The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	1225549	1232600	5408816	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1225549_1226763_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1226980_1227250_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1227410_1227833_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1227962_1229021_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1229099_1229750_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1229932_1230523_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1231024_1231273_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1232117_1232600_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	1511496	1518235	5408816	integrase,transposase	Enterobacteria_phage(50.0%)	6	1499170:1499186	1520431:1520447
1499170:1499186	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1511496_1512066_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1512205_1513418_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1513832_1514513_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1514522_1515659_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1515833_1516991_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1517302_1518235_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1520431:1520447	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	1743529	1833754	5408816	terminase,portal,holin,tail,transposase,tRNA,lysis,protease	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1743529_1744225_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1744221_1744620_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1744750_1745659_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1745785_1747144_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1747155_1748184_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1748198_1748900_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1748908_1749553_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1749567_1750761_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1750920_1751871_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1752258_1752342_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1752565_1754002_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1754054_1754816_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1754945_1755524_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1755693_1756281_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1756454_1757387_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1757424_1759140_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1759335_1761633_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1761884_1762802_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1762808_1763966_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1763958_1764885_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1764889_1765621_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1765601_1765709_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1765768_1766470_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1767608_1768821_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1769141_1769291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1769348_1770875_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1771376_1771832_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1771831_1772002_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1771994_1772285_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1772281_1772644_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1772640_1772781_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1772866_1773301_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1773552_1773705_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1774508_1776455_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1776592_1776772_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1776812_1777058_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1777135_1777351_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1777355_1777889_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1778159_1778729_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1778728_1778875_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1779102_1779288_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1779805_1780282_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1780278_1782402_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1782398_1782611_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1782610_1784113_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1784057_1786082_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1786169_1786496_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1786488_1786770_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1786772_1787396_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1787408_1787807_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1787814_1788567_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1788580_1789009_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1789035_1789344_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1789387_1792033_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1792029_1792359_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1792358_1793057_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1793062_1793806_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1793751_1794381_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080213.1|1794621_1798101_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230459.1|1798167_1798767_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080201.1|1798831_1800145_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	2.8e-77
WP_001023407.1|1800146_1800416_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_075702011.1|1800576_1800993_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1801074_1801716_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1801877_1802126_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1802640_1804326_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1804322_1805042_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1805088_1805559_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1805600_1806062_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1806186_1808190_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1808186_1809323_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1809315_1810047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1810065_1811595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1811605_1812694_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1813325_1813643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1813704_1817334_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1824291_1826325_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1826456_1827566_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1827827_1828109_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1828400_1828943_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1829030_1829705_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1829720_1832201_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1832541_1833754_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	1942571	2019200	5408816	terminase,head,holin,tail,transposase,integrase,lysis,protease	Stx2-converting_phage(50.6%)	95	1933522:1933536	1948949:1948963
1933522:1933536	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1942571_1943750_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1943730_1943922_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1944003_1944348_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1944535_1944886_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1944882_1945239_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1945752_1946700_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1946696_1946918_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1947016_1947298_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1947308_1947500_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1947472_1947655_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1947651_1948332_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1948328_1949114_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1948949:1948963	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1949389_1950602_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1950803_1950947_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1950915_1951080_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1951152_1951521_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1951703_1951955_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1952013_1952286_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1952263_1952446_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1953014_1953536_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1953717_1954930_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1955350_1956046_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1956120_1956336_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1956477_1956774_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1956806_1956968_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1956954_1957776_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1957772_1959149_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1959219_1959498_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1959630_1959846_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1959856_1960093_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1960049_1960496_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1960492_1961020_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1961016_1961199_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1961473_1962178_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108016.1|1962975_1963581_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	4.3e-97
