_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|3494689_3494854_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|3494822_3494966_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3495041_3495338_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3495343_3496129_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3496125_3496803_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3496802_3496985_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3496957_3497149_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3497159_3497441_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3497539_3497761_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_021497462.1|3497757_3498531_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	100.0	2.3e-143
WP_000797281.1|3498682_3498871_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3498872_3499088_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3499089_3499308_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3499309_3499597_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3500572_3500872_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3500957_3501242_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3501294_3502605_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3502601_3503180_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3503200_3503428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3503465_3504707_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3506514_3507435_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3507434_3507740_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3507893_3508493_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3508489_3511036_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3511035_3512208_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3512337_3513030_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3513002_3514031_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|3516929_3518003_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3518051_3518186_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3518213_3518444_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3518418_3518607_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3518617_3518830_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3519115_3519328_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3519769_3520075_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3520181_3520826_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3520822_3521569_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3521568_3523665_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3523710_3524850_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3524837_3525284_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3525303_3527484_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3527603_3528908_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3528987_3529080_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3529092_3530229_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3530240_3531785_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3531918_3532776_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3532772_3533171_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3533167_3533755_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3533751_3534459_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3534477_3536271_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3535102:3535117	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3536267_3537386_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3539659_3539929_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001230444.1|3541308_3541908_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3541975_3545449_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3545582_3546110_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3546300_3546933_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3546878_3547622_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3547632_3548331_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3548330_3548660_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|3548656_3551236_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|3551216_3551630_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3551656_3552088_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3552101_3552842_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3552823_3553090_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3553147_3553495_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3553531_3555037_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3555026_3556619_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3556615_3556822_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3556805_3558734_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3558997_3560536_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3560585_3560933_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3560929_3561310_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3561385_3561661_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3562411_3562618_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3562873_3563146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3563305_3563839_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3564059_3564173_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3564394_3564580_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3565107_3565422_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3566778_3568629_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3569396_3570110_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3570730_3571549_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3571700_3572072_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3572061_3572433_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3572445_3573495_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3573496_3573775_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3573942_3574098_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3574199_3574337_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3574702_3575476_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3575827_3576241_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3576256_3577027_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3577048_3577795_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3577801_3578893_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3578971_3579427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3579633_3580059_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3580042_3580315_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3580423_3580825_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3580852_3581044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3581043_3581331_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3581608_3581764_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3581905_3582295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3582481_3582667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3583240_3583429_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3583425_3583617_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3583710_3586182_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3586249_3586492_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3586469_3587489_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3587896_3588556_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3590321:3590336	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	3876599	3914696	5545879	terminase,protease,holin,integrase,tail,portal,lysis	Enterobacteria_phage(51.16%)	50	3876184:3876198	3914770:3914784
3876184:3876198	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3876599_3877298_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3877528_3878410_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3878579_3878741_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3879237_3880257_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3880290_3881271_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3881447_3881717_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3881718_3883035_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3883094_3883694_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3883764_3887178_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3887238_3887847_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3887783_3888527_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3888532_3889231_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3889240_3889570_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3889569_3892635_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3892606_3892936_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3892944_3893331_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3893391_3894135_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3894145_3894547_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3894543_3895122_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3895133_3895409_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3895401_3895725_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3895811_3897839_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3897783_3898119_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3898240_3899365_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3899292_3899505_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3899501_3901604_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3901603_3902095_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3902769_3902922_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3902909_3903377_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3903373_3903871_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3903870_3904086_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3904228_3904627_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3904707_3904866_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3904951_3905695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3905878_3906568_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3906582_3906705_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3907042_3908002_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3908213_3908879_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3908875_3909496_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3909488_3909659_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3909655_3909838_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3910535_3911216_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3911212_3911395_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3911367_3911559_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3911569_3911851_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3911949_3912171_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3912381_3912984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3913226_3913394_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3913433_3913652_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3913925_3914696_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3914770:3914784	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038357	Escherichia coli O157:H7 strain F7508 chromosome, complete genome	5545879	4493619	4544864	5545879	tail,transposase,plate,integrase	Enterobacteria_phage(23.81%)	51	4493190:4493204	4529425:4529439
4493190:4493204	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4493619_4494801_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4495763_4496507_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4497330_4498104_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4498161_4498716_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4498745_4499240_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4499239_4499833_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4499804_4500248_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4500268_4500664_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4500978_4501290_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4502241_4502535_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4502653_4502854_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4502954_4503668_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4503795_4504185_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4504424_4504670_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4505739_4506993_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4507004_4508108_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4508395_4509451_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4509489_4509891_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4509948_4511193_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4511284_4511743_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4512003_4513461_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4513517_4514075_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4513986_4514253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4514559_4515012_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4515021_4515420_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4515422_4515716_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4515767_4516823_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4516893_4517679_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4517623_4519363_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4520180_4520954_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4521139_4521400_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4521418_4521679_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4521834_4522575_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4522545_4523313_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4523417_4523996_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4524235_4526680_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4526722_4527196_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4527349_4528120_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4528237_4529410_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4529490_4529676_+	protein YncO	NA	NA	NA	NA	NA
4529425:4529439	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4529590_4529854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4530055_4531816_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4531818_4532955_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001452927.1|4533700_4534234_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4534302_4538517_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4538592_4540734_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4540943_4541462_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4542158_4542659_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4542693_4542918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4542968_4544360_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4544450_4544864_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038359	Escherichia coli O157:H7 strain F7508 plasmid pF7508-1, complete sequence	92704	29207	37999	92704	transposase,integrase	Macacine_betaherpesvirus(66.67%)	6	25777:25790	32365:32378
25777:25790	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|31911_32250_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|32837_34004_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
32365:32378	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|34003_34975_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|36274_37999_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
