The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	1229873	1243310	5520652	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229873_1230485_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230481_1231147_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231143_1231767_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232019_1232763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232848_1233016_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233423_1235277_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235426_1235642_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235646_1235991_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236347_1236728_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236724_1237072_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237689_1237959_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238119_1238542_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238671_1239730_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239808_1240459_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240641_1241232_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241733_1241982_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242827_1243310_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	1522207	1527633	5520652	integrase	Enterobacteria_phage(50.0%)	6	1511195:1511211	1529829:1529845
1511195:1511211	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522207_1522777_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522776_1523244_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523230_1523911_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523920_1525057_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525231_1526389_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526700_1527633_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529829:1529845	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	1771914	1873358	5520652	protease,tRNA,head,holin,terminase,capsid,tail,integrase,portal	Enterobacteria_phage(44.44%)	117	1855132:1855191	1870662:1870731
WP_000569336.1|1771914_1772841_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1772845_1773577_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1773557_1773665_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1773724_1774426_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1774446_1775733_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1775766_1776021_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1776039_1776174_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1776177_1776420_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1776507_1776870_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1776866_1777223_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1777556_1777733_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1777734_1778682_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1778678_1778900_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1778998_1779280_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1779290_1779482_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1779454_1779637_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1779636_1780314_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1780310_1781096_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1781101_1781398_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1781473_1781764_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1782267_1783875_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1783981_1784674_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1785037_1785577_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1785573_1786593_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1786589_1787291_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1787287_1787572_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1787799_1787997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1788040_1788322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1788412_1788514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1788510_1788966_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1788965_1789136_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1789128_1789419_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1789415_1789778_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1789774_1789915_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1790000_1790435_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1790683_1790836_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1791639_1793586_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1793723_1793903_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1793943_1794189_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1794266_1794482_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1794486_1795020_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1795290_1795860_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1795859_1796006_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1796233_1796419_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1796936_1797413_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1797409_1799533_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1799529_1799742_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1799741_1801244_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1801188_1803213_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1803300_1803627_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1803619_1803901_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1803903_1804527_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1804539_1804938_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1804945_1805698_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1805711_1806134_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1806160_1806469_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847298.1|1809154_1809484_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1809483_1810182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1810192_1810936_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1810881_1811511_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|1811751_1815231_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|1815298_1815898_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268854.1|1815962_1817132_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|1817133_1817403_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1817563_1817980_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1818061_1818703_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1818864_1819113_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1819627_1821313_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1821309_1822029_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1822075_1822546_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1822587_1823049_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1823173_1825177_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1825173_1826310_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1826302_1827034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1827052_1828582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1828592_1829681_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1830921_1831239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1831300_1834930_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1841886_1843920_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1844051_1845161_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1845422_1845704_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1845995_1846538_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1846625_1847300_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1847315_1849796_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1849806_1850841_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1850922_1851261_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1851478_1852330_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1852450_1852723_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1852832_1853147_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1853156_1853504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1854554_1854794_-	hypothetical protein	NA	NA	NA	NA	NA
1855132:1855191	attL	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGT	NA	NA	NA	NA
WP_021500177.1|1855234_1856455_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.0	1.5e-133
WP_000775337.1|1856451_1857225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748513.1|1857316_1857541_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_077696851.1|1857551_1858283_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|1858275_1858461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748511.1|1858460_1858652_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	3.8e-07
WP_024748510.1|1858641_1858884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748509.1|1858889_1859189_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021500345.1|1859185_1861318_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_024165893.1|1861690_1861942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294169.1|1861938_1862244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|1862253_1862664_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024165864.1|1862676_1862949_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021500171.1|1863236_1864394_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	65.1	5.6e-138
WP_000987369.1|1864448_1865006_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_000267605.1|1865007_1866219_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020667.1|1866215_1866554_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.3e-29
WP_000137525.1|1866550_1866844_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	63.9	1.4e-32
WP_001145909.1|1866843_1867284_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.1	2.9e-55
WP_001196871.1|1867267_1867450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1867573_1867930_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_024748508.1|1867913_1869575_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_021500174.1|1869589_1869871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1870889_1871678_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
1870662:1870731	attR	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGTGGTCAGTTTT	NA	NA	NA	NA
WP_000822268.1|1871674_1872475_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1872539_1873358_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
>prophage 4
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	1974638	2050765	5520652	protease,transposase,head,lysis,holin,terminase,capsid,tail,integrase	Stx2-converting_phage(58.02%)	95	1965589:1965603	1981012:1981026