WP_001028855.1|1963577_1964249_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1964239_1964728_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1965366_1966326_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1966337_1966607_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1966903_1967227_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_021503541.1|1967470_1969408_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1969545_1969725_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1969765_1970038_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1970114_1970330_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1970329_1970827_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1970823_1971261_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1971463_1971961_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1971957_1972215_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1972677_1972905_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1972946_1973312_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1973604_1974168_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1974164_1975826_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1977870_1978092_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1980618_1980945_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1980954_1981305_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1981301_1981748_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1981744_1982089_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1982147_1982864_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1982869_1983244_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1983339_1983549_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080206.1|1983600_1986843_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|1986835_1987177_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1987176_1987875_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1987891_1988212_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1988319_1988493_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1988563_1989487_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1989541_1990279_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1990224_1990857_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001171540.1|1991190_1991571_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1991567_1991915_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1991964_1993503_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1993545_1997025_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230459.1|1997091_1997691_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|1997755_1999069_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|1999070_1999340_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|1999480_2000356_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2000580_2001231_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2002554_2003721_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2003839_2004313_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2004511_2005570_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2005741_2006071_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2006171_2006354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2006842_2006956_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2006968_2007163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2007621_2007990_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2008063_2008285_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2008347_2008824_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2008838_2009318_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2009399_2010221_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2010441_2010852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2010867_2011551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077882757.1|2011686_2012439_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_171878943.1|2012481_2013695_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2014066_2016214_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2017661_2019200_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	2038368	2086188	5408816	terminase,portal,head,holin,tail,transposase,integrase,capsid	Escherichia_phage(40.48%)	54	2023856:2023870	2049023:2049037
2023856:2023870	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2038368_2039581_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2043865_2044663_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2044898_2045921_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2045920_2046124_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2046182_2048654_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2048749_2048938_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2048934_2049123_-	cell division inhibitor	NA	NA	NA	NA	NA
2049023:2049037	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2049603_2049756_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2050030_2050675_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2050772_2051000_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2050996_2051422_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2051490_2052528_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2052439_2052982_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2053016_2053715_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2053736_2053961_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2053957_2054314_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2054346_2054499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2054495_2054807_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2054933_2055497_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2055606_2055711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2055897_2056110_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2056151_2056337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2056277_2056556_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2056557_2057607_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2057619_2057979_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2057975_2058665_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2059298_2059727_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2062136_2063350_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2063660_2063876_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2063880_2064225_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2064275_2064809_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2064964_2065147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2065159_2065291_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2065518_2065704_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2066230_2066545_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2066626_2066851_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2067245_2067755_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2069639_2069846_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2069842_2071435_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2071424_2072930_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2072966_2073314_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2073371_2073638_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2073619_2074360_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2074373_2074805_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2074831_2075245_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|2075225_2077805_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847314.1|2077801_2078131_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2078130_2078829_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2078834_2079578_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2079523_2080153_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_171878946.1|2080393_2083873_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_001230459.1|2083939_2084539_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878948.1|2084603_2085917_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	1.8e-76
WP_001023407.1|2085918_2086188_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	2143564	2163582	5408816	integrase,tail,transposase	Enterobacteria_phage(70.83%)	28	2156718:2156731	2166724:2166737
WP_162829348.1|2143564_2144778_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000005444.1|2144907_2146092_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2146091_2146604_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2146658_2147024_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2147032_2147188_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2149990_2150479_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2150635_2151208_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2151251_2151797_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2151834_2153047_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2153130_2153445_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2153449_2154409_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2154485_2157308_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2156718:2156731	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2157314_2157680_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2157676_2158294_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2158305_2158605_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2158601_2158868_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2158864_2159068_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2159091_2159508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2159600_2159714_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2159710_2159953_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2159964_2160243_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2160253_2160604_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2160625_2160829_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2160900_2161038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2161127_2161532_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2161547_2162198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2162227_2162575_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2162580_2163582_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2166724:2166737	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	2484126	2623685	5408816	terminase,portal,head,holin,tail,transposase,capsid,protease	Escherichia_phage(28.57%)	165	NA	NA
WP_001260835.1|2484126_2484948_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2485047_2485131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2485223_2485559_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2485955_2487209_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2487315_2488209_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2488343_2489564_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2489688_2490384_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2490336_2491629_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2491786_2492401_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2492443_2493298_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2493299_2493917_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2493927_2496351_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2496411_2498838_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2499036_2499342_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2499449_2500160_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2500162_2500723_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2500757_2501099_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2501233_2501560_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2502548_2502800_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2502872_2505344_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2505436_2505628_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2505624_2505813_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2506213_2506378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2506381_2506600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2506671_2506971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2507323_2507602_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2507603_2507795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2507815_2508187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2508284_2508587_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2508583_2509009_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2509031_2509994_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2510000_2510741_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2511551_2511947_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2512003_2512588_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2512703_2512808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2512996_2513209_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2513376_2513655_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2513656_2514706_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2514718_2515078_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2515074_2515764_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001455449.1|2516400_2516829_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	2.2e-63
