The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	1220503	1245995	5569928	transposase,integrase,tail,holin	Enterobacteria_phage(29.41%)	29	1212770:1212784	1246866:1246880
1212770:1212784	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_162829202.1|1220503_1221717_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001071599.1|1221908_1222115_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1222437_1223643_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1223644_1224958_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1224954_1226586_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1226586_1226985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1227082_1227496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064234917.1|1227891_1229178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1229253_1229589_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1229591_1230347_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1230694_1231261_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1231235_1231847_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231843_1232509_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1232505_1233129_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1233381_1234125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1234210_1234378_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1234785_1236639_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1236788_1237004_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1237008_1237353_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1237709_1238090_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1238086_1238434_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1238934_1240148_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1240365_1240635_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240795_1241218_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241347_1242406_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242484_1243135_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132159.1|1243317_1243917_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1244418_1244667_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245512_1245995_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1246866:1246880	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	1523573	1528999	5569928	integrase	Enterobacteria_phage(50.0%)	6	1512561:1512577	1531195:1531211
1512561:1512577	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1523573_1524143_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1524142_1524610_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1524596_1525277_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1525286_1526423_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1526597_1527755_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1528066_1528999_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1531195:1531211	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	1776337	1853903	5569928	holin,tRNA,protease,portal,transposase,terminase,tail	Enterobacteria_phage(65.43%)	90	NA	NA
WP_000569336.1|1776337_1777264_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1777268_1778000_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1777980_1778088_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1778147_1778849_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1778869_1780156_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1780189_1780444_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1780462_1780597_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1780600_1780843_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1780930_1781293_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1781289_1781646_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1781979_1782156_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1782157_1783105_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1783101_1783323_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1783421_1783703_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1783713_1783905_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1783877_1784060_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1784059_1784737_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1784733_1785519_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1785524_1785821_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1785896_1786040_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1786008_1786173_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_162829202.1|1786468_1787681_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001066169.1|1788187_1788769_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1788785_1789058_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1789570_1790122_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1790128_1790410_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1790532_1791180_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1791288_1791507_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1791624_1791921_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_074458080.1|1791953_1792220_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	3.7e-37
WP_162829202.1|1792222_1793436_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000788906.1|1794201_1794903_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1794899_1795190_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1795260_1795539_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1795671_1795887_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1795897_1796134_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1796090_1796537_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1796533_1797061_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1797057_1797234_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1797236_1797638_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1797597_1797807_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1797799_1798405_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1798401_1798596_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1798588_1799023_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1799529_1800477_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1800486_1800756_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_171877602.1|1801266_1803213_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.8	0.0e+00
WP_000143458.1|1803350_1803530_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1803570_1803816_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1803893_1804109_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1804113_1804647_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1804917_1805487_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1805486_1805633_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1805860_1806046_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1806257_1806530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1806562_1807039_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1807035_1809159_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1809155_1809368_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1809367_1810870_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_162829202.1|1811776_1812990_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001097065.1|1814239_1814566_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1814558_1814840_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1814842_1815466_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1815478_1815877_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1815884_1816637_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1816650_1817073_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1817099_1817408_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_171877603.1|1817451_1820097_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	96.8	0.0e+00
WP_000847298.1|1820093_1820423_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1820422_1821121_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1821131_1821875_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1821820_1822450_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1822690_1823866_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1823817_1826163_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1826230_1826830_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1826894_1828208_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1828209_1828479_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1828846_1829095_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1829609_1831295_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1831291_1832011_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1832057_1832528_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1832569_1833031_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1833155_1835159_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1835155_1836292_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1836284_1837016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1837034_1838564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1838574_1839663_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1840903_1841221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877604.1|1841282_1844912_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1851869_1853903_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	1968853	2096693	5569928	holin,capsid,integrase,head,protease,bacteriocin,portal,transposase,lysis,terminase,tail	Stx2-converting_phage(30.63%)	173	1959804:1959818	1977070:1977084
1959804:1959818	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1968853_1970032_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1970012_1970204_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1970285_1970630_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000669868.1|1970656_1970824_-	hypothetical protein	NA	A0A0P0ZEM3	Stx2-converting_phage	100.0	6.4e-27
WP_000203820.1|1970866_1971499_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	100.0	1.8e-114
WP_000795072.1|1971822_1972551_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	99.6	2.3e-129
WP_000610378.1|1972646_1973012_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	100.0	7.1e-71
WP_001289954.1|1973873_1974821_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1974817_1975039_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1975137_1975419_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548546.1|1975429_1975621_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_000682304.1|1975593_1975776_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186743.1|1975772_1976453_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	99.6	1.2e-132
WP_000100847.1|1976449_1977235_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