1965589:1965603	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1974638_1975817_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1975797_1975989_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1976066_1976411_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1976598_1976949_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1977815_1978763_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1978759_1978981_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1979079_1979361_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1979371_1979563_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1979535_1979718_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1979714_1980395_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|1980391_1981177_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1981012:1981026	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|1981182_1981479_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1981553_1981697_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1981665_1981830_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1981902_1982271_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1982453_1982705_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1982763_1983036_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1983013_1983196_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1983764_1984286_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1984787_1985483_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1985557_1985773_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1985914_1986211_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1986243_1986405_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1986391_1987213_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1987209_1988586_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1988664_1989276_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1989739_1990072_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1990204_1990420_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1990430_1990667_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1990623_1991070_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1991066_1991594_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1991590_1991773_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1992047_1992812_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1992886_1993609_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1993608_1994214_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1994210_1994882_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1994872_1995361_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1996010_1996970_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1996981_1997251_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1997547_1997871_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_024748507.1|1998114_2000052_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.5	0.0e+00
WP_000143458.1|2000188_2000368_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2000408_2000681_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2000757_2000973_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2000972_2001470_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2001466_2001904_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2002106_2002604_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2002600_2002858_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2003320_2003548_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2003589_2003955_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2004245_2004809_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|2005477_2006691_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|2007843_2009781_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2009825_2010047_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2012573_2012900_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2012909_2013260_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2013256_2013703_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2013699_2014044_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2014102_2014819_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2014824_2015199_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2015294_2015504_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2015555_2018798_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2018790_2019132_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2019131_2019830_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2019846_2020167_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2020274_2020448_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2020518_2021442_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_024748453.1|2021495_2022233_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	98.4	5.0e-148
WP_129137391.1|2022178_2022811_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_000515107.1|2023071_2026551_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2026617_2027217_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2027281_2028595_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2028596_2028866_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2029006_2029882_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2030106_2030757_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2032080_2033247_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2033365_2033839_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2034037_2035096_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2035267_2035597_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2035697_2035880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2036368_2036482_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2036494_2036689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2037147_2037516_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2037589_2037811_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2037873_2038350_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2038364_2038844_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2038925_2039747_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2039967_2040378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2040393_2041077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2041212_2042283_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2042279_2043185_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2043181_2044063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2044046_2045260_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2045631_2047779_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2049226_2050765_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	2075745	2118734	5520652	transposase,head,holin,terminase,capsid,tail,portal	Escherichia_phage(32.56%)	52	NA	NA
WP_001171554.1|2075745_2076126_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2076122_2076470_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2076519_2078058_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000094838.1|2078609_2078813_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2078871_2081343_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2081438_2081627_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2081623_2081812_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2082292_2082445_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2082719_2083364_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2083461_2083689_+	cell division protein	NA	NA	NA	NA	NA
WP_024748451.1|2084178_2085216_+	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2085127_2085670_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2085704_2086403_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2086424_2086649_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2086645_2087002_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2087034_2087187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2087183_2087495_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2087621_2088185_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2088294_2088399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2088585_2088798_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2088965_2089244_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2089245_2090295_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2090307_2090667_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2090663_2091353_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2092892_2094743_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2094824_2096038_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2096348_2096564_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2096568_2096913_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2096963_2097497_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2097652_2097835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2097847_2097979_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2098206_2098392_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2098918_2099233_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2099314_2099539_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2099933_2100443_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2100414_2102343_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2102326_2102533_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2102529_2104122_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2104111_2105617_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2105653_2106001_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2106058_2106325_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2106306_2107047_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2107060_2107492_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2107518_2107932_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2107912_2110492_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2110488_2110818_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2110817_2111516_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_024748514.1|2111526_2112270_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_050546863.1|2112215_2112848_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001230509.1|2116629_2117229_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|2117293_2118463_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|2118464_2118734_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 6
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	2176317	2196303	5520652	tail,integrase,transposase	Enterobacteria_phage(75.0%)	28	2189439:2189452	2199445:2199458
WP_032161583.1|2176317_2177454_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2177404_2177728_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2177885_2179070_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2179069_2179582_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2179636_2180002_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2180010_2180166_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2182968_2183457_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2183613_2184186_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2184229_2184760_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2185851_2186166_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2186170_2187130_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2187206_2190029_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2189439:2189452	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2190035_2190401_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2190397_2191015_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2191026_2191326_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2191322_2191589_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2191585_2191789_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2191812_2192229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2192321_2192435_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2192431_2192674_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2192685_2192964_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2192974_2193325_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2193346_2193550_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2193621_2193759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2193848_2194253_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2194268_2194919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2194948_2195296_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2195301_2196303_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2199445:2199458	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	2516849	2600614	5520652	protease,transposase,head,holin,terminase,capsid,tail,portal	Stx2-converting_phage(37.74%)	88	NA	NA