WP_000023202.1|2517307_2519158_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2519597_2519813_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2519817_2520162_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2520212_2520746_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2520852_2522066_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2522364_2522934_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2522933_2523080_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2523307_2523493_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2523917_2524145_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2524186_2524552_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_070080218.1|2524841_2525405_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_070080219.1|2525401_2527063_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063023.1|2529107_2529329_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080220.1|2529274_2531854_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
WP_000125988.1|2531856_2532183_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2532192_2532543_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2532539_2532986_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2532982_2533327_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2534115_2534490_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2534585_2534795_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_021503509.1|2534846_2538089_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|2538081_2538423_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|2538422_2539121_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_070080223.1|2539131_2539875_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_050439450.1|2539820_2540453_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_070080224.1|2540795_2544056_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	91.9	0.0e+00
WP_001304111.1|2544058_2544274_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2544341_2544941_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_075702005.1|2545005_2546220_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001121225.1|2547014_2547665_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2548247_2549786_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2549835_2550183_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2550179_2550560_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001120551.1|2551522_2551765_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2552475_2553720_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2553812_2554001_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2553997_2554186_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2554750_2554960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2554960_2555599_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2555610_2555763_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2556055_2556394_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2556785_2557028_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2557011_2557437_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2557505_2558549_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2558541_2559003_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2559036_2559753_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2559785_2560067_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2560063_2560291_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2560283_2560595_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2560722_2560941_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2560942_2561500_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2561733_2561946_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2562065_2562410_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2562531_2562804_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2562805_2563855_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2563867_2564173_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2564235_2564790_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2565014_2565212_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2565347_2566061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2566515_2566944_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023184.1|2567421_2569272_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2569710_2569926_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2569930_2570275_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2570325_2570859_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2571129_2571699_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2571698_2571845_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2572067_2572253_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2572778_2573093_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2573174_2573399_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2573785_2574331_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2574305_2576231_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2576227_2576434_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2576430_2578032_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2578012_2579332_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2579341_2579674_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2579729_2580755_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2580796_2581195_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2581206_2581560_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975102.1|2581571_2582150_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000683105.1|2582146_2582542_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2582549_2583290_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2583305_2583728_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2583709_2584144_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2584136_2586686_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2586682_2587012_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2587011_2587710_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2587715_2588459_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090919.1|2588395_2589028_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_070080236.1|2589088_2592487_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_001230336.1|2592553_2593153_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2593217_2596133_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2596132_2596714_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2596833_2597724_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2597742_2598249_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2598285_2598786_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2598864_2599047_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2599544_2600213_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2600269_2600518_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|2600593_2600974_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2600970_2601318_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2601367_2602906_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2603208_2604693_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2604879_2605833_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2606331_2606916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001358785.1|2606940_2607378_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000539892.1|2607857_2608010_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_000872355.1|2608112_2608436_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_032169657.1|2608968_2609079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373094.1|2609131_2609536_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332300.1|2609756_2610488_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_001359088.1|2610692_2611904_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554146.1|2612217_2612454_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858015.1|2612496_2612769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|2612797_2613064_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065752.1|2613176_2613425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|2613808_2615332_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001299921.1|2615463_2615682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979977.1|2618779_2619115_-	YmgD family protein	NA	NA	NA	NA	NA
WP_001304448.1|2619118_2619403_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000122462.1|2619464_2619638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|2619738_2619924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131446.1|2619884_2620004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080235.1|2620443_2622447_+	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|2622472_2623685_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 8
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	2718475	2832646	5408816	terminase,portal,head,lysis,holin,tail,tRNA,integrase,capsid	Enterobacteria_phage(32.63%)	137	2783013:2783028	2811267:2811282
WP_000113674.1|2718475_2719606_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2719583_2719832_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2719896_2722368_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2722460_2722652_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2722648_2722837_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2723234_2723402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2723395_2723629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2723606_2724014_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2724036_2724255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2724327_2724627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2724890_2725298_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2725374_2725602_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2725585_2726137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2726108_2727149_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2727060_2727603_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2727789_2728371_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2728367_2728532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2729230_2729989_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2730267_2730480_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2730700_2730958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2731027_2731306_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2731307_2732354_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2732366_2732726_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2732734_2733265_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2733506_2733704_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935549.1|2733854_2734919_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_070080234.1|2735715_2737566_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2738005_2738221_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2738225_2738570_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2738620_2739154_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2739424_2739994_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2739993_2740140_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2740367_2740553_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2740977_2741205_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2741246_2741612_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_047082927.1|2741902_2742466_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	83.4	7.1e-70
