The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	1220956	1244451	5399622	tail,transposase,integrase,holin	Enterobacteria_phage(33.33%)	27	1212602:1212616	1245322:1245336
1212602:1212616	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1220956_1222162_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222163_1223477_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223473_1225105_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225105_1225504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225601_1226015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150578.1|1226410_1227655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227730_1228066_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228068_1228824_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229159_1229726_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229700_1230312_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230308_1230974_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1230970_1231594_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231846_1232590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232675_1232843_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233250_1235104_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235253_1235469_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235473_1235818_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236174_1236555_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236551_1236899_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237399_1238613_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238830_1239100_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239260_1239683_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239812_1240871_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1240949_1241600_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241782_1242373_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242874_1243123_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1243968_1244451_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245322:1245336	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	1522029	1527455	5399622	integrase	Enterobacteria_phage(50.0%)	6	1511017:1511033	1529651:1529667
1511017:1511033	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522029_1522599_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522598_1523066_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523052_1523733_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523742_1524879_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525053_1526211_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526522_1527455_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529651:1529667	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	1773074	1780655	5399622	transposase	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569336.1|1773074_1774001_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1774005_1774737_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774717_1774825_-	protein YohO	NA	NA	NA	NA	NA
WP_001240409.1|1774884_1775616_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_001301761.1|1775837_1777523_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1777519_1778239_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1778285_1778756_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1778797_1779259_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_162829202.1|1779442_1780655_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	1928384	2000780	5399622	head,transposase,terminase,capsid,integrase,portal,holin,tail	Escherichia_phage(34.78%)	69	1927891:1927906	1984969:1984984
1927891:1927906	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1928384_1929598_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1929969_1932117_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1933564_1935103_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1935152_1935500_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1935496_1935877_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1936238_1936784_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1936780_1937524_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1937535_1938615_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1938676_1939612_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1940068_1940986_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1941087_1942038_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1944424_1945141_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1945483_1946938_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1947039_1948356_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1948669_1949722_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1949983_1957966_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|1958455_1959253_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|1959488_1960511_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|1960510_1960714_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|1960772_1963244_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|1963339_1963528_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|1963524_1963713_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|1964193_1964346_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|1964620_1965265_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1965362_1965590_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1965586_1966012_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|1966080_1967118_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|1967029_1967572_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|1967606_1968305_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1968326_1968551_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1968547_1968904_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1968936_1969089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1969085_1969397_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1969523_1970087_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1970196_1970301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1970487_1970700_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|1970867_1971146_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1971147_1972197_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1972209_1972569_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|1972565_1973255_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|1973888_1974317_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|1974794_1976645_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|1976726_1977940_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|1978250_1978466_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|1978470_1978815_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1978865_1979399_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1979554_1979737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1979749_1979881_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1980108_1980294_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1980820_1981135_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1981216_1981441_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1981835_1982345_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|1984227_1984434_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1984430_1986023_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
1984969:1984984	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|1986012_1987518_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1987554_1987902_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1987959_1988226_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1988207_1988948_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1988961_1989393_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1989419_1989833_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|1989813_1991676_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_001304129.1|1991627_1992392_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.0	3.3e-134
WP_000847298.1|1992388_1992718_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1992717_1993416_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1993426_1994170_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1994115_1994745_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001230508.1|1998531_1999131_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|1999195_2000509_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2000510_2000780_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	2058422	2078405	5399622	tail,transposase,integrase	Enterobacteria_phage(75.0%)	28	2071541:2071554	2081547:2081560
WP_032161728.1|2058422_2059556_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2059506_2059830_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2059987_2061172_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2061171_2061684_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2061738_2062104_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2062112_2062268_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2065070_2065559_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2065715_2066288_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2066331_2066862_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2067953_2068268_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2068272_2069232_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2069308_2072131_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2071541:2071554	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2072137_2072503_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2072499_2073117_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2073128_2073428_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2073424_2073691_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2073687_2073891_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2073914_2074331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2074423_2074537_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2074533_2074776_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2074787_2075066_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2075076_2075427_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2075448_2075652_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2075723_2075861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2075950_2076355_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2076370_2077021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2077050_2077398_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2077403_2078405_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2081547:2081560	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	2397637	2487498	5399622	head,transposase,terminase,capsid,portal,holin,tail,protease	Stx2-converting_phage(40.35%)	96	NA	NA