1977070:1977084	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995439.1|1977240_1977537_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1977612_1977756_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198863.1|1977724_1977889_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000065377.1|1977961_1978330_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|1978480_1978951_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1979009_1979393_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745483.1|1979881_1980046_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1980048_1981095_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1981088_1981550_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1981617_1981959_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1982019_1982727_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1982805_1983033_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|1983171_1983468_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|1983500_1984439_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|1984435_1985137_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1985133_1985424_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1985494_1985773_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|1985904_1986120_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|1986130_1986367_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_115449729.1|1986323_1986770_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	99.3	2.4e-81
WP_000153288.1|1986766_1987294_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000335902.1|1987475_1988525_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|1988676_1989399_+	phage antirepressor KilAC domain-containing protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107955.1|1989398_1990004_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|1990000_1990195_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|1990187_1990622_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|1991405_1992365_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1992376_1992646_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|1993132_1995070_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|1995204_1995384_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1995424_1995697_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1995773_1995989_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|1995993_1996527_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|1996801_1997371_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1997370_1997520_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1997527_1997992_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1998023_1998317_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001086069.1|1998725_1999532_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1999512_2001219_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|2001218_2003363_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|2003520_2004528_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|2004551_2005766_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|2005821_2006211_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|2006260_2006722_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|2006705_2007269_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|2007268_2007919_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000117994.1|2007915_2009853_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|2009854_2010124_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|2010263_2010452_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|2010746_2012372_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|2012368_2013637_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|2013651_2013930_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|2013935_2014553_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|2014643_2015378_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|2015610_2015751_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|2015807_2016209_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_171877605.1|2016302_2016959_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	99.5	1.2e-108
WP_000455644.1|2016961_2017408_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|2017417_2017669_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|2017679_2018945_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331673.1|2019014_2027396_+	hypothetical protein	NA	A0A0P0ZCJ1	Stx2-converting_phage	100.0	0.0e+00
WP_000756595.1|2027946_2028291_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|2028410_2028623_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|2028856_2029252_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000206751.1|2029251_2029869_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000212746.1|2029872_2030160_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|2030161_2030380_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|2030381_2030597_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|2030598_2030787_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_171877606.1|2030938_2031712_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	98.4	9.5e-142
WP_000774248.1|2031708_2031930_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|2032028_2032310_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_171877607.1|2032320_2032512_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	98.4	7.3e-27
WP_001303590.1|2032484_2032667_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186880.1|2032666_2033344_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	98.7	5.1e-131
WP_000100845.1|2033340_2034126_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995487.1|2034131_2034428_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2034502_2034646_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2034614_2034779_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2034851_2035220_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2035402_2035654_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2035712_2035985_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2035962_2036145_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2036713_2037235_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2037736_2038432_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2038508_2038724_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2038865_2039162_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2039194_2039356_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2039342_2040164_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2040160_2041537_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2041607_2041886_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2042018_2042234_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|2042244_2042481_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001455574.1|2042437_2042884_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	99.3	4.1e-81
WP_171877608.1|2042880_2043408_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	99.4	3.6e-100
WP_001254256.1|2043404_2043587_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208497.1|2043861_2044590_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	95.6	3.6e-114
WP_000849633.1|2044845_2045526_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2045600_2046323_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2046322_2046928_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2046924_2047596_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2047586_2048075_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2048724_2049684_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2049695_2049965_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2050261_2050585_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_171877609.1|2050828_2052766_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	98.8	0.0e+00
WP_000143458.1|2052903_2053083_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2053123_2053396_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2053472_2053688_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2053687_2054185_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2054181_2054619_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2054821_2055319_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2055315_2055573_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2056035_2056263_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2056304_2056670_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958365.1|2056957_2057521_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_001301491.1|2057517_2059179_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2059242_2061180_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2061224_2061446_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171877610.1|2061391_2063971_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125988.1|2063973_2064300_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2064309_2064660_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2064656_2065103_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2065099_2065444_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2065509_2066226_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710962.1|2066240_2066615_+|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001453698.1|2066710_2066920_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2066973_2070216_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2070208_2070550_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2070549_2071248_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2071264_2071585_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2071692_2071866_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2071936_2072860_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|2072913_2073651_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|2073596_2074229_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_171877611.1|2074488_2077980_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.3	0.0e+00
WP_001230550.1|2078050_2078650_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_171877612.1|2078714_2080028_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	1.0e-79
WP_001023452.1|2080029_2080299_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2080439_2081315_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2081539_2082190_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2083513_2084680_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2084798_2085272_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2085470_2086529_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2086700_2087030_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2087130_2087313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2087801_2087915_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2087927_2088122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2088580_2088949_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2089022_2089244_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_171877613.1|2089306_2089783_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2089797_2090277_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2090358_2091180_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2091400_2091811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2091826_2092510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|2092645_2093716_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2093712_2094618_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2094614_2095496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2095479_2096693_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