WP_070080219.1|2742462_2744124_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063023.1|2746168_2746390_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2748916_2749243_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2749252_2749603_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2749599_2750046_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2750042_2750387_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|2750445_2751162_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|2751167_2751542_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2751637_2751847_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_021503509.1|2751898_2755141_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|2755133_2755475_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2755474_2756173_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2756189_2756444_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_032169778.1|2756553_2756703_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2756966_2757845_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2757898_2758636_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071527644.1|2758581_2758818_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_115801847.1|2758830_2758920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2758939_2761288_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001303921.1|2767587_2767863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2767923_2769285_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2769648_2770512_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2770495_2771632_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2771881_2773108_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2773156_2774278_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|2774526_2775756_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2776120_2776309_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2777113_2777311_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2777303_2777516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2777505_2777970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2777962_2778196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2778201_2778501_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|2778497_2779898_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|2780098_2780350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2780346_2780757_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2780767_2781040_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2781166_2781391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2781642_2781849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2781848_2782904_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2782916_2783252_+|head	head decoration protein	head	NA	NA	NA	NA
2783013:2783028	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2783264_2783678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2783883_2784426_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2784681_2784963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2785563_2787024_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2787023_2787695_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2787863_2789234_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2789237_2789879_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2789914_2791021_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2791074_2791536_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2791545_2792199_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2792370_2793621_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2793734_2794877_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2794866_2795103_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2796027_2796729_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2796725_2797028_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2797095_2797428_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001459030.1|2797492_2797615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001693106.1|2797672_2799199_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001053040.1|2799700_2800156_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2800155_2800326_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774484.1|2800318_2800609_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099695.1|2800605_2800968_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2800964_2801105_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2801101_2801791_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2802112_2802418_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2802404_2802881_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2803097_2803280_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2803370_2803664_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_001459037.1|2803955_2804366_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_001031427.1|2804651_2804858_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2805022_2805217_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2805605_2806151_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027374.1|2806125_2808051_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2808047_2808254_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2808250_2809852_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2809832_2811152_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2811161_2811494_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2811267:2811282	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|2811549_2812575_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2812616_2813015_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2813026_2813380_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2813394_2813928_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2813924_2814320_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235098.1|2814327_2815080_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|2815093_2815522_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|2815548_2815857_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|2815900_2818546_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|2818542_2818872_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2818871_2819570_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2819575_2820319_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2820264_2820894_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070081045.1|2821134_2824611_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.9	0.0e+00
WP_001230466.1|2824677_2825277_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080214.1|2825341_2826655_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2826656_2826926_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2827038_2827614_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2827686_2828316_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2828397_2829039_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2829200_2829443_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2829574_2830858_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2830946_2832407_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2832442_2832646_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	3078338	3177892	5408816	terminase,head,holin,tail,transposase,integrase,protease	Stx2-converting_phage(26.15%)	106	3163474:3163494	3187530:3187550
WP_162829202.1|3078338_3079551_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000202114.1|3080768_3081335_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506490.1|3081812_3082601_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001302118.1|3082744_3083872_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485019.1|3083939_3085874_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
WP_000859972.1|3086108_3088094_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288364.1|3088241_3088415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088621.1|3088504_3089254_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|3089522_3089741_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001303294.1|3089866_3090193_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176265.1|3090192_3090930_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|3091122_3092292_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876292.1|3092298_3092607_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256542.1|3092755_3093520_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|3093689_3094280_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099451.1|3094343_3097019_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|3097182_3097278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233043.1|3097391_3097559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|3097561_3097726_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|3098020_3098995_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|3099204_3101802_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|3102181_3102433_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422055.1|3102468_3103518_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3103737_3104496_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3104492_3105083_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3105122_3105995_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_162829202.1|3107105_3108319_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001295575.1|3109131_3109752_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3109748_3110630_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3110767_3110812_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3110903_3112466_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3112465_3114061_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|3114061_3115423_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|3115434_3116628_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3116627_3117434_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3117814_3117994_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3118079_3118580_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3118625_3119132_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001345079.1|3120445_3121096_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3122602_3123193_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3123376_3124024_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3124160_3124307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3124734_3125013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3125352_3125733_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3125729_3126077_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3126126_3127665_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3128630_3129200_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001