WP_001260835.1|2516849_2517671_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2517770_2517854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2517946_2518282_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2518678_2519932_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2520038_2520932_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2521066_2522287_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2522411_2523107_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2523059_2524352_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2524509_2525124_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2525166_2526021_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2526022_2526640_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2526650_2529074_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2529134_2531561_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2531759_2532065_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2532172_2532883_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2532885_2533446_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2533480_2533822_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2533956_2534283_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2535271_2535523_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2535595_2538067_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2538159_2538351_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2538347_2538536_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2538936_2539101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2539104_2539323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2539394_2539694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2540046_2540325_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2540326_2540518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2540538_2540910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2541007_2541310_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2541306_2541732_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_077696847.1|2541754_2542717_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	56.7	4.0e-81
WP_000788936.1|2542723_2543464_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2544274_2544670_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2544726_2545311_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2545426_2545531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2545719_2545932_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2546099_2546378_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2546379_2547429_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2547441_2547801_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2547797_2548487_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2549123_2549552_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2550030_2551881_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2552320_2552536_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2552540_2552885_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2552935_2553469_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2553739_2554309_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2554308_2554455_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2554682_2554868_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2555292_2555520_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2555561_2555927_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2556216_2556780_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2556776_2558438_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2558501_2560439_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2560483_2560705_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2560650_2563152_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2563231_2563558_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2563567_2563918_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2563914_2564361_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2564357_2564702_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2564760_2565477_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2565491_2565866_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2565961_2566171_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2566218_2569461_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2569453_2569795_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2569794_2570493_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_024748465.1|2570503_2571247_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	6.6e-148
WP_129137391.1|2571192_2571825_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2572071_2575551_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230495.1|2575617_2576217_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748463.1|2576281_2577595_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2577596_2577866_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_162829200.1|2579514_2580728_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001079499.1|2585263_2585770_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2585815_2586316_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2586401_2586581_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2586961_2587768_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2587767_2588961_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2588972_2590334_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2590334_2591930_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2591929_2593492_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2593583_2593628_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2593765_2594647_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2594643_2595264_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2595291_2596875_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2597087_2597960_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2597999_2598590_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2598586_2599345_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2599564_2600614_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	2873332	3029970	5520652	transposase,head,holin,terminase,capsid,tail,integrase,portal	Stx2-converting_phage(29.38%)	190	2984736:2984750	3031182:3031196
WP_000214712.1|2873332_2873536_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2873571_2875032_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2875120_2876404_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2876535_2876778_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2876939_2877581_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2877662_2878292_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2878364_2878940_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2879053_2879323_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2879324_2880638_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230508.1|2880702_2881302_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171879493.1|2881369_2884849_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
WP_129137391.1|2885095_2885728_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748465.1|2885673_2886417_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	6.6e-148
WP_024748466.1|2886427_2887126_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	5.6e-133
WP_000847298.1|2887125_2887455_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748467.1|2887451_2890064_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2890044_2890458_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2890484_2890907_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2890920_2891673_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2891680_2892076_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2892072_2892606_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2892620_2892974_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2892985_2893384_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_024748468.1|2893425_2894451_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	9.6e-190
WP_001295978.1|2894506_2894839_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2894848_2896168_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2896148_2897750_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2897746_2897953_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748469.1|2897949_2899875_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|2899849_2900395_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2900781_2901006_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2901087_2901402_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2901927_2902113_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2902335_2902482_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2902481_2903051_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2903321_2903855_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2903905_2904250_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2904254_2904470_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_024748470.1|2904909_2906760_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001302123.1|2907237_2907669_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2908119_2908833_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2908968_2909166_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2909390_2909945_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2910007_2910313_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2910325_2911375_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2911376_2911649_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2911770_2912115_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2912234_2912447_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2912680_2913238_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2913239_2913458_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2913585_2913897_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2913889_2914117_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2914113_2914395_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2914427_2915144_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2915177_2915639_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2915631_2916675_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2916743_2917169_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2917152_2917395_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2917786_2918125_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2918417_2918570_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2918581_2919220_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2919220_2919430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2919994_2920183_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2920179_2920368_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2920460_2921705_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2922415_2922658_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2923620_2924001_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2923997_2924345_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2924394_2925933_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2926515_2927166_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2927875_2928451_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2928564_2928834_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_024748471.1|2928835_2930005_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	3.6e-84