WP_001260835.1|2397637_2398459_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2398558_2398642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2398734_2399070_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2399466_2400720_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2400826_2401720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2401854_2403075_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2403199_2403895_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2403847_2405140_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2405297_2405912_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2405954_2406809_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2406810_2407428_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001473553.1|2407438_2409862_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	4.8e-208
WP_000041704.1|2409922_2412349_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2412547_2412853_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2412960_2413671_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2413673_2414234_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2414268_2414610_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2414744_2415071_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2416059_2416311_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2416383_2418855_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2418947_2419139_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2419135_2419324_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2419724_2419889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2419892_2420111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2420182_2420482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2420834_2421113_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2421114_2421306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2421326_2421698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2421795_2422098_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2422094_2422520_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2422542_2423505_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2423511_2424252_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2425062_2425458_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2425514_2426099_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2426214_2426319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2426507_2426720_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2426887_2427166_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2427167_2428217_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2428229_2428589_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2428585_2429275_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2429913_2430342_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2430820_2432671_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2433110_2433326_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2433330_2433675_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2433725_2434259_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2434529_2435099_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2435098_2435245_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2435472_2435658_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2436082_2436310_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2436351_2436717_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2437006_2437570_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2437566_2439228_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2439291_2441229_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2441273_2441495_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_098049823.1|2441440_2444020_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.7	0.0e+00
WP_000125988.1|2444022_2444349_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2444358_2444709_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2444705_2445152_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2445148_2445493_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275500.1|2445551_2446268_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_001030063.1|2446273_2446648_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2446743_2446953_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|2447005_2450086_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|2450078_2450420_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2450419_2450857_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000514792.1|2451044_2454521_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001228304.1|2454588_2455188_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2455339_2456653_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2456654_2456924_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2457950_2459276_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2460873_2460996_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2461102_2462014_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2462079_2462649_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2463614_2465153_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2465202_2465550_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2465546_2465927_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2466266_2466545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2466972_2467119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2467255_2467903_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2468086_2468677_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001079499.1|2472147_2472654_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2472699_2473200_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2473285_2473465_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2473845_2474652_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2474651_2475845_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2475856_2477218_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2477218_2478814_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2478813_2480376_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2480467_2480512_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2480649_2481531_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2481527_2482148_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2482175_2483759_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2483971_2484844_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2484883_2485474_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2485470_2486229_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2486448_2487498_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	2565618	2631733	5399622	head,transposase,terminase,capsid,tRNA,portal,holin,tail	Escherichia_phage(46.27%)	79	NA	NA
WP_162829202.1|2565618_2566832_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|2567691_2569137_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|2569136_2570447_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|2570622_2571531_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|2571860_2572424_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|2572444_2573677_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2573931_2574915_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2575189_2575360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2575392_2576766_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2576894_2577830_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2577881_2579117_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2579118_2579334_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2579433_2579622_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2579659_2579809_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2579864_2580674_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2580666_2583267_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2583368_2583644_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2583718_2583889_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2583888_2584110_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2584551_2585040_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2585036_2585192_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2585202_2585382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2585624_2586044_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2586123_2586378_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2586374_2586797_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2586874_2587663_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2587669_2588416_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2588438_2589200_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2589215_2589638_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|2589743_2589956_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|2590207_2590471_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|2590481_2590643_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2590721_2590967_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2591398_2592550_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2592517_2593507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2593506_2594898_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000940319.1|2595397_2595997_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|2595996_2596287_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2596283_2596838_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2597399_2597831_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_098049826.1|2598405_2600256_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_024180155.1|2600694_2600910_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2600914_2601259_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2601309_2601843_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2602113_2602683_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2602682_2602829_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2603051_2603237_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2603762_2604077_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2604158_2604383_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2604769_2605315_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2605289_2607215_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2607211_2607418_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2607414_2609016_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2608996_2610316_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2610325_2610658_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2610713_2611739_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2611780_2612179_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2612190_2612544_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2612558_2613092_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2613088_2613484_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2613491_2614244_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2614257_2614680_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2614706_2615120_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2615100_2617713_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2617709_2618039_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2618038_2618737_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2618747_2619491_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2619436_2620066_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514945.1|2620306_2623786_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2623853_2624453_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2624517_2625741_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2625742_2626012_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2626125_2626701_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2626773_2627403_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2627484_2628126_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2628287_2628530_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2628661_2629945_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2630033_2631494_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2631529_2631733_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	2813701	2862162	5399622	head,terminase,capsid,integrase,portal,holin,tail	Stx2-converting_phage(38.78%)	61	2806585:2806599	2865044:2865058
