The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	1236573	1260068	5566982	tail,holin,integrase,transposase	Enterobacteria_phage(33.33%)	27	1230166:1230180	1260939:1260953
1230166:1230180	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1236573_1237779_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1237780_1239094_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1239090_1240722_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1240722_1241121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1241218_1241632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024180811.1|1242027_1243266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1243341_1243677_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1243679_1244435_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108083.1|1244776_1245343_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223948.1|1245317_1245929_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1245925_1246591_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1246587_1247211_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1247463_1248207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1248292_1248460_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1248867_1250721_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1250870_1251086_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1251090_1251435_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1251791_1252172_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1252168_1252516_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1253016_1254230_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1254447_1254717_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442136.1|1254877_1255300_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	96.3	1.7e-71
WP_001301665.1|1255429_1256488_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1256566_1257217_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1257399_1257990_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1258491_1258740_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1259585_1260068_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1260939:1260953	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	1537646	1603373	5566982	tail,terminase,bacteriocin,lysis,portal,capsid,integrase,holin	Escherichia_phage(66.67%)	75	1542041:1542065	1602342:1602366
WP_000950857.1|1537646_1538216_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_171880307.1|1538215_1538683_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	3.7e-64
WP_000960724.1|1538669_1539350_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1539359_1540496_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1540670_1541828_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1542041:1542065	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1542259_1543429_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1543412_1543595_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001441720.1|1543673_1544045_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	89.4	9.8e-52
WP_001291843.1|1544080_1544293_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|1544252_1544879_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|1544875_1545307_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|1545362_1545992_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|1546241_1546526_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_001694420.1|1546881_1547811_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	100.0	5.1e-182
WP_000036158.1|1548324_1549026_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_000476216.1|1549022_1549262_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000157000.1|1549254_1549458_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_171880308.1|1549454_1550333_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.7	1.1e-178
WP_032274360.1|1550440_1550917_-	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	96.8	3.4e-81
WP_032274361.1|1550993_1551815_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	99.3	7.2e-148
WP_001071603.1|1551878_1552226_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_033805714.1|1552300_1552888_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.0	5.8e-107
WP_032274364.1|1552887_1553577_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.1	5.0e-134
WP_032274365.1|1553573_1554524_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	99.7	5.4e-179
WP_032274366.1|1554541_1554823_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
WP_032274367.1|1554843_1555125_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
WP_106888904.1|1555419_1556205_-	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	86.6	3.7e-125
WP_001064714.1|1556926_1557880_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_032274372.1|1557876_1559346_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2L1IV91	Escherichia_phage	99.4	4.3e-284
WP_001056250.1|1559440_1560154_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240875.1|1560249_1560453_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_000470023.1|1560986_1561373_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
WP_032274375.1|1561366_1562887_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
WP_032274376.1|1562876_1563848_+	toprim domain-containing protein	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
WP_000402092.1|1563847_1564297_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_032274377.1|1564304_1564868_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	98.4	1.3e-103
WP_000144764.1|1564864_1565059_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|1565051_1565486_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|1566269_1567229_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1567240_1567510_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|1567996_1569934_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|1570068_1570248_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1570288_1570561_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1570637_1570853_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|1570857_1571391_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|1571665_1572235_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1572234_1572384_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1572391_1572856_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1572887_1573181_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1573330_1573534_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|1573589_1574396_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1574376_1576083_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787035.1|1576082_1578227_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_171880309.1|1578384_1579392_+	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.4	6.7e-180
WP_000214474.1|1579415_1580630_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140444.1|1580684_1581074_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001371266.1|1581123_1581585_+	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_000829202.1|1581568_1582132_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|1582131_1582782_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_012816803.1|1582778_1584716_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_001023407.1|1584717_1584987_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001303606.1|1585125_1585314_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146321.1|1585608_1587234_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_000197188.1|1587230_1588499_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_000455633.1|1588513_1588792_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001459282.1|1588797_1589415_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000836187.1|1589494_1590232_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_000078907.1|1590464_1590605_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035555.1|1590661_1591063_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000509019.1|1591156_1591810_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000455645.1|1591812_1592259_+	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000540391.1|1592269_1592521_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012437.1|1592531_1593797_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_171880310.1|1593866_1602218_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.7	0.0e+00
WP_000368131.1|1602440_1603373_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1602342:1602366	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 3
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	1850219	1956156	5566982	tail,protease,terminase,tRNA,transposase,portal,holin	Enterobacteria_phage(50.68%)	112	NA	NA
WP_000569336.1|1850219_1851146_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1851150_1851882_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1851862_1851970_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1852029_1852731_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1852751_1854038_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1854071_1854326_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1854344_1854479_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_032287390.1|1854482_1854725_-	hypothetical protein	NA	B6DZ51	Enterobacteria_phage	96.5	6.2e-23
WP_162829202.1|1854690_1855904_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000610375.1|1856125_1856488_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1856484_1856841_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1857174_1857351_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1857352_1858300_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1858296_1858518_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1858616_1858898_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1858908_1859100_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1859072_1859255_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1859254_1859932_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000943920.1|1859928_1860267_-	recombinase	NA	A0A1I9LJN0	Stx_converting_phage	100.0	3.9e-55
WP_162829202.1|1860320_1861533_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000995395.1|1862032_1862329_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1862404_1862695_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1863198_1864806_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712398.1|1864912_1865605_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	5.6e-109