WP_001230508.1|2930069_2930669_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2930736_2930952_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|2930954_2934215_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_162829348.1|2934380_2935593_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_024748472.1|2935715_2936153_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2936152_2936494_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2936486_2939729_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2939776_2939986_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2940081_2940456_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2940470_2941187_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2941245_2941590_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2941586_2942033_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2942029_2942380_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2942389_2942716_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2942795_2945297_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2945242_2945464_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2945508_2947446_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2947509_2949171_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2949167_2949731_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|2950019_2950385_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2950426_2950651_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2950732_2951047_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2951574_2951760_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|2951976_2952474_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_024164617.1|2952473_2952689_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_024748518.1|2953127_2954978_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|2955469_2956528_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|2956678_2956876_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|2957102_2957924_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|2957920_2958295_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|2959358_2959637_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|2959702_2959870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2960166_2960379_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2960567_2960672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2960787_2961150_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2961146_2961518_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2961553_2961766_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2961814_2962171_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2962227_2962623_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|2962638_2963409_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|2963438_2964179_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2964185_2965139_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2965161_2965587_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2965570_2965846_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2965948_2966338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|2966507_2966660_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|2967147_2967336_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2967332_2967521_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_024748517.1|2967613_2970058_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.9e-176
WP_000113189.1|2970122_2970371_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|2970348_2971479_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_001345079.1|2972778_2973429_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2974935_2975526_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2975709_2976357_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2976493_2976640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2977067_2977346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2977685_2978066_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2978062_2978410_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2978459_2979998_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2982662_2983988_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
2984736:2984750	attL	CCCACTACTGCCGCT	NA	NA	NA	NA
WP_001023474.1|2985014_2985284_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|2985285_2986599_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001228304.1|2986750_2987350_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2987417_2989763_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2989714_2990890_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2991232_2991865_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|2991810_2992554_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|2992564_2993263_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2993262_2993604_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2993596_2996839_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2996891_2997101_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2997196_2997571_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2997576_2998293_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2998351_2998696_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2998692_2999139_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2999135_2999486_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2999495_2999822_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2999901_3002403_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3002348_3002570_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3002614_3004552_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_024748457.1|3004615_3006277_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_001303051.1|3006273_3006837_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3007126_3007492_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3007533_3007761_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3008185_3008371_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3008598_3008745_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3008744_3009314_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3009584_3010118_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3010168_3010513_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3010517_3010733_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3010882_3012736_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3013532_3014591_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3014741_3014939_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3015180_3015711_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3015719_3016079_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3016091_3017138_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3017139_3017418_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3017487_3017745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3017965_3018178_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3018456_3019215_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3019913_3020078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3020074_3020656_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3020842_3021385_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3021296_3022337_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3022308_3022860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3022843_3023071_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3023147_3023555_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3023818_3024118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3024190_3024409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3024431_3024839_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3024816_3025050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3025043_3025211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3025608_3025797_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3025793_3025985_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3026077_3028549_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3028613_3028862_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3028839_3029970_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3031182:3031196	attR	AGCGGCAGTAGTGGG	NA	NA	NA	NA
>prophage 9
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	3076666	3170358	5520652	protease,transposase,head,tRNA,lysis,holin,terminase,capsid,tail,integrase,portal	Enterobacteria_phage(49.06%)	100	3099864:3099879	3164261:3164276
WP_001299679.1|3076666_3077923_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3078136_3078760_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3078759_3079611_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3079761_3080709_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3080833_3082513_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3082567_3082846_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3083123_3083708_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3083824_3084916_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3085759_3088645_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3088744_3090664_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3091370_3091982_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3092081_3092996_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3093091_3094828_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3094985_3096199_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3096536_3097607_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3097616_3098915_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3099277_3100810_+	SpoVR family protein	NA	NA	NA	NA	NA