509602.1|3129265_3130177_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_106409364.1|3130283_3130406_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3132003_3133329_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023407.1|3134355_3134625_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000216532.1|3134626_3135940_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3136091_3136691_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_070080232.1|3136758_3140232_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001152180.1|3140420_3140858_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|3140857_3141199_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_021503509.1|3141191_3144434_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_001453698.1|3144485_3144695_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3144790_3145165_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|3145170_3145887_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|3145945_3146290_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3146286_3146733_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3146729_3147080_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3147089_3147416_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3149942_3150164_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3152208_3153870_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3153866_3154430_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3154718_3155084_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3155125_3155311_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3155440_3155581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3155937_3156162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3156226_3156433_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3156660_3156807_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3156806_3157376_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3157646_3158180_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3158230_3158575_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3158579_3158795_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3158870_3159140_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3159177_3159360_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3159507_3161445_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3161759_3161927_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762928.1|3162523_3163345_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3163341_3163716_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3163474:3163494	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3163728_3164778_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3164779_3165058_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3165225_3165438_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3165626_3165731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3165846_3166434_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3166436_3166628_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3166629_3167067_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3167053_3167371_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3167324_3167642_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3167631_3167934_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3167930_3168212_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3168244_3168961_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3168994_3169537_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070081046.1|3169448_3170492_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	78.8	1.4e-87
WP_000693915.1|3170560_3170986_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3170969_3171293_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3171417_3171894_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3172209_3172362_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_001509524.1|3172476_3172992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3173533_3173722_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3173718_3173910_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000003742.1|3176535_3176805_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3176773_3177892_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
3187530:3187550	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	3273467	3327233	5408816	transposase,protease	Escherichia_phage(30.0%)	49	NA	NA
WP_162829202.1|3273467_3274681_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001069768.1|3277052_3277925_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282125.1|3278252_3278435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|3278734_3279160_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_162829202.1|3279360_3280573_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3281245_3283414_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001304206.1|3283410_3283926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3284166_3285213_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3287200_3287392_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3287444_3287678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3287773_3288397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3288485_3288995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3289452_3289911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3291264_3292389_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3293118_3293316_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3293381_3293597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3293956_3294145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3294241_3294421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3294472_3294667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3295447_3295783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3296415_3296634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3298086_3300177_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3300690_3301077_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3301499_3302075_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3302143_3302722_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3302770_3303811_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3303833_3304289_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3304311_3305469_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3305468_3306050_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3306372_3307431_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3307440_3308583_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3308575_3309349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3309350_3310430_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3310429_3311386_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3311396_3312605_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3312622_3313090_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3313350_3313680_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3313666_3314008_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3314950_3316564_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3316594_3316945_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3316941_3317367_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3317709_3318923_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3318960_3321300_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_162829202.1|3321521_3322735_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001509494.1|3322786_3322951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3323369_3324908_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3324957_3325305_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3325301_3325682_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_171878941.1|3326020_3327233_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
>prophage 11
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	3445602	3502684	5408816	portal,head,holin,tail,transposase,integrase,capsid,protease	Escherichia_phage(29.55%)	63	3447537:3447552	3504449:3504464
WP_000003653.1|3445602_3446190_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3446186_3446894_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3446912_3448706_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3447537:3447552	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3448702_3449821_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3452235_3452505_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3452506_3453820_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3453884_3454484_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080242.1|3454551_3458025_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3458158_3458686_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3458876_3459509_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3459454_3460198_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_070080243.1|3460208_3460907_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|3460906_3461236_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_070080244.1|3461232_3463812_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|3463792_3464206_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3464232_3464664_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3464677_3465418_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3465399_3465666_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3465723_3466071_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3466107_3467613_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3467602_3469195_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3469191_3469398_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3471574_3473113_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3473162_3473510_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3473506_3473887_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3473962_3474238_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3475104_3476317_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3476314_3476509_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3476764_3477037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3477196_3477730_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3477950_3478064_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3478285_3478471_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3478998_3479313_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3479517_3480731_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3480906_3482757_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3483524_3484238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3484858_3485677_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3485828_3486200_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3486189_3486561_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3486573_3487623_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3487624_3487903_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3488070_3488226_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3488327_3488465_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3488830_3489604_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3489955_3490369_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3490384_3491155_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3491176_3491923_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3491929_3493021_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3493099_3493555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3493761_3494187_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3494170_3494443_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3494551_3494953_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3494980_3495172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3495171_3495459_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3495736_3495892_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3496033_3496357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3496609_3496795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3497368_3497557_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3497553_3497745_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3497838_3500310_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3500377_3500620_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3500597_3501617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3502024_3502684_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3504449:3504464	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	3733617	3758692	5408816	terminase,holin,tail,transposase,integrase,lysis,protease	Escherichia_phage(34.48%)	36	3733202:3733216	3758766:3758780