WP_001182877.1|1865968_1866508_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147238.1|1866504_1867524_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_000788902.1|1867520_1868222_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000152742.1|1868426_1868774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|1869526_1870135_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|1870434_1870851_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|1870829_1871231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|1871354_1871456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|1871452_1871908_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|1871907_1872078_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|1872070_1872361_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|1872357_1872720_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1872716_1872857_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1872942_1873377_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1873625_1873778_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142933.1|1874581_1876528_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|1876664_1876844_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1876884_1877130_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1877207_1877423_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1877427_1877961_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1878231_1878801_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1878800_1878947_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1879174_1879360_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1879571_1879844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1879876_1880353_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1880349_1882473_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1882469_1882682_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1882681_1884184_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1884128_1886153_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1886240_1886567_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1886559_1886841_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000682716.1|1887478_1887877_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1887884_1888637_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1888650_1889073_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1889099_1889408_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|1889451_1892097_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1892093_1892423_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|1892422_1893121_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|1893131_1893875_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|1893820_1894450_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514990.1|1894690_1898164_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|1898231_1898831_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279064.1|1898895_1900209_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	3.7e-77
WP_001023455.1|1900210_1900480_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001261937.1|1900847_1901096_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1901610_1903296_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1903292_1904012_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1904058_1904529_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1904570_1905032_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1905156_1907160_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1907156_1908293_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1908285_1909017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1909035_1910565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880311.1|1910575_1911664_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1912904_1913222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1913283_1916913_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1922713_1923926_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001301615.1|1925183_1927217_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001743954.1|1927348_1928458_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1928719_1929001_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1929292_1929835_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1929922_1930597_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1930612_1933093_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1933103_1934138_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1934219_1934558_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1934775_1935627_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1935747_1936020_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1936129_1936444_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1936453_1936801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1937851_1938091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1938424_1939213_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1939209_1940010_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1940074_1940893_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1940944_1941691_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1941664_1942630_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1942626_1943631_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1943627_1944905_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1945161_1946214_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1946512_1947367_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1947395_1948658_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1948667_1949120_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1949150_1949435_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1949438_1950794_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1950841_1951882_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1951981_1952761_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1952842_1953742_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1954147_1954465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1954794_1956156_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2042173	2119399	5566982	tail,protease,terminase,head,transposase,lysis,portal,capsid,integrase,holin	Stx2-converting_phage(43.9%)	96	2033124:2033138	2049855:2049869
2033124:2033138	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|2042173_2043352_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2043332_2043524_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2043601_2043946_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2044133_2044484_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_162829202.1|2045066_2046280_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001289930.1|2046658_2047606_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2047602_2047824_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2047922_2048204_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2048214_2048406_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2048378_2048561_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186807.1|2048557_2049238_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.5e-132
WP_001302855.1|2049234_2050020_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2049855:2049869	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2050025_2050322_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2050396_2050540_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2050508_2050673_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2050745_2051114_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2051296_2051548_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2051606_2051879_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2051856_2052039_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2052607_2053129_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2053630_2054326_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2054401_2054617_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2054758_2055055_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2055087_2055249_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2055235_2056057_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_162829202.1|2057266_2058479_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001000130.1|2058813_2059092_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2059224_2059440_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2059450_2059687_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2059643_2060090_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2060086_2060614_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2060610_2060793_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208497.1|2061067_2061796_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	95.6	3.6e-114
WP_000849633.1|2062051_2062732_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2062806_2063529_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2063528_2064134_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2064130_2064802_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2064792_2065281_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2065930_2066890_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2066901_2067171_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2067467_2067791_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143087.1|2068034_2069972_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_000143458.1|2070108_2070288_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2070328_2070601_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2070677_2070893_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2070892_2071390_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2071386_2071824_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2072026_2072524_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2072520_2072778_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2073240_2073468_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2073509_2073875_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958422.1|2074164_2074728_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_001301491.1|2074724_2076386_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2076449_2078387_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2078431_2078653_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2078598_2081100_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2081179_2081506_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2081515_2081866_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2081862_2082309_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2082305_2082650_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2082715_2083432_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2083446_2083821_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2083916_2084126_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_137325069.1|2084173_2087416_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.3	0.0e+00
WP_171880313.1|2087408_2087750_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	5.6e-62
WP_171878326.1|2087749_2088448_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	2.5e-133
WP_001302649.1|2088464_2088785_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2088892_2089066_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2089136_2090060_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|2090113_2090851_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|2090796_2091429_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_000515146.1|2091688_2095180_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	97.9	0.0e+00