3099864:3099879	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3100861_3101581_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3101802_3103344_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3103489_3104020_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3104065_3105334_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3105333_3105753_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3106125_3107037_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3107243_3107705_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3107781_3108441_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3108512_3108806_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3108817_3108976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3109046_3109448_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3109550_3109919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3110438_3111134_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3111157_3111970_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3111973_3112240_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3113471_3114056_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3114554_3115508_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3115694_3117179_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3117481_3119020_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3119069_3119417_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3119413_3119794_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3119869_3120118_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3120174_3120843_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3121340_3121523_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3121601_3122102_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3122138_3122645_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3122663_3123554_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3123673_3124255_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3124254_3127170_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3127234_3127834_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3127900_3131299_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3131359_3131992_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3131928_3132672_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3132677_3133376_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3133375_3133705_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001509030.1|3133701_3136251_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_024748456.1|3136243_3136678_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479161.1|3136659_3137082_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3137097_3137838_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3137845_3138241_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3138237_3138816_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3138827_3139181_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3139192_3139591_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3139632_3140658_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3140712_3141045_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3141054_3142374_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3142354_3143956_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3143952_3144159_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748455.1|3144155_3146081_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3146055_3146601_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3146989_3147184_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3147348_3147555_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3147840_3148251_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3148542_3148836_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3148926_3149109_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3149325_3149802_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3149788_3150094_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3150415_3151105_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3151101_3151242_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3151238_3151601_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3151597_3151888_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3151880_3152051_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3152050_3152506_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3153007_3154534_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3154591_3154714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3154778_3155111_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3155178_3155481_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3155477_3156179_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3157103_3157340_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3157329_3158472_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3158585_3159836_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3160007_3160661_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3160670_3161132_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3161185_3162292_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3162327_3162969_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3162972_3164343_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3164261:3164276	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3164511_3165183_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3165182_3166643_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3167243_3167525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3167780_3168323_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3168528_3168942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3168954_3169290_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3169302_3170358_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	3176450	3235104	5520652	transposase,head,holin,terminase,capsid,tail,integrase,portal	Enterobacteria_phage(26.32%)	72	3220671:3220691	3241761:3241781
WP_032174463.1|3176450_3177668_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3177666_3178879_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3179241_3180363_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3180411_3181638_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3181887_3183024_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3183007_3183871_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3184234_3185596_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3185656_3185932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3188240_3191642_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3192232_3194581_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3194600_3194690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3194702_3194939_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3194884_3195622_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3195675_3196554_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3196856_3196967_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3197076_3197331_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3197347_3198046_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3198045_3198387_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3198379_3201622_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3201669_3201879_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3201974_3202349_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3202363_3203080_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3203138_3203483_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3203479_3203926_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3203922_3204273_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3204282_3204609_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3204688_3207190_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3207135_3207357_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3207401_3209339_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3209402_3211064_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3211060_3211624_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3211915_3212281_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3212322_3212508_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3212637_3212778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3213134_3213359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3213423_3213630_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3213857_3214004_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3214003_3214573_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3214843_3215377_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3215427_3215772_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3215776_3215992_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3216067_3216337_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3216374_3216557_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3216704_3218642_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3218956_3219124_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3219720_3220542_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3220538_3220913_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3220671:3220691	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3220925_3221975_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3221976_3222255_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3222422_3222635_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3222823_3222928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3223043_3223631_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3223633_3223825_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3223826_3224264_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3224250_3224568_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3224521_3224839_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3224828_3225131_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3225127_3225409_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3225441_3226158_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3226191_3226734_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3226645_3227683_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3227751_3228177_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3228160_3228484_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3228608_3229085_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3229400_3229553_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3229667_3230183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3230315_3230705_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3230766_3231036_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3231004_3232123_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3232289_3233084_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3233080_3234127_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3234282_3235104_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3241761:3241781	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	3486087	3541423	5520652	protease,transposase,head,holin,capsid,tail,integrase,portal	Escherichia_phage(25.58%)	62	3488022:3488037	3543188:3543203
WP_000003653.1|3486087_3486675_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3486671_3487379_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3487397_3489191_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3488022:3488037	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3489187_3490306_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3492298_3492568_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3492569_3493883_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3493947_3494547_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_024748504.1|3494614_3498088_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649827.1|3498221_3498749_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3498939_3499572_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_024748503.1|3499517_3500261_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.8	5.6e-147