>prophage 5
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	2100659	2167876	5569928	holin,capsid,integrase,head,portal,transposase,terminase,tail	Escherichia_phage(34.78%)	68	2094986:2095001	2152064:2152079
2094986:2095001	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000998048.1|2100659_2102198_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2102247_2102595_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2102591_2102972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2103333_2103879_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2103875_2104619_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2104630_2105710_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2105771_2106707_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2107163_2108081_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2108182_2109133_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2111519_2112236_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2112578_2114033_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2114134_2115451_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2115764_2116817_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2117078_2125061_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2125550_2126348_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2126583_2127606_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2127605_2127809_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2127867_2130339_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2130434_2130623_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2130619_2130808_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2131288_2131441_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2131715_2132360_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2132457_2132685_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2132681_2133107_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2133175_2134213_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2134124_2134667_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2134701_2135400_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2135421_2135646_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2135642_2135999_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2136031_2136184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2136180_2136492_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2136618_2137182_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2137291_2137396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2137582_2137795_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2137962_2138241_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2138242_2139292_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2139304_2139664_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2139660_2140350_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2140983_2141412_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2141889_2143740_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2143821_2145035_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2145345_2145561_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2145565_2145910_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2145960_2146494_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2146649_2146832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2146844_2146976_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2147203_2147389_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2147915_2148230_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2148311_2148536_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2148930_2149440_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2151322_2151529_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2151525_2153118_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2152064:2152079	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2153107_2154613_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2154649_2154997_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2155054_2155321_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2155302_2156043_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2156056_2156488_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2156514_2156928_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|2156908_2159488_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|2159484_2159814_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2159813_2160512_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2160522_2161266_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_171877650.1|2161211_2161841_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.4	1.4e-98
WP_001356361.1|2162081_2163257_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_171877649.1|2163208_2165560_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230508.1|2165627_2166227_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|2166291_2167605_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2167606_2167876_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	2225456	2246755	5569928	transposase,integrase,tail	Enterobacteria_phage(72.0%)	29	2239891:2239904	2249897:2249910
WP_050543672.1|2225456_2226536_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
WP_162829202.1|2226538_2227752_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132765.1|2227856_2228180_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2228337_2229522_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2229521_2230034_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2230088_2230454_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2230462_2230618_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2233420_2233909_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2234065_2234638_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2234681_2235212_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2236303_2236618_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2236622_2237582_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123465.1|2237658_2240481_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
2239891:2239904	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2240487_2240853_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2240849_2241467_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2241478_2241778_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2241774_2242041_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2242037_2242241_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2242264_2242681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2242773_2242887_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2242883_2243126_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2243137_2243416_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2243426_2243777_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2243798_2244002_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2244073_2244211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2244300_2244705_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2244720_2245371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2245400_2245748_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2245753_2246755_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2249897:2249910	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	2567297	2691331	5569928	capsid,holin,tRNA,head,protease,portal,transposase,terminase,tail	Escherichia_phage(32.14%)	145	NA	NA
WP_001260835.1|2567297_2568119_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2568218_2568302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2568394_2568730_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2569126_2570380_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2570486_2571380_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2571514_2572735_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2572859_2573555_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2573507_2574800_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2574957_2575572_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2575614_2576469_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2576470_2577088_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2577098_2579522_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2579582_2582009_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2582207_2582513_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2582620_2583331_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2583333_2583894_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2583928_2584270_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2584404_2584731_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2585719_2585971_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2586043_2588515_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2588607_2588799_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2588795_2588984_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2589384_2589549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2589552_2589771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2589842_2590142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2590494_2590773_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2590774_2590966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2590986_2591358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2591455_2591758_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2591754_2592180_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2592202_2593165_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2593171_2593912_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2594722_2595118_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2595174_2595759_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2595874_2595979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2596167_2596380_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2596547_2596826_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2596827_2597877_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2597889_2598249_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2598245_2598935_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2599574_2600003_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_039102530.1|2600481_2602332_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2602771_2602987_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2602991_2603336_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2603386_2603920_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2604190_2604760_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2604759_2604906_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2605133_2605319_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2605743_2605971_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2606012_2606378_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2606667_2607231_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_171877621.1|2607227_2608889_