WP_000268864.1|2095915_2097229_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_001023452.1|2097230_2097500_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2097640_2098516_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2098740_2099391_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2100714_2101881_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2101999_2102473_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2102671_2103730_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2103901_2104231_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2104331_2104514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2105002_2105116_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2105128_2105323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2105781_2106150_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2106223_2106445_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2106507_2106984_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2106998_2107478_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2107559_2108381_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2108601_2109012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880314.1|2109027_2109711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|2109846_2110917_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2110913_2111819_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2111815_2112697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2112680_2113894_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2114265_2116413_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_171880315.1|2117860_2119399_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
>prophage 5
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2133120	2187707	5566982	tail,terminase,head,transposase,portal,capsid,integrase,holin	Escherichia_phage(41.86%)	55	2133079:2133138	2162294:2163603
2133079:2133138	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|2133120_2134334_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001356620.1|2135592_2143575_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2144064_2144862_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2145097_2146120_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2146119_2146323_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2146381_2148853_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2148948_2149137_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2149133_2149322_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2149802_2149955_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2150229_2150874_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2150971_2151199_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2151195_2151621_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2151689_2152727_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2152638_2153181_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2153215_2153914_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2153935_2154160_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2154156_2154513_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2154545_2154698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2154694_2155006_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2155132_2155696_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2155805_2155910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2156096_2156309_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2156476_2156755_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2156756_2157806_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2157818_2158178_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2158174_2158864_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2159497_2159926_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2160403_2162254_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2162335_2163549_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2163859_2164075_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
2162294:2163603	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCA	NA	NA	NA	NA
WP_000731204.1|2164079_2164424_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2164474_2165008_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2165163_2165346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2165358_2165490_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2165717_2165903_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2166429_2166744_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2166825_2167050_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2167444_2167954_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_162829202.1|2168188_2169401_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171880341.1|2169476_2171168_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.3e-227
WP_000259002.1|2171151_2171358_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2171354_2172947_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2172936_2174442_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_001301534.1|2174883_2175150_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2175131_2175872_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2175885_2176317_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2176343_2176757_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082466.1|2176737_2179317_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2179313_2179643_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2179642_2180341_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|2180351_2181095_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2181040_2181670_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_062946141.1|2181910_2185390_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_000268865.1|2186122_2187436_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2187437_2187707_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2243121	2263101	5566982	tail,integrase,transposase	Enterobacteria_phage(75.0%)	28	2256237:2256250	2266243:2266256
WP_171880317.1|2243121_2244252_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.6e-41
WP_000132765.1|2244202_2244526_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2244683_2245868_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2245867_2246380_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2246434_2246800_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2246808_2246964_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2249766_2250255_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2250411_2250984_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2251027_2251558_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2252649_2252964_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2252968_2253928_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2254004_2256827_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2256237:2256250	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2256833_2257199_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2257195_2257813_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2257824_2258124_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2258120_2258387_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2258383_2258587_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2258610_2259027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2259119_2259233_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2259229_2259472_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2259483_2259762_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2259772_2260123_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2260144_2260348_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2260419_2260557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2260646_2261051_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2261066_2261717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2261746_2262094_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001356640.1|2262099_2263101_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	7.8e-104
2266243:2266256	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2583647	2675423	5566982	tail,protease,terminase,head,transposase,portal,capsid,holin	Stx2-converting_phage(35.0%)	99	NA	NA
WP_001260835.1|2583647_2584469_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2584568_2584652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2584744_2585080_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2585476_2586730_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2586836_2587730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2587864_2589085_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2589209_2589905_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2589857_2591150_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2591307_2591922_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2591964_2592819_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2592820_2593438_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2593448_2595872_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2595932_2598359_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2598557_2598863_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2598970_2599681_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2599683_2600244_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2600278_2600620_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2600754_2601081_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2602069_2602321_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2602393_2604865_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2604957_2605149_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2605145_2605334_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2605734_2605899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2605902_2606121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2606192_2606492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2606844_2607123_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2607124_2607316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2607336_2607708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2607805_2608108_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2608104_2608530_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000788938.1|2609521_2610262_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2611072_2611468_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2611524_2612109_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2612224_2612329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2612517_2612730_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2612897_2613176_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2613177_2614227_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2614239_2614599_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2614595_2615285_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2615922_2616351_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2616829_2618680_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2619119_2619335_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2619339_2619684_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2619734_2620268_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2620538_2621108_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2621107_2621254_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2621481_2621667_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2622091_2622319_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2622360_2622726_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_171880321.1|2623015_2623579_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.4	2.0e-88
WP_001301491.1|2623575_2625237_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2625300_2627238_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2627282_2627504_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2627449_2629951_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2630030_2630357_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2630366_2630717_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2630713_2631160_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2631156_2631501_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2631566_2632283_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2632297_2632672_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2632767_2632977_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_137325069.1|2633024_2636267_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.3	0.0e+00