2806585:2806599	attL	TTTTGACTTTCTGCT	NA	NA	NA	NA
WP_001295593.1|2813701_2814136_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2814716_2815358_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2815439_2816069_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2816141_2816717_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2816829_2817099_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2817100_2818414_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2818478_2819078_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2819148_2822646_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2822779_2823307_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2823497_2824130_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2824075_2824819_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2824829_2825528_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2825527_2825869_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_137054077.1|2825861_2829104_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.6	0.0e+00
WP_001453746.1|2829151_2829361_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2829456_2829831_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2829845_2830562_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2830627_2830972_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2830968_2831415_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2831411_2831762_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2831771_2832098_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2832100_2834680_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|2834625_2834847_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2834891_2836829_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2836892_2838554_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2838550_2839114_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2839403_2839769_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2839810_2840038_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2840462_2840648_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2840875_2841022_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2841021_2841591_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2841861_2842395_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2842445_2842790_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2842794_2843010_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2843159_2845013_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2845809_2846868_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2847018_2847216_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2847457_2847988_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2847996_2848356_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2848368_2849415_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2849416_2849695_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2849764_2850022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2850242_2850455_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2850733_2851492_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2852190_2852355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2852351_2852933_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2853119_2853662_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2853573_2854614_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2854585_2855137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2855120_2855348_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2855424_2855832_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2856095_2856395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2856467_2856686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2856708_2857116_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2857093_2857327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2857320_2857464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2857800_2857989_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2857985_2858177_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2858269_2860741_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2860805_2861054_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2861031_2862162_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2865044:2865058	attR	TTTTGACTTTCTGCT	NA	NA	NA	NA
>prophage 9
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	2908858	3118503	5399622	plate,head,transposase,terminase,capsid,tRNA,integrase,portal,holin,tail,lysis,protease	Enterobacteria_phage(24.05%)	254	2940255:2940270	3125160:3125180
WP_001299679.1|2908858_2910115_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2910328_2910952_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2910951_2911803_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2911953_2912901_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2913025_2914705_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2914759_2915038_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2915315_2915900_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2916016_2917108_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|2919929_2921000_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2921010_2921643_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2921653_2923072_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|2925103_2925304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|2925411_2926434_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2926433_2927414_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2927410_2928169_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|2928987_2929842_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2929867_2931838_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2931887_2932142_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020150.1|2932342_2933077_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|2933078_2933690_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2933789_2934704_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2934799_2936536_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|2936927_2937998_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2938007_2939306_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2939668_2941201_+	SpoVR family protein	NA	NA	NA	NA	NA
2940255:2940270	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2941252_2941972_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
2940255:2940270	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406390.1|2942193_2943735_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2943880_2944411_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2944456_2945725_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2945724_2946144_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2946516_2947428_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2947634_2948096_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2948172_2948832_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2948903_2949197_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|2949208_2949367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2949437_2949839_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|2949941_2950310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2950829_2951525_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2951548_2952361_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2952364_2952631_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|2953796_2955010_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|2955183_2955768_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2956266_2957220_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2957406_2958891_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|2959193_2960732_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2960781_2961129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2961125_2961506_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|2961581_2961830_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2961886_2962555_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2963052_2963235_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2963313_2963814_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2963850_2964357_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2964375_2965266_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|2965385_2965967_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|2965966_2968882_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|2968946_2969546_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|2969612_2973011_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|2973071_2973704_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|2973640_2974384_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_171877413.1|2974389_2975061_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.6	7.5e-127
WP_000528251.1|2975186_2975924_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|2975877_2976078_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2976192_2976657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2976695_2976941_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2976976_2977159_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2977305_2979345_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2979444_2980005_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2980227_2980431_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2980510_2981032_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2981066_2981978_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2981977_2982538_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2982528_2983611_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2983610_2984048_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2984040_2984655_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2984644_2985769_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_061330372.1|2985752_2987102_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	1.3e-53