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2608952_2610890_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2610934_2611156_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2611101_2613603_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2613682_2614009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2614018_2614369_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2614365_2614812_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2614808_2615153_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|2615211_2615928_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|2615933_2616308_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2616403_2616613_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|2616665_2619746_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|2619738_2620080_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2620079_2620517_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2620704_2623965_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2623967_2624183_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2624250_2624850_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2624914_2626138_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2626139_2626409_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_162829202.1|2626625_2627839_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|2628698_2630144_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|2630143_2631454_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|2631629_2632538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|2632867_2633431_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|2633451_2634684_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2634938_2635922_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2636196_2636367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2636399_2637773_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2637901_2638837_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2638888_2640124_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2640125_2640341_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2640440_2640629_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2640666_2640816_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2640871_2641681_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105153.1|2641673_2644274_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	6.7e-248
WP_001344816.1|2644375_2644651_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2644725_2644896_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2644895_2645117_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2645558_2646047_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2646043_2646199_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2646209_2646389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2646631_2647051_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2647130_2647385_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2647381_2647804_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2647881_2648670_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2648676_2649423_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2649445_2650207_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2650222_2650645_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|2650750_2650963_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|2651214_2651478_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|2651488_2651650_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2651728_2651974_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2652405_2653557_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2653524_2654514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2654513_2655905_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000940319.1|2656404_2657004_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|2657003_2657294_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2657290_2657845_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2658406_2658838_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143077.1|2659412_2661266_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|2661415_2661631_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|2661635_2661980_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|2662030_2662564_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|2662837_2663533_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|2663627_2663759_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|2663981_2664167_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|2664567_2664894_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|2665025_2665226_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|2665267_2665633_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|2665921_2666485_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|2666481_2668143_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|2668206_2670144_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|2670188_2670410_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2672936_2673263_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|2673272_2673623_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|2673619_2674066_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|2674062_2674407_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|2674475_2675192_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|2675197_2675572_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|2675667_2675877_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171877622.1|2675928_2679171_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.1	0.0e+00
WP_000807964.1|2679163_2679505_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_171877623.1|2679504_2680203_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	4.9e-129
WP_171877624.1|2680213_2680957_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	2.7e-149
WP_064732755.1|2680902_2681535_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|2681725_2682253_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|2682386_2685884_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|2685954_2686554_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|2686618_2687932_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|2687933_2688203_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|2688315_2688891_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2688963_2689593_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2689674_2690316_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2690896_2691331_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	2871853	2928083	5569928	capsid,holin,head,portal,transposase,terminase,tail	Escherichia_phage(35.94%)	71	NA	NA
WP_000214712.1|2871853_2872057_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2872092_2873553_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2873641_2874925_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2875056_2875299_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143808.1|2875460_2876102_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|2876183_2876813_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2876885_2877461_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|2877574_2877844_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2877845_2879069_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2879133_2879733_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171877628.1|2879800_2883280_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_123007081.1|2883520_2884150_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|2884095_2884839_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2884849_2885548_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2885547_2885877_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171877629.1|2885873_2888486_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2888466_2888880_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2888906_2889329_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2889342_2890095_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2890102_2890498_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2890494_2891028_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2891042_2891396_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2891407_2891806_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2891847_2892873_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2892928_2893261_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2893270_2894590_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2894570_2896172_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2896168_2896375_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|2896371_2898297_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|2898271_2898817_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001303940.1|2899203_2899428_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2899509_2899824_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2900349_2900535_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2900757_2900904_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2900903_2901473_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2901744_2902278_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2902328_2902673_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2902677_2902893_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2903331_2905182_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2905659_2906091_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2906541_2907255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2907390_2907588_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2907812_2908367_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2908429_2908735_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2908747_2909797_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2909798_2910071_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2910192_2910537_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2910656_2910869_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2911102_2911660_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2911661_2911880_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2912007_2912319_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2912311_2912539_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2912535_2912817_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2912849_2913566_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2913599_2914061_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2914053_2915097_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2915165_2915591_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2915574_2915817_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2916208_2916547_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2916839_2916992_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2917003_2917642_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2917642_2917852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2918416_2918605_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2918601_2918790_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2918882_2920127_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2920837_2921080_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171547.1|2922042_2922423_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	5.5e-66