WP_171880313.1|2636259_2636601_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	5.6e-62
WP_001179481.1|2636600_2637299_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2637309_2638053_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2637998_2638631_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2638973_2640149_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_137325071.1|2640100_2642446_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.2	0.0e+00
WP_001228290.1|2642513_2643113_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_171880322.1|2643264_2644578_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	3.2e-81
WP_001023474.1|2644579_2644849_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2645875_2647201_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2648798_2648921_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2649027_2649939_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2650004_2650574_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2651539_2653078_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2653127_2653475_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2653471_2653852_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2654191_2654470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2654897_2655044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2655180_2655828_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2656011_2656602_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2658108_2658759_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2660072_2660579_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2660624_2661125_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2661210_2661390_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2661770_2662577_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2662576_2663770_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2663781_2665143_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2665143_2666739_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2666738_2668301_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2668392_2668437_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2668574_2669456_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2669452_2670073_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2670100_2671684_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2671896_2672769_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2672808_2673399_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2673395_2674154_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2674373_2675423_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2759055	2812905	5566982	tail,protease,terminase,tRNA,portal,holin	Escherichia_phage(40.0%)	65	NA	NA
WP_001489118.1|2759055_2760288_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2760542_2761526_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123746.1|2762003_2763377_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|2763505_2764441_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000040845.1|2764492_2765728_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_000079604.1|2765729_2765945_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|2766044_2766233_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2766225_2766420_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|2766476_2767286_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|2767278_2769948_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000245534.1|2770028_2770205_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000560226.1|2770198_2770420_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|2770466_2771315_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|2771726_2771879_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2772185_2772605_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2772701_2772944_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|2772940_2773363_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|2773440_2774229_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|2774235_2774982_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|2775004_2775766_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|2775781_2776204_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|2776200_2776431_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|2776585_2777236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|2777222_2778344_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|2778466_2778679_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000940305.1|2779238_2779838_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|2779837_2780128_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|2780124_2780667_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_171880324.1|2781368_2783315_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000143458.1|2783451_2783631_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2783671_2783917_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2783994_2784210_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|2784214_2784748_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|2785018_2785588_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2785587_2785734_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2785961_2786147_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|2786358_2786631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2786663_2787140_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|2787136_2789260_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|2789256_2789469_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2789468_2790971_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2790915_2792940_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2793027_2793354_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2793346_2793628_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2793630_2794254_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2794266_2794665_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2794672_2795425_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2795438_2795861_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2795887_2796196_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|2796239_2798885_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|2798881_2799211_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2799210_2799909_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|2799919_2800663_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2800608_2801238_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514992.1|2801478_2804958_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_001230508.1|2805025_2805625_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2805689_2806913_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023407.1|2806914_2807184_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2807297_2807873_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2807945_2808575_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2808656_2809298_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2809459_2809702_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2809833_2811117_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2811205_2812666_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2812701_2812905_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	2994734	3091578	5566982	tail,terminase,head,transposase,portal,capsid,integrase,holin	Escherichia_phage(30.48%)	123	2987618:2987632	3094460:3094474
2987618:2987632	attL	TTTTGACTTTCTGCT	NA	NA	NA	NA
WP_001295593.1|2994734_2995169_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2995749_2996391_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2996472_2997102_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2997174_2997750_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|2997862_2998132_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_000279065.1|2998133_2999456_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|2999520_3000120_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000514990.1|3000187_3003661_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_096851774.1|3003901_3004531_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|3004476_3005220_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001356552.1|3005230_3005929_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|3005928_3006258_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_137325049.1|3006254_3008867_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000533440.1|3008847_3009261_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3009287_3009710_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3009723_3010476_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|3010483_3010879_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|3010875_3011409_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3011423_3011777_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|3011788_3012187_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3012228_3013254_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3013309_3013642_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3013651_3014971_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3014951_3016553_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3016549_3016756_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|3016752_3018678_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3018652_3019198_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3019584_3019809_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3019890_3020205_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3020730_3020916_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3021138_3021285_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3021284_3021854_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3022125_3022659_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731240.1|3022709_3023054_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