WP_024748502.1|3500271_3500970_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000847298.1|3500969_3501299_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748501.1|3501295_3503875_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533440.1|3503855_3504269_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3504295_3504718_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_032254564.1|3504731_3505472_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	1.5e-131
WP_001301534.1|3505453_3505720_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3505777_3506125_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3506161_3507667_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3507656_3509249_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3509245_3509452_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3511628_3513167_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3513216_3513564_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3513560_3513941_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3514016_3514292_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3515042_3515249_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3515504_3515777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3515936_3516470_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3516690_3516804_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3517025_3517211_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3517738_3518053_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3518257_3519471_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3519646_3521497_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3522263_3522977_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3523597_3524416_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3524567_3524939_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3524928_3525300_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3525312_3526362_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3526363_3526642_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3526809_3526965_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3527066_3527204_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3527569_3528343_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3528694_3529108_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3529123_3529894_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3529915_3530662_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3530668_3531760_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3531838_3532294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3532500_3532926_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3532909_3533182_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3533290_3533692_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3533719_3533911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3533910_3534198_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3534475_3534631_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3534772_3535162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3535348_3535534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3536107_3536296_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3536292_3536484_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3536577_3539049_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3539116_3539359_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3539336_3540356_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3540763_3541423_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3543188:3543203	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	3553882	3689632	5520652	protease,tRNA,head,plate,lysis,holin,terminase,capsid,tail,integrase,portal	Escherichia_phage(38.03%)	128	3612345:3612363	3703304:3703322
WP_000156526.1|3553882_3555643_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3555711_3556230_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3556299_3556467_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759107.1|3556722_3557286_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445550.1|3557282_3558923_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333170.1|3558927_3560181_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053083.1|3560310_3562218_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_001086511.1|3562229_3564338_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224291.1|3564581_3565691_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001301917.1|3565687_3566230_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3566403_3567414_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000919496.1|3568226_3568742_-	fimbrial protein	NA	NA	NA	NA	NA
WP_077626202.1|3568749_3569277_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165679.1|3569304_3570375_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001303867.1|3572989_3573691_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750295.1|3573773_3574313_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263919.1|3574668_3575244_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244347.1|3575236_3576196_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055981.1|3576192_3577338_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235210.1|3577349_3578141_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3578137_3578905_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|3578947_3581560_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|3581825_3583028_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|3583196_3584597_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|3585199_3586288_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|3586472_3587663_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|3587713_3588361_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3588387_3588936_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925977.1|3589116_3590964_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|3591224_3595685_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001302273.1|3595684_3596389_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288845.1|3596369_3597692_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001301572.1|3597688_3598474_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3598609_3599389_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3599365_3600259_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011613.1|3600412_3601159_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3601155_3601338_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056545.1|3601389_3602622_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570541.1|3602658_3603645_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3603641_3605390_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705685.1|3605426_3607691_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3607897_3608182_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3608341_3610015_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3610125_3610809_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000799175.1|3610981_3611746_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3611914_3613198_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
3612345:3612363	attL	GCGCCCATTTTTTCCAGCA	NA	NA	NA	NA
WP_000057165.1|3613268_3614357_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642854.1|3614555_3615248_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001301741.1|3615377_3617138_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642546.1|3617543_3618401_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|3618455_3620738_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|3621056_3621275_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882928.1|3621356_3622520_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	6.6e-203
WP_000978907.1|3622519_3622999_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|3623013_3625461_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|3625453_3625573_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3625605_3625881_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3625937_3626456_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286688.1|3626468_3627659_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	2.8e-225
WP_000905107.1|3627718_3628312_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	3.9e-103
WP_001127579.1|3628342_3628753_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	95.2	3.2e-64
WP_001008235.1|3628773_3629217_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_000639074.1|3629188_3629584_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_000216974.1|3629592_3630786_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	87.2	1.0e-158
WP_001285340.1|3630782_3631394_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121474.1|3631386_3632295_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127145.1|3632299_3632647_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	5.5e-57
WP_001093691.1|3632643_3633279_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.9e-111
WP_001001773.1|3633345_3633798_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_000917149.1|3633790_3634258_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001440152.1|3634220_3634394_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040640.1|3634365_3634791_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
WP_000736606.1|3634778_3635204_-	hypothetical protein	NA	M1SV74	Escherichia_phage	95.0	1.2e-56
WP_001144101.1|3635218_3635716_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3635715_3635997_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|3636000_3636204_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3636203_3636713_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203428.1|3636812_3637556_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_001248570.1|3637559_3638633_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	2.5e-201
WP_001085975.1|3638691_3639546_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_000156847.1|3639719_3641492_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_000038152.1|3641491_3642526_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	2.1e-200
WP_000997853.1|3642865_3644698_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	6.9e-90
WP_000268620.1|3644814_3647097_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027664.1|3647086_3647362_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001153795.1|3647358_3647583_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	4.2e-34
WP_001277959.1|3647582_3647885_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	2.9e-46