WP_000612591.1|2922419_2922767_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2922816_2924355_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2924937_2925588_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_162829202.1|2926870_2928083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 9
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	3006203	3120115	5569928	plate,capsid,holin,head,protease,transposase,terminase,tail	Escherichia_phage(25.53%)	138	NA	NA
WP_000422055.1|3006203_3007253_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3007472_3008231_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3008227_3008818_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3008857_3009730_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3009942_3011526_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3011553_3012174_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3012170_3013052_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3013189_3013234_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|3013325_3014888_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3014887_3016483_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|3016483_3017845_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|3017856_3019050_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3019049_3019856_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3020236_3020416_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3020501_3021002_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3021047_3021554_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001345079.1|3022867_3023518_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3025024_3025615_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3025798_3026446_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3026582_3026729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3027156_3027435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3027774_3028155_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_171877631.1|3028151_3028499_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_000998048.1|3028548_3030087_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3031052_3031622_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3031687_3032599_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3032705_3032828_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3034425_3035751_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023993.1|3036777_3037047_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	94.4	1.6e-43
WP_171877632.1|3037048_3038272_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.3	3.7e-79
WP_001228289.1|3038336_3038936_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_115801855.1|3039003_3041349_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|3041300_3042476_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3042818_3043451_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3043396_3044140_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|3044150_3044849_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807950.1|3044848_3045190_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3045182_3048425_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3048477_3048687_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3048782_3049157_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275477.1|3049162_3049879_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
WP_000133393.1|3049947_3050292_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|3050288_3050735_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|3050731_3051082_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|3051091_3051418_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|3053944_3054166_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3054210_3056148_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3056211_3057873_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3057869_3058433_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3058722_3059088_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3059129_3059357_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3059781_3059967_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3060194_3060341_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3060340_3060910_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3061180_3061714_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3061764_3062109_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3062113_3062329_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000528251.1|3064335_3065073_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|3065026_3065227_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3065341_3065806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3065844_3066090_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3066125_3066308_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3066454_3068494_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3068593_3069154_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|3069376_3069580_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|3069659_3070181_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|3070215_3071127_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|3071126_3071687_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3071677_3072760_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|3072759_3073197_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3073189_3073804_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3073793_3074918_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|3074901_3076251_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|3076237_3078313_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|3078439_3078916_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3078930_3079296_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|3079304_3080807_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3080803_3081049_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3081049_3081610_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3081606_3082026_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002060.1|3082022_3082391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3082434_3083382_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|3083381_3084506_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|3084682_3085156_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|3085274_3086600_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|3086583_3088173_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|3088172_3089837_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|3089836_3090418_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|3090420_3090711_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|3090707_3091016_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|3090996_3091224_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3091233_3091452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3091435_3091864_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3091898_3092399_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3092470_3092896_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|3092965_3093475_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3093471_3093768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3093757_3093955_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|3093947_3094280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3094318_3094504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|3094500_3095052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|3095055_3095571_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|3095570_3096104_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|3096107_3096650_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|3096747_3097278_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|3097289_3097583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3097587_3097860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3097856_3098138_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3098139_3098394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|3098406_3098628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3098630_3099563_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|3099633_3101724_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|3101725_3101974_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|3102164_3102695_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000935548.1|3103870_3104929_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3105079_3105277_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3105518_3106049_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3106057_3106417_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3106429_3107476_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3107477_3107756_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3107825_3108083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3108303_3108516_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3108794_3109553_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3110251_3110416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3110412_3110994_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3111180_3111723_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3111634_3112675_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3112646_3113198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3113181_3113409_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3113485_3113893_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_162829202.1|3114281_3115494_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001171903.1|3115841_3116060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3116082_3116490_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3116467_3116701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|3116694_3116838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3117174_3117363_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3117359_3117551_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171877633.1|3117643_3120115_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
>prophage 10
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	3168232	3324814	5569928	capsid,holin,tRNA,integrase,head,protease,portal,transposase,lysis,terminase,tail	Enterobacteria_phage(35.19%)	175	3310381:3310401	3331471:3331491