WP_024180155.1|3023058_3023274_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|3023712_3025563_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3026040_3026472_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3026922_3027636_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3027771_3027969_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3028193_3028748_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3028810_3029116_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3029128_3030178_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3030179_3030452_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3030573_3030918_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3031037_3031250_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3031483_3032041_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3032042_3032261_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3032388_3032700_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3032692_3032920_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3032916_3033198_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3033230_3033947_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3033980_3034442_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000693878.1|3035556_3035982_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3035965_3036208_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3036599_3036938_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3037230_3037383_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3037394_3038033_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3038033_3038243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3038807_3038996_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3038992_3039181_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3039273_3040518_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3041228_3041471_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3042433_3042814_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3042810_3043158_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3043207_3044746_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3045328_3045979_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|3046689_3047265_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3047378_3047648_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|3047649_3048873_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|3048937_3049537_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3049604_3049820_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001356568.1|3049822_3053083_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179470.1|3053270_3053708_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.2	2.5e-62
WP_171880313.1|3053707_3054049_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	5.6e-62
WP_000212814.1|3054041_3057122_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.6	0.0e+00
WP_001453746.1|3057169_3057379_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3057474_3057849_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3057863_3058580_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3058645_3058990_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3058986_3059433_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3059429_3059780_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000126003.1|3059789_3060116_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_000267295.1|3060118_3062698_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3062643_3062865_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3062909_3064847_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3064910_3066572_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3066568_3067132_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3067421_3067787_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3067828_3068056_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3068480_3068666_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3068893_3069040_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3069039_3069609_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3069879_3070413_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3070463_3070808_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3070812_3071028_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3071177_3073031_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3073827_3074886_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3075036_3075234_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3075475_3076006_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3076014_3076374_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3076386_3077433_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3077434_3077713_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3077782_3078040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3078142_3079355_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000961820.1|3079573_3079786_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3080064_3080823_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3081521_3081686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3081682_3082264_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3082450_3082993_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3082904_3083945_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3083916_3084468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3084451_3084679_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3084755_3085163_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3085426_3085726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3085798_3086017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3086039_3086447_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3086424_3086658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3086651_3086819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3087216_3087405_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3087401_3087593_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3087685_3090157_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3090221_3090470_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3090447_3091578_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3094460:3094474	attR	TTTTGACTTTCTGCT	NA	NA	NA	NA
>prophage 10
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3138274	3193876	5566982	protease,tail,tRNA,transposase	Stx2-converting_phage(25.0%)	49	NA	NA
WP_001299679.1|3138274_3139531_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3139744_3140368_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3140367_3141219_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3141369_3142317_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3142441_3144121_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3144175_3144454_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3144731_3145316_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3145432_3146524_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3149345_3150416_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3150426_3151059_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3151069_3152488_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3154519_3154720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3154827_3155850_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3155849_3156830_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3156826_3157585_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3158403_3159258_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3159283_3161254_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3161303_3161558_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171878588.1|3162406_3163619_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3163807_3164419_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3164518_3165433_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3165528_3167265_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_171880328.1|3167422_3168636_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	1.9e-168
WP_000197859.1|3168973_3170044_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3170053_3171352_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3171714_3173247_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3173298_3174018_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3174239_3175781_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3175926_3176457_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3176502_3177771_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3177770_3178190_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3178562_3179474_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3179680_3180142_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3180218_3180878_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3180949_3181243_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3181254_3181413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3181483_3181885_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3181987_3182356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3182875_3183571_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3183594_3184407_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3184410_3184677_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3185842_3187056_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3187229_3187814_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3188312_3189266_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3189452_3190937_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3191239_3192778_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3192827_3193175_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3193171_3193552_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3193627_3193876_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 11
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3197431	3244117	5566982	tail,terminase,head,tRNA,lysis,portal,capsid,holin	Enterobacteria_phage(55.81%)	55	NA	NA
WP_000885630.1|3197431_3198013_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000268883.1|3198012_3200928_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3200992_3201592_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3201658_3205057_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3205117_3205750_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3205686_3206430_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3206435_3207134_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847334.1|3207133_3207463_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	6.2e-58
WP_000840323.1|3207459_3210009_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3210001_3210436_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3210417_3210840_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3210855_3211596_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3211603_3211999_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3211995_3212574_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3212585_3212939_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3212950_3213349_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3213390_3214416_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3214471_3214804_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3214813_3216133_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3216113_3217715_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3217711_3217918_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3217914_3219840_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3219814_3220360_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3220748_3220943_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3221107_3221314_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3221599_3222010_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3222301_3222595_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3222685_3222868_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3223084_3223561_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3223547_3223853_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3224174_3224864_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3224860_3225001_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3224997_3225360_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3225356_3225647_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3225639_3225810_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3225809_3226265_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3226766_3228293_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3228350_3228473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3228537_3228870_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3228937_3229240_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3229236_3229938_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3230862_3231099_+	excisionase	NA	NA	NA	NA	NA