WP_000557703.1|3647884_3648109_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|3648172_3648673_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|3648669_3648840_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000022051.1|3648850_3649207_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|3649311_3649623_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|3649716_3650712_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3650743_3651541_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918514.1|3651750_3653181_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3653390_3654539_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3654853_3655480_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3655515_3656379_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213047.1|3656380_3656998_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|3657008_3659453_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|3659691_3660984_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3661074_3662418_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3662428_3663040_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076999.1|3663194_3667223_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3667357_3667852_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3668396_3669362_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043606.1|3669484_3671251_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202230.1|3671251_3672973_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
WP_001241680.1|3673014_3673719_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3674003_3674222_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3674908_3677185_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3677215_3677536_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000562896.1|3678514_3679438_-|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000006076.1|3679427_3679589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|3679600_3680089_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_001018605.1|3680218_3680380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|3680383_3680578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164427.1|3680708_3680954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761784.1|3681305_3683054_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
WP_000770151.1|3683050_3683350_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000659213.1|3683587_3683779_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_001368837.1|3683957_3684161_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201464.1|3684360_3684540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|3684674_3684899_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000775337.1|3684990_3685764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085207.1|3685760_3686984_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000410785.1|3687388_3687613_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3687685_3689632_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3703304:3703322	attR	TGCTGGAAAAAATGGGCGC	NA	NA	NA	NA
>prophage 13
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	3811752	3849847	5520652	protease,lysis,holin,terminase,tail,integrase,portal	Enterobacteria_phage(51.22%)	48	3811337:3811351	3849921:3849935
3811337:3811351	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3811752_3812451_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3812681_3813563_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3813731_3813893_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3814389_3815409_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3815442_3816423_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3816599_3816869_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3816870_3818187_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3818246_3818846_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_001508920.1|3822390_3822999_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	7.1e-100
WP_000194779.1|3822935_3823679_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3823684_3824383_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3824392_3824722_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3824721_3827787_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3827758_3828088_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3828096_3828483_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3828543_3829287_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3829297_3829699_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3829695_3830274_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3830285_3830561_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3830553_3830877_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3830963_3832991_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3832935_3833271_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3833392_3834517_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3834444_3834657_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3834653_3836756_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3837920_3838073_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3838060_3838528_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3838524_3839022_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3839021_3839237_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3839379_3839778_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3839858_3840017_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3840102_3840846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3841029_3841719_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3841733_3841856_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3842193_3843153_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3843364_3844030_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3844026_3844647_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3844639_3844810_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3844806_3844989_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3845686_3846367_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3846363_3846546_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3846518_3846710_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3846720_3847002_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3847100_3847322_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3847532_3848135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3848377_3848545_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3848584_3848803_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3849076_3849847_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3849921:3849935	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	4393200	4473756	5520652	protease,transposase,head,plate,lysis,holin,terminase,capsid,tail,integrase,portal	Shigella_phage(45.0%)	96	4430318:4430364	4469854:4469900
WP_000998048.1|4393200_4394739_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4394788_4395136_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4395132_4395513_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4395776_4396040_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4396039_4396180_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4396249_4396441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4397265_4397808_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4397882_4398470_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4398527_4399196_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4399221_4401747_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4401736_4403380_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4403348_4404059_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4404371_4404701_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4404948_4405563_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4405980_4406670_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4406666_4407623_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4407619_4409818_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4409827_4410784_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4410962_4412090_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4412231_4413290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4413535_4414438_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4415140_4415419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4415585_4416308_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4416406_4417306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4417981_4418938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4419070_4421404_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4421417_4421741_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4421740_4421962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4421958_4422516_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4422512_4422773_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4423706_4424459_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4424455_4425007_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4425012_4425285_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4425694_4426261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4426260_4426851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4426881_4427514_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4427506_4427965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4427964_4428582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4428554_4428971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4428974_4430156_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4430318:4430364	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4431118_4431862_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4432686_4433460_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4433520_4434075_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4434105_4434516_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4434536_4434980_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4434951_4435554_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4435553_4436324_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4436327_4436912_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4436902_4437961_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4437947_4438373_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4438372_4438921_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4438920_4440000_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4439996_4441325_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4441385_4443221_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4443362_4443632_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4443631_4443988_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4443987_4445484_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4445467_4445638_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4445646_4446207_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4446203_4446710_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4446684_4447095_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4447091_4447415_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4447493_4448723_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4448733_4449336_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4449328_4450555_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4450544_4450706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4450702_4452199_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4452432_4452927_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4453329_4454542_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4455241_4455535_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4455625_4455808_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4456024_4456501_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4456504_4456840_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4456976_4457270_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4457548_4457782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4457925_4458465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4458679_4459432_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4459445_4460435_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4460442_4461252_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4461271_4461661_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4461657_4461984_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4461980_4462634_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4462633_4463128_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4463124_4464066_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4464055_4464235_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4464410_4464962_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4464954_4465215_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4465312_4466005_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4466282_4466579_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4467255_4467792_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4467782_4468145_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4468144_4468450_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4468676_4469840_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4470044_4471298_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4469854:4469900	