WP_001299679.1|3168232_3169489_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3169702_3170326_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3170325_3171177_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3171327_3172275_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3172399_3174079_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3174133_3174412_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3174689_3175274_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3175390_3176482_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3179303_3180374_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3180384_3181017_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3181027_3182446_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3184477_3184678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3184785_3185808_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3185807_3186788_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3186784_3187543_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3188361_3189216_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3189241_3191212_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3191261_3191516_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020150.1|3191716_3192451_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3192452_3193064_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3193163_3194078_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3194173_3195910_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3196301_3197372_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3197381_3198680_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3199042_3200575_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3200626_3201346_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3201567_3203109_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3203254_3203785_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3203830_3205099_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3205098_3205518_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3205890_3206802_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3207008_3207470_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3207546_3208206_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3208277_3208571_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3208582_3208741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3208811_3209213_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3209315_3209684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3210203_3210899_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3210922_3211735_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3211738_3212005_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3213170_3214384_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3214557_3215142_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3215640_3216594_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3216780_3218265_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171877651.1|3218567_3220160_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.8e-299
WP_162829202.1|3220143_3221357_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3221469_3221817_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3221813_3222194_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3222269_3222518_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3222574_3223243_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3223740_3223923_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3224001_3224502_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3224538_3225045_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3225063_3225954_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_171877634.1|3226073_3226655_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	1.4e-100
WP_000268883.1|3226654_3229570_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3229634_3230234_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3230300_3233699_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3233759_3234392_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3234328_3235072_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3235077_3235776_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3235775_3236105_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3236101_3238651_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3238643_3239078_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3239059_3239482_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3239497_3240238_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3240245_3240641_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3240637_3241216_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3241227_3241581_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3241592_3241991_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3242032_3243058_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3243113_3243446_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3243455_3244775_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3244755_3246357_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3246353_3246560_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3246556_3248482_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3248456_3249002_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3249390_3249585_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3249749_3249956_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3250241_3250652_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_171877635.1|3250943_3251237_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	97.9	1.7e-46
WP_010917798.1|3251327_3251510_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3251726_3252203_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3252189_3252495_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3252816_3253506_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3253502_3253643_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3253639_3254002_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3253998_3254289_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3254281_3254452_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3254451_3254907_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3255408_3256935_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3256992_3257115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3257179_3257512_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3257579_3257882_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3257878_3258580_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3259504_3259741_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3259730_3260873_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3260986_3262237_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3262408_3263062_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3263071_3263533_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3263586_3264693_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_171877636.1|3264728_3265370_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3265373_3266744_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3266912_3267584_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3267583_3269044_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001301987.1|3269119_3270241_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3270289_3271516_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3271765_3272902_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3272885_3273749_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3274112_3275474_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3275534_3275810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3278118_3281520_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3282110_3284459_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3284478_3284568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3284580_3284817_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3284762_3285500_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3285553_3286432_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3286734_3286845_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3286954_3287209_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3287225_3287924_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3287923_3288265_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3288257_3291500_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3291552_3291762_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3291857_3292232_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|3292237_3292954_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|3293012_3293357_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3293353_3293800_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3293796_3294147_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3294156_3294483_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171877637.1|3294562_3296902_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.2	0.0e+00
WP_001063099.1|3296847_3297069_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3297113_3299051_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3299114_3300776_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3300772_3301336_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3301625_3301991_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3302032_3302218_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3302347_3302488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3302844_3303069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3303133_3303340_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3303567_3303714_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3303713_3304283_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3304553_3305087_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3305137_3305482_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3305486_3305702_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3305777_3306047_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3306084_3306267_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3306414_3308352_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3308666_3308834_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3309430_3310252_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3310248_3310623_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3310381:3310401	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3310635_3311685_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3311686_3311965_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3312132_3312345_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3312533_3312638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3312753_3313341_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3313343_3313535_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3313536_3313974_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3313960_3314278_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3314231_3314549_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3314538_3314841_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3314837_3315119_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3315151_3315868_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3315901_3316444_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3316355_3317393_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3317461_3317887_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3317870_3318194_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3318318_3318795_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3319110_3319263_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3319377_3319893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3320025_3320415_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3320476_3320746_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3320714_3321833_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3321999_3322794_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3322790_3323837_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3323992_3324814_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3331471:3331491	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	3426215	3489636	5569928	transposase,integrase,protease	Escherichia_phage(33.33%)	60	3414333:3414346	3492722:3492735