WP_000444477.1|3232344_3233595_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3233766_3234420_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3234429_3234891_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3234944_3236051_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3236086_3236728_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3236731_3238102_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_171880329.1|3238270_3238942_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3238941_3240402_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3241002_3241284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3241539_3242082_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3242287_3242701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3242713_3243049_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3243061_3244117_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 12
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3250209	3307556	5566982	tail,terminase,head,portal,capsid,integrase,holin	Stx2-converting_phage(28.57%)	71	3293123:3293143	3314213:3314233
WP_000085256.1|3250209_3251439_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3251687_3252809_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3252857_3254084_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3254333_3255470_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3255453_3256317_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3256680_3258042_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3258102_3258378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3260686_3264088_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001356663.1|3264678_3267027_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3267046_3267136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171880342.1|3267148_3267385_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	78.7	1.1e-19
WP_000967271.1|3267330_3268068_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3268121_3269000_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3269302_3269413_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3269522_3269777_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179479.1|3269793_3270492_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.0e-130
WP_171880313.1|3270491_3270833_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	5.6e-62
WP_000212827.1|3270825_3274068_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3274115_3274325_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3274420_3274795_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3274809_3275526_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3275591_3275936_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3275932_3276379_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3276375_3276726_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000126003.1|3276735_3277062_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_000267295.1|3277064_3279644_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3279589_3279811_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3279855_3281793_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3281856_3283518_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171878590.1|3283514_3284078_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.4	2.6e-88
WP_000279786.1|3284367_3284733_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3284774_3284960_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3285089_3285230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3285586_3285811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3285875_3286082_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3286309_3286456_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3286455_3287025_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3287295_3287829_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3287879_3288224_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3288228_3288444_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3288519_3288789_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3288826_3289009_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3289156_3291094_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3291408_3291576_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3292172_3292994_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3292990_3293365_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3293123:3293143	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3293377_3294427_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3294428_3294707_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3294874_3295087_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3295275_3295380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3295495_3296083_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3296085_3296277_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3296278_3296716_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3296702_3297020_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3296973_3297291_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3297280_3297583_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3297579_3297861_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3297893_3298610_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3298643_3299186_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3299097_3300135_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3300203_3300629_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3300612_3300936_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3301060_3301537_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3301852_3302005_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3302119_3302635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3302767_3303157_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3303218_3303488_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3303456_3304575_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3304741_3305536_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3305532_3306579_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3306734_3307556_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3314213:3314233	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3413040	3476877	5566982	protease,integrase,transposase	Stx2-converting_phage(27.78%)	60	3464793:3464808	3482693:3482708
WP_162829242.1|3413040_3414253_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001287881.1|3414847_3415039_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3415091_3415325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3415420_3416044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3416132_3416642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3417099_3417558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3418911_3420036_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3420765_3420963_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3421028_3421244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3421888_3422068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3422119_3422314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3423094_3423430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3424062_3424281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3425733_3427824_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3428337_3428724_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3429146_3429722_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3429790_3430369_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3430417_3431458_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3431480_3431936_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3431958_3433116_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3433115_3433697_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3434019_3435078_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3435087_3436230_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3436222_3436996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3436997_3438077_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3438076_3439033_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3439043_3440252_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3440269_3440737_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3440997_3441327_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3441313_3441655_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3442597_3444211_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3444241_3444592_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3444588_3445014_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000097913.1|3446158_3446332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397129.1|3447351_3448023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3448894_3449035_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3449336_3449600_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3450811_3451429_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3451440_3452115_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3452115_3452580_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3452589_3454293_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3454285_3454606_-	urease subunit beta	NA	NA	NA	NA	NA
WP_171880330.1|3454614_3454917_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3455007_3455706_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3456086_3456362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000592000.1|3456586_3458206_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3458298_3458658_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_162829202.1|3459839_3461052_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_028913479.1|3461269_3461875_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3463266_3463647_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3463643_3463991_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3464040_3465579_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3464793:3464808	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000136079.1|3465997_3466174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3466335_3468696_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3468850_3469414_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335698.1|3470234_3471620_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3471838_3472036_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3472262_3472559_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3473670_3475488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3475674_3476877_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3482693:3482708	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
>prophage 14
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3569321	3624711	5566982	tail,protease,head,transposase,portal,capsid,integrase,holin	Escherichia_phage(29.27%)	60	3571256:3571271	3626476:3626491