WP_000113525.1|2987088_2989164_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|2989290_2989767_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2989781_2990147_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2990155_2991658_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2991654_2991900_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2991900_2992461_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2992457_2992877_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002058.1|2992873_2993254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2993297_2994245_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|2994244_2995369_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|2995545_2996019_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|2996137_2997463_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|2997446_2999036_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|2999035_3000700_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|3000699_3001281_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|3001283_3001574_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|3001570_3001879_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|3001859_3002087_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3002096_3002315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3002298_3002727_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3002761_3003262_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3003333_3003759_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|3003828_3004338_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3004334_3004631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3004620_3004818_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|3004810_3005143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3005181_3005367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|3005363_3005915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|3005918_3006434_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|3006433_3006967_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|3006970_3007513_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|3007610_3008141_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|3008152_3008446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3008450_3008723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3008719_3009001_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3009002_3009257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|3009269_3009491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129791.1|3009493_3010426_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
WP_000289290.1|3010496_3012587_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|3012588_3012837_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|3013027_3013558_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000847331.1|3013841_3014171_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3014167_3016717_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3016709_3017144_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3017125_3017548_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3017563_3018304_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3018311_3018707_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3018703_3019282_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3019293_3019647_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3019658_3020057_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3020098_3021124_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3021179_3021512_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3021521_3022841_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3022821_3024423_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3024419_3024626_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3024622_3026548_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3026522_3027068_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3027456_3027651_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3027815_3028022_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3028307_3028718_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3029009_3029303_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3029393_3029576_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3029792_3030269_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3030255_3030561_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3030882_3031572_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3031568_3031709_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3031705_3032068_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3032064_3032355_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3032347_3032518_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3032517_3032973_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3033474_3035001_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3035058_3035181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3035245_3035578_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3035645_3035948_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3035944_3036646_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3037570_3037807_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3037796_3038939_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3039052_3040303_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3040474_3041128_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3041137_3041599_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3041652_3042759_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3042794_3043436_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3043439_3044810_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3044728:3044743	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3044978_3045650_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3044728:3044743	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3045649_3047110_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3047966_3048248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|3048261_3049923_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|3049906_3050263_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3050386_3050569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3050552_3050993_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3050992_3051289_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3051285_3051624_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3051620_3052832_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3052833_3053406_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3053445_3054603_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3054895_3055120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3055244_3055517_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3055527_3055938_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3055934_3056186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3056556_3058689_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3058685_3058985_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3058990_3059233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3059222_3059414_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3059413_3059599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3059591_3059789_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3059814_3060558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3060615_3060804_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3061168_3062398_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3062646_3063768_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3063816_3065043_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3065292_3066429_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3066412_3067276_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3067639_3069001_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3069061_3069337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3071645_3075047_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3075637_3077986_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3078005_3078095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3078107_3078344_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3078289_3079027_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3079080_3079959_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3080261_3080372_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3080481_3080736_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3080752_3081451_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3081450_3081792_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3081784_3085027_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3085079_3085289_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3085384_3085759_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3085764_3086481_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3086539_3086884_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3086880_3087327_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3087323_3087674_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3087683_3088010_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3088089_3090591_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3090536_3090758_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3090802_3092740_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3092803_3094465_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3094461_3095025_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3095314_3095680_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3095721_3095907_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3096036_3096177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3096533_3096758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3096822_3097029_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3097256_3097403_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3097402_3097972_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3098242_3098776_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3098826_3099171_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3099175_3099391_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3099466_3099736_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3099773_3099956_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3100103_3102041_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3102355_3102523_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3103119_3103941_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3103937_3104312_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3104324_3105374_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3105375_3105654_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3105821_3106034_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3106222_3106327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3106442_3107030_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3107032_3107224_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3107225_3107663_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3107649_3107967_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3107920_3108238_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3108227_3108530_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3108526_3108808_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3108840_3109557_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3109590_3110133_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3110044_3111082_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3111150_3111576_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3111559_3111883_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3112007_3112484_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3112799_3112952_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3113066_3113582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3113714_3114104_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3114165_3114435_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3114403_3115522_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3115688_3116483_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3116479_3117526_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3117681_3118503_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3125160:3125180	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	3347291	3499690	5399622	head,transposase,terminase,capsid,integrase,portal,holin,tail,bacteriocin,protease	Escherichia_phage(47.41%)	179	3446236:3446251	3501455:3501470