3414333:3414346	attL	ACCATCGACAAACG	NA	NA	NA	NA
WP_162829202.1|3426215_3427429_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001455442.1|3427434_3429645_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001304206.1|3429641_3430157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3430397_3431444_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_162829197.1|3431624_3432837_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
WP_001287881.1|3433431_3433623_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3433675_3433909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3434004_3434628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167437.1|3434716_3435226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3435683_3436142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3437495_3438620_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3439349_3439547_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3439612_3439828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3440472_3440652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004880.1|3440703_3440898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3441678_3442014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3442646_3442865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3444317_3446408_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000301248.1|3447730_3448306_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3448374_3448953_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3449001_3450042_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3450064_3450520_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3450542_3451700_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3451699_3452281_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3452603_3453662_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3453671_3454814_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3454806_3455580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3455581_3456661_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3456660_3457617_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3457627_3458836_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3458853_3459321_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3459581_3459911_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3459897_3460239_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3461181_3462795_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3462825_3463176_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3463172_3463598_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000097913.1|3464742_3464916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397129.1|3465935_3466607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3467478_3467619_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3467920_3468184_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3469395_3470013_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3470024_3470699_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3470699_3471164_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3471173_3472877_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3472869_3473190_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3473198_3473501_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3473591_3474290_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3474670_3474946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3475170_3476790_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3476882_3477242_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3477927_3478218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3478241_3478493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3478540_3479146_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_171877618.1|3479456_3480669_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000282084.1|3481609_3482173_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335698.1|3482993_3484379_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3484597_3484795_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3485021_3485318_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3486429_3488247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3488433_3489636_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3492722:3492735	attR	CGTTTGTCGATGGT	NA	NA	NA	NA
>prophage 12
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	3582080	3637186	5569928	capsid,holin,integrase,head,protease,portal,transposase,tail	Stx2-converting_phage(26.19%)	61	3584015:3584030	3638951:3638966
WP_000003653.1|3582080_3582668_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3582664_3583372_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3583390_3585184_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3584015:3584030	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001455430.1|3585180_3586299_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3588290_3588560_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3588561_3589875_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3589939_3590539_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515110.1|3590606_3594080_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3594213_3594741_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3594931_3595564_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3595509_3596253_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_072617001.1|3596263_3596962_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|3596961_3597291_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171877638.1|3597287_3599867_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000533402.1|3599847_3600261_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3600287_3600719_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3600732_3601473_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3601454_3601721_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3601778_3602126_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3602162_3603668_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3603657_3605250_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3605246_3605453_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3607627_3609166_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3609215_3609563_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3609559_3609940_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3610015_3610291_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3611041_3611248_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3611503_3611776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3611935_3612469_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_171877639.1|3612689_3612803_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	8.7e-12
WP_012816791.1|3613024_3613210_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3613737_3614052_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3615408_3617259_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3618026_3618740_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3619360_3620179_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3620330_3620702_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3620691_3621063_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3621075_3622125_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3622126_3622405_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3622572_3622728_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3622829_3622967_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3623332_3624106_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3624457_3624871_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3624886_3625657_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3625678_3626425_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3626431_3627523_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3627601_3628057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3628263_3628689_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3628672_3628945_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3629053_3629455_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3629482_3629674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3629673_3629961_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3630238_3630394_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3630535_3630925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3631111_3631297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3631870_3632059_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3632055_3632247_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3632340_3634812_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3634879_3635122_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3635099_3636119_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3636526_3637186_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3638951:3638966	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	3883313	3924036	5569928	holin,integrase,protease,portal,transposase,lysis,terminase,tail	Enterobacteria_phage(50.0%)	51	3882898:3882912	3924110:3924124
3882898:3882912	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3883313_3884012_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3884242_3885124_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3885293_3885455_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3885951_3886971_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3887004_3887985_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3888161_3888431_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3888432_3889749_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3889808_3890408_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3890478_3893892_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3893952_3894561_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3894497_3895241_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3895246_3895945_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3895954_3896284_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_162829202.1|3897466_3898680_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001161009.1|3900633_3900963_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3900971_3901358_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3901418_3902162_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3902172_3902574_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3902570_3903149_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3903160_3903436_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3903428_3903752_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3903838_3905866_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3905810_3906146_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3906267_3907392_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3907319_3907532_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3907528_3909631_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3909630_3910122_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_162829202.1|3910655_3911868_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001139679.1|3912109_3912262_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3912249_3912717_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3912713_3913211_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3913210_3913426_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3913568_3913967_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3914047_3914206_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3914291_3915035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3915218_3915908_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3915922_3916045_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3916382_3917342_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_171877641.1|3917553_3918219_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	2.5e-130