WP_000003680.1|3569321_3569909_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3569905_3570613_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3570631_3572425_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3571256:3571271	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3572421_3573540_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3575813_3576083_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3576084_3577398_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230371.1|3577462_3578062_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	5.5e-105
WP_000515110.1|3578129_3581603_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3581736_3582264_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3582454_3583087_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3583032_3583776_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151108.1|3583786_3584485_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.2e-130
WP_000847298.1|3584484_3584814_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082466.1|3584810_3587390_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3587370_3587784_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3587810_3588242_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3588255_3588996_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3588977_3589244_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001254002.1|3589685_3591191_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3591180_3592773_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3592769_3592976_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3595152_3596691_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3596740_3597088_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3597084_3597465_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3597540_3597816_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3598566_3598773_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3599028_3599301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3599460_3599994_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3600214_3600328_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3600549_3600735_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3601262_3601577_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3602933_3604784_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3605551_3606265_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3606885_3607704_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3607855_3608227_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3608216_3608588_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3608600_3609650_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3609651_3609930_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3610097_3610253_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3610354_3610492_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3610857_3611631_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3611982_3612396_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3612411_3613182_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3613203_3613950_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3613956_3615048_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3615126_3615582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3615788_3616214_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3616197_3616470_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3616578_3616980_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3617007_3617199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3617198_3617486_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3617763_3617919_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3618060_3618450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3618636_3618822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3619395_3619584_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3619580_3619772_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3619865_3622337_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3622404_3622647_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3622624_3623644_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3624051_3624711_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3626476:3626491	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 15
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	3855641	3893738	5566982	tail,protease,terminase,lysis,portal,integrase,holin	Enterobacteria_phage(52.38%)	49	3855226:3855240	3893812:3893826
3855226:3855240	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3855641_3856340_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3856570_3857452_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3857621_3857783_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3858279_3859299_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_001024022.1|3860489_3860759_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741876.1|3860760_3862077_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.4	7.7e-67
WP_001233141.1|3862136_3862736_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3862806_3866220_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3866280_3866889_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3866825_3867569_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3867574_3868273_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3868282_3868612_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3868611_3871677_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3871648_3871978_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3871986_3872373_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3872433_3873177_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3873187_3873589_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3873585_3874164_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3874175_3874451_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3874443_3874767_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136595.1|3874853_3876881_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3876825_3877161_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3877282_3878407_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3878334_3878547_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3878543_3880646_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3880645_3881137_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3881811_3881964_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3881951_3882419_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3882415_3882913_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3882912_3883128_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3883270_3883669_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3883749_3883908_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3883993_3884737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3884920_3885610_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3885624_3885747_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3886084_3887044_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3887255_3887921_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3887917_3888538_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3888530_3888701_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3888697_3888880_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3889577_3890258_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3890254_3890437_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3890409_3890601_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3890611_3890893_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3890991_3891213_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3891423_3892026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3892268_3892436_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3892475_3892694_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3892967_3893738_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3893812:3893826	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 16
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	4436731	4515970	5566982	tail,protease,terminase,head,plate,transposase,lysis,portal,capsid,integrase,holin	Shigella_phage(43.33%)	95	4473848:4473894	4512068:4512114
WP_000998048.1|4436731_4438270_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4438319_4438667_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4438663_4439044_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4439307_4439571_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4439570_4439711_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4439780_4439972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4440796_4441339_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4441413_4442001_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4442058_4442727_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131062.1|4442752_4445278_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4445267_4446911_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4446879_4447590_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4447902_4448232_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4448479_4449094_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4449511_4450201_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4450197_4451154_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4451150_4453349_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4453358_4454315_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4454493_4455621_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4455762_4456821_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4457066_4457969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4458671_4458950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4459116_4459839_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4459937_4460837_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4461512_4462469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4462601_4464935_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4464948_4465272_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4465271_4465493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4465489_4466047_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4466043_4466304_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4467237_4467990_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4467986_4468538_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4468543_4468816_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4469225_4469792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4469791_4470382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4470412_4471045_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4471037_4471496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4471495_4472113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4472504_4473686_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4473848:4473894	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4474648_4475392_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4476216_4476990_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4477050_4477605_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4477635_4478154_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4478153_4478756_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4478727_4479171_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4479191_4479587_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4479857_4480442_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4480432_4481491_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4481477_4481903_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4481902_4482451_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4482450_4483530_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4483526_4484855_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4484915_4486751_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4486892_4487162_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4487161_4487518_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155726.1|4487517_4489014_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	4.2e-271