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4471309_4472413_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4472700_4473756_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	4908207	4920783	5520652	integrase	Enterobacteria_phage(81.82%)	15	4907241:4907256	4925736:4925751
4907241:4907256	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4908207_4909035_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4909252_4909447_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4909802_4912136_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4912150_4912471_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4912606_4913062_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4913054_4913342_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4913334_4913925_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4913921_4914188_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4914739_4915474_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4915470_4915971_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4916044_4916617_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4916942_4918187_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4918224_4918959_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4919035_4919341_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4919508_4920783_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4925736:4925751	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 16
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	4953203	5012231	5520652	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4953203_4954556_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4954649_4955201_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4955356_4956730_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4956905_4957904_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4957936_4958932_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4958918_4959941_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4959954_4961457_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4961596_4962553_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4962862_4963393_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4963472_4963823_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4963816_4964068_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4964279_4964621_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4964623_4968403_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4968399_4970133_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4970338_4970977_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4971299_4972643_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4972738_4972945_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4973269_4973824_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4973886_4974825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4975036_4975777_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4975966_4977910_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4978027_4978408_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4978496_4979357_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4979464_4980430_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4980537_4981200_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4981244_4982657_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4982965_4983586_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4983803_4984442_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4984576_4985785_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4985792_4986224_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4986846_4987641_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4987711_4988161_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4988202_4988430_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4988434_4988749_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4988755_4989151_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4989477_4989753_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4989881_4990568_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4990567_4991422_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4991431_4992082_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4992095_4992560_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4992569_4992875_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4992890_4994288_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4995814_4996570_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4996566_4997316_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4997497_4997827_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4997975_4998251_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4998367_4999993_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5000076_5001240_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5001242_5001881_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5001890_5002289_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5002306_5002966_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5003016_5003715_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5003733_5004135_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5004261_5004993_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5005173_5007615_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5007653_5008079_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5008283_5009582_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5009685_5009883_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5009964_5010969_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5010971_5012231_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038355	Escherichia coli O157:H7 str. F8092B chromosome, complete genome	5520652	5149111	5163776	5520652	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5144952:5144967	5162481:5162496
5144952:5144967	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5149111_5150527_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5150609_5151593_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5151758_5152001_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5152134_5153172_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5153260_5154358_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5154419_5154668_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5154828_5155470_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5155551_5156181_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5156253_5156826_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5156937_5157207_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5157208_5158522_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5158586_5159186_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5160507_5161044_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5161034_5161385_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5161381_5161666_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5162001_5162199_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5162543_5162825_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5162481:5162496	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5162872_5163046_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5163242_5163776_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038356	Escherichia coli O157:H7 str. F8092B plasmid pF8092B-1, complete sequence	98062	0	36850	98062	transposase,integrase	Stx2-converting_phage(54.55%)	33	18975:18989	42711:42725
WP_001302175.1|2588_3464_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|3464_5432_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|5431_6937_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|6938_8162_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|8192_8627_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|8623_9178_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|9192_9540_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|9536_10136_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|10132_11110_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|11148_12321_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|12307_12820_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|12877_13711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|13802_14204_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000998048.1|15924_17463_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|17512_17860_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|17856_18237_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000839950.1|18544_19060_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
18975:18989	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|19061_22058_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|22107_24228_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|24231_25671_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001171554.1|26519_26900_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|26896_27244_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|27293_28832_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_077696845.1|28828_29095_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_001066920.1|29215_29956_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|30240_31218_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|31625_31826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|31822_32443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|32439_33123_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|33581_33800_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|33801_34107_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|34107_34914_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|35636_36850_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
42711:42725	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