WP_001108055.1|3918215_3918836_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3918828_3918999_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3918995_3919178_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3919875_3920556_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3920552_3920735_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3920707_3920899_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3920909_3921191_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3921289_3921511_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3921721_3922324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3922566_3922734_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3922773_3922992_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3923265_3924036_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3924110:3924124	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	4435751	4494570	5569928	transposase,holin	Escherichia_phage(30.0%)	48	NA	NA
WP_000131044.1|4435751_4437785_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|4437913_4438501_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|4438514_4439987_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159114.1|4440000_4441689_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
WP_001356433.1|4442370_4442505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301820.1|4443621_4443759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303994.1|4443850_4444435_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213041.1|4444588_4445350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|4445895_4447108_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001356435.1|4447752_4447965_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001302816.1|4449057_4449753_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4449745_4451173_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4451183_4451903_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|4452429_4453284_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4453509_4454835_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4454943_4455180_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4455191_4455785_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_162829202.1|4456173_4457387_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000621002.1|4458375_4459233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092594.1|4459353_4463607_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001038968.1|4464940_4465297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302814.1|4465584_4466511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4466667_4467588_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182335.1|4467822_4468965_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000998048.1|4469776_4471315_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4471364_4471712_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4471708_4472089_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4472352_4472616_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4472615_4472756_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4472825_4473017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4473841_4474384_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4474458_4475046_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4475103_4475772_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4475797_4478323_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4478312_4479956_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4479924_4480635_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4480947_4481277_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4481524_4482139_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4482556_4483246_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4483242_4484199_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4484195_4486394_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4486403_4487360_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4487538_4488666_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4488807_4489866_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4490111_4491014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4491716_4491995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4492161_4492884_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162829202.1|4493356_4494570_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 15
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	4506853	4558105	5569928	transposase,integrase,tail,plate	Escherichia_phage(25.0%)	50	4506424:4506438	4542648:4542662
4506424:4506438	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4506853_4508035_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4508997_4509741_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4510564_4511338_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4511395_4511950_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4511979_4512474_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4512473_4513067_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4513038_4513482_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4513502_4513898_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4514212_4514524_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4515475_4515769_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4515887_4516088_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4516188_4516902_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4517029_4517419_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4517658_4517904_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4518973_4520227_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4520238_4521342_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000174701.1|4522712_4523114_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4523171_4524416_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4524507_4524966_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4525226_4526684_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4526740_4527298_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4527209_4527476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4527782_4528235_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4528244_4528643_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4528645_4528939_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4528990_4530046_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4530116_4530902_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4530846_4532586_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4533403_4534177_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4534362_4534623_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4534641_4534902_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4535057_4535798_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4535768_4536536_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4536640_4537219_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4537458_4539903_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4539945_4540419_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4540572_4541343_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4541460_4542633_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4542713_4542899_+	protein YncO	NA	NA	NA	NA	NA
4542648:4542662	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4542813_4543077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4543278_4545039_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4545041_4546178_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451375.1|4546923_4547475_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4547543_4551758_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4551833_4553975_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4554184_4554703_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4555399_4555900_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4555934_4556159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4556209_4557601_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4557691_4558105_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP038351	Escherichia coli O157:H7 strain F8798 chromosome, complete genome	5569928	5198397	5213062	5569928	tRNA,integrase,tail	Enterobacteria_phage(43.75%)	19	5194238:5194253	5211767:5211782
5194238:5194253	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5198397_5199813_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5199895_5200879_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5201044_5201287_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5201420_5202458_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5202546_5203644_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5203705_5203954_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5204114_5204756_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5204837_5205467_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5205539_5206112_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5206223_5206493_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5206494_5207808_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5207872_5208472_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5209793_5210330_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5210320_5210671_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5210667_5210952_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5211287_5211485_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5211829_5212111_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5211767:5211782	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5212158_5212332_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_171877653.1|5212528_5213062_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	9.0e-99