WP_000497751.1|4488997_4489168_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4489176_4489737_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4489733_4490240_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4490214_4490625_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4490621_4490945_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4491023_4492253_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4492263_4492866_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4492858_4494085_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4494074_4494236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4494232_4495729_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4495962_4496457_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135207.1|4496582_4496933_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4497458_4497752_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4497842_4498025_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4498238_4498715_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4498718_4499054_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4499190_4499484_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4499762_4499996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4500139_4500679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4500893_4501646_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4501659_4502649_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4502656_4503466_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4503485_4503875_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|4503871_4504198_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001303054.1|4504194_4504848_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072131649.1|4504847_4505342_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104949.1|4505338_4506280_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4506269_4506449_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4506624_4507176_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4507168_4507429_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4507526_4508219_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4508496_4508793_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4509469_4510006_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4509996_4510359_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4510358_4510664_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4510890_4512054_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4512258_4513512_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4512068:4512114	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4513523_4514627_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4514914_4515970_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 17
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	4534756	4599027	5566982	plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	52	NA	NA
WP_000027430.1|4534756_4535929_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4536009_4536195_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4536109_4536373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4536574_4538335_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4538337_4539474_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356493.1|4540219_4540765_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4540833_4542342_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000995683.1|4542523_4543240_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000103125.1|4547687_4549829_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4550038_4550557_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4551252_4551753_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4551787_4552012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4552062_4553454_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4553544_4553958_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393849.1|4553961_4555812_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4555775_4556858_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4556882_4558163_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080155.1|4558159_4558684_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4558686_4560018_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4560022_4560784_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614377.1|4560792_4563576_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000088854.1|4563572_4564316_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001303798.1|4565868_4569303_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4569313_4570723_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4570688_4571168_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4571188_4571410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4571488_4572085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4572087_4572537_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4573014_4573815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4574352_4575084_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4575148_4575616_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4575612_4576335_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4576368_4577124_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4577195_4578554_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4578601_4579372_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4579449_4580250_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4580490_4581405_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4581401_4582205_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4587962_4588538_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4588725_4589757_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4589749_4590403_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4590442_4591258_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4591375_4591780_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4591776_4592484_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4592594_4594313_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4594365_4595190_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4595389_4596100_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4596113_4596524_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4596520_4597066_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4597231_4597432_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4597418_4597679_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4597731_4599027_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP038346	Escherichia coli O157:H7 strain G5295 chromosome, complete genome	5566982	5194124	5210102	5566982	tail,tRNA,integrase,transposase	Enterobacteria_phage(43.75%)	19	5189965:5189980	5208807:5208822
5189965:5189980	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5194124_5195540_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5195622_5196606_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5196771_5197014_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5197147_5198185_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5198273_5199371_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5199432_5199681_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5199841_5200483_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5200564_5201194_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5201266_5201839_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5201950_5202220_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5202221_5203535_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5203599_5204199_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_162829202.1|5205664_5206877_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001242740.1|5207360_5207711_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5207707_5207992_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5208327_5208525_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5208869_5209151_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5208807:5208822	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5209198_5209372_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5209568_5210102_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038348	Escherichia coli O157:H7 strain G5295 plasmid pG5295-1, complete sequence	89216	8158	54526	89216	integrase,transposase,protease	Stx2-converting_phage(33.33%)	36	39101:39115	59751:59765
WP_001034100.1|8158_12061_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|14240_15062_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15061_16168_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16257_17979_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18052_19051_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000998048.1|19411_20950_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|20999_21347_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|21343_21724_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001358886.1|22381_25078_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25164_26040_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26040_28008_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28007_29513_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|29514_30738_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30768_31203_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31199_31754_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|31768_32116_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32112_32712_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32708_33686_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|33724_34897_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34883_35396_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35453_36287_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36378_36780_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|38670_39186_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39101:39115	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39187_42184_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42233_44354_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44357_45797_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|46540_46771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46891_47632_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47916_48894_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49301_49502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49498_50119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50115_50799_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51257_51476_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51477_51783_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016990.1|51783_52590_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.3	4.1e-55
WP_162829202.1|53312_54526_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
59751:59765	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