WP_001028088.1|3347291_3347786_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3347806_3349135_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3349217_3349325_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203825.1|3350283_3350913_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3350960_3351182_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3351178_3351463_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3351940_3352348_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3352347_3352743_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3352976_3353189_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3353308_3353653_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000331690.1|3354203_3362585_-	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3362654_3363920_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3363930_3364182_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3364191_3364638_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3364640_3365297_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3365390_3365792_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3365848_3365989_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3366221_3366956_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_162829202.1|3367440_3368654_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000455634.1|3368982_3369261_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3369275_3370544_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3370540_3372166_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3372460_3372649_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3372788_3373058_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3373059_3374997_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3374993_3375644_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3375643_3376207_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3376190_3376652_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3376701_3377091_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3377146_3378361_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3378384_3379392_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3379549_3381694_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3381693_3383400_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3383380_3384187_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3384242_3384446_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3384595_3384889_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3384979_3385165_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3385392_3385539_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3385538_3386108_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3386378_3386912_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3386916_3387132_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3387208_3387481_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3387521_3387701_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000224729.1|3387835_3388105_-	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
WP_162829202.1|3388162_3389375_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738068.1|3391573_3391843_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3391854_3392814_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3393597_3394032_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3394024_3394219_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3394215_3394821_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|3394820_3395543_-	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|3395617_3396352_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|3396626_3396809_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3396805_3397333_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3397329_3397776_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3397732_3397969_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3397979_3398195_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3398327_3398606_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|3398676_3398946_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|3398945_3400382_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|3400371_3401271_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|3401263_3401410_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|3401442_3401739_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|3401880_3402096_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3402171_3402867_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3403368_3403890_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3404458_3404641_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3404618_3404891_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3404949_3405201_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3405383_3405752_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3405824_3405989_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3405957_3406101_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3406175_3406472_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3406477_3407263_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|3407259_3407940_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|3407936_3408119_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|3408091_3408283_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_001444000.1|3408293_3408575_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|3408673_3408895_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|3408891_3409665_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|3409816_3410005_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3410006_3410222_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3410223_3410442_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3410443_3410731_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3411706_3412006_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3412091_3412376_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3412428_3413739_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3413735_3414314_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3414334_3414562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3414599_3415841_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3417648_3418569_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3418568_3418874_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3419027_3419627_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3419623_3422170_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3422169_3423342_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3423471_3424164_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3424136_3425165_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|3425247_3427992_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|3428063_3429137_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3429185_3429320_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3429347_3429578_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3429552_3429741_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3429751_3429964_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3430249_3430462_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3430903_3431209_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3431315_3431960_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3431956_3432703_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3432702_3434799_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3434844_3435984_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3435971_3436418_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3436437_3438618_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3438737_3440042_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3440121_3440214_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3440226_3441363_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3441374_3442919_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3443052_3443910_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3443906_3444305_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3444301_3444889_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3444885_3445593_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3445611_3447405_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3446236:3446251	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3447401_3448520_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3450793_3451063_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3451064_3452378_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3452442_3453042_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3453109_3456583_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3456716_3457244_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3457434_3458067_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3458012_3458756_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3458766_3459465_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3459464_3459794_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082449.1|3459790_3462370_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000533402.1|3462350_3462764_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3462790_3463222_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3463235_3463976_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3463957_3464224_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3464281_3464629_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3464665_3466171_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3466160_3467753_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3467749_3467956_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3467939_3469868_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3470131_3471670_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3471719_3472067_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3472063_3472444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3472519_3472795_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3473545_3473752_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3474007_3474280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3474439_3474973_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3475193_3475307_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3475528_3475714_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3476241_3476556_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3477912_3479763_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3480530_3481244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3481864_3482683_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3482834_3483206_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3483195_3483567_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3483579_3484629_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3484630_3484909_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3485076_3485232_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3485333_3485471_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3485836_3486610_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3486961_3487375_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3487390_3488161_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3488182_3488929_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3488935_3490027_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3490105_3490561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3490767_3491193_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3491176_3491449_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3491557_3491959_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3491986_3492178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3492177_3492465_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3492742_3492898_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3493039_3493429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3493615_3493801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3494374_3494563_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3494559_3494751_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3494844_3497316_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3497383_3497626_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3497603_3498623_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3499030_3499690_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3501455:3501470	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 11
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	3730627	3768724	5399622	terminase,integrase,portal,holin,tail,lysis,protease	Enterobacteria_phage(51.16%)	50	3730212:3730226	3768798:3768812
3730212:3730226	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3730627_3731326_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3731556_3732438_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3732607_3732769_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3733265_3734285_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3734318_3735299_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3735475_3735745_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3735746_3737063_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3737122_3737722_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3737792_3741206_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3741266_3741875_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3741811_3742555_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3742560_3743259_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3743268_3743598_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3743597_3746663_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3746634_3746964_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3746972_3747359_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3747419_3748163_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3748173_3748575_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3748571_3749150_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3749161_3749437_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3749429_3749753_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3749839_3751867_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3751811_3752147_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3752268_3753393_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3753320_3753533_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3753529_3755632_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3755631_3756123_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3756797_3756950_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3756937_3757405_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3757401_3757899_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3757898_3758114_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3758256_3758655_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3758735_3758894_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3758979_3759723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3759906_3760596_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3760610_3760733_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3761070_3762030_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3762241_3762907_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3762903_3763524_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3763516_3763687_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3763683_3763866_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3764563_3765244_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3765240_3765423_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3765395_3765587_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3765597_3765879_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3765977_3766199_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3766409_3767012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3767254_3767422_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3767461_3767680_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3767953_3768724_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3768798:3768812	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP038349	Escherichia coli O157:H7 strain F8952 chromosome, complete genome	5399622	4347623	4398892	5399622	plate,tail,transposase,integrase	Enterobacteria_phage(23.81%)	51	4347194:4347208	4383429:4383443
4347194:4347208	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4347623_4348805_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4349767_4350511_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4351334_4352108_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4352165_4352720_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4352749_4353244_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4353243_4353837_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4353808_4354252_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4354272_4354668_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4354982_4355294_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4356245_4356539_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4356657_4356858_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4356958_4357672_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4357799_4358189_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4358428_4358674_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4359743_4360997_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4361008_4362112_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4362399_4363455_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4363493_4363895_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4363952_4365197_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4365288_4365747_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4366007_4367465_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4367521_4368079_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4367990_4368257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4368563_4369016_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4369025_4369424_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4369426_4369720_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4369771_4370827_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4370897_4371683_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4371627_4373367_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4374184_4374958_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4375143_4375404_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4375422_4375683_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4375838_4376579_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4376549_4377317_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4377421_4378000_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4378239_4380684_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4380726_4381200_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4381353_4382124_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4382241_4383414_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4383494_4383680_+	protein YncO	NA	NA	NA	NA	NA
4383429:4383443	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4383594_4383858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4384059_4385820_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4385822_4386959_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356573.1|4387704_4388262_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4388330_4392545_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103107.1|4392620_4394762_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|4394971_4395490_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4396186_4396687_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4396721_4396946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4396996_4398388_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4398478_4398892_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038350	Escherichia coli O157:H7 strain F8952 plasmid pF8952-1, complete sequence	92716	49392	58184	92716	transposase,integrase	Macacine_betaherpesvirus(66.67%)	6	45962:45975	52550:52563
45962:45975	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|49392_50199_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|50921_52135_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|52096_52435_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|53022_54189_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
52550:52563	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|54188_55160_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|56459_58184_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