3733202:3733216	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3733617_3734316_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3734546_3735428_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3735596_3735758_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3736254_3737274_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3737307_3738288_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3738464_3738734_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741877.1|3738735_3739989_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3740048_3740627_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3740693_3741906_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3741971_3742184_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3742180_3744283_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3744282_3744774_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3745448_3745601_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3745588_3746056_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3746052_3746550_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3746549_3746765_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3746907_3747306_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3747386_3747545_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3747630_3748374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3748557_3749247_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3749261_3749384_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3749721_3750681_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3750892_3751558_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3751554_3752175_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3752167_3752338_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3752334_3752517_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3753437_3754651_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072140988.1|3754707_3755208_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.8	1.1e-93
WP_000682316.1|3755204_3755387_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3755359_3755551_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3755561_3755843_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3755941_3756163_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3756373_3756976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3757218_3757386_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3757425_3757644_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3757621_3758692_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3758766:3758780	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	4339928	4398870	5408816	transposase,plate	uncultured_Caudovirales_phage(18.75%)	53	NA	NA
WP_162829348.1|4339928_4341141_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4341240_4342083_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001509364.1|4342105_4344757_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.1	5.4e-43
WP_000165865.1|4345824_4346700_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000189397.1|4346913_4347621_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001458941.1|4347622_4347772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508241.1|4347783_4347999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642925.1|4348090_4348501_+	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_000480477.1|4348566_4349505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234373.1|4349594_4350413_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4350504_4350990_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4351005_4351482_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4351550_4351772_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_000942525.1|4353055_4354126_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4354104_4354764_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4355283_4356537_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4356548_4357652_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4357939_4358995_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4359033_4359435_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4359492_4360737_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4360828_4361287_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4361547_4363005_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4363061_4363619_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4363530_4363797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4364103_4364556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4364565_4364964_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4364966_4365260_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4365311_4366367_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4366437_4367223_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4367167_4368907_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4369724_4370498_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4370683_4370944_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4370962_4371223_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4371378_4372119_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4372089_4372857_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4372961_4373540_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4373779_4376224_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4376266_4376740_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4376893_4377664_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4377781_4378954_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4379034_4379220_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4379134_4379398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4379599_4381360_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_070080248.1|4381362_4382499_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000339420.1|4383888_4385397_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000509109.1|4386436_4390669_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4390744_4392886_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4393095_4393614_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4394310_4394811_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4394845_4395070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4395120_4396512_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4396602_4397016_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4397019_4398870_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 14
NZ_CP038344	Escherichia coli O157:H7 strain Gim1-1 chromosome, complete genome	5408816	5037271	5051936	5408816	integrase,tail,tRNA	Enterobacteria_phage(43.75%)	19	5033112:5033127	5050641:5050656
5033112:5033127	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5037271_5038687_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5038769_5039753_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5039918_5040161_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5040294_5041332_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5041420_5042518_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5042579_5042828_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5042988_5043630_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5043711_5044341_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5044413_5044986_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5045097_5045367_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5045368_5046682_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5046746_5047346_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5048667_5049204_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5049194_5049545_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5049541_5049826_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5050161_5050359_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5050703_5050985_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5050641:5050656	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5051032_5051206_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5051402_5051936_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038345	Escherichia coli O157:H7 strain Gim1-1 plasmid pGM11-1, complete sequence	92577	24314	84757	92577	protease,integrase,transposase	Macacine_betaherpesvirus(22.22%)	53	11888:11903	52333:52348
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24314_25055_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25339_26317_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|29206_29989_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
WP_162829202.1|30520_31734_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000772446.1|32395_33562_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|33561_34533_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001414532.1|35227_36130_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|36133_36439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|36515_37199_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|37199_37421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|37314_37869_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|38998_39301_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|39347_39770_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|39766_39958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|40076_40466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|40953_41184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|41235_42597_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|42643_43207_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_087498072.1|43292_43772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|43841_44048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|44073_44526_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|44582_44816_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|44881_46840_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|46894_47329_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|47325_48087_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032169660.1|48318_48477_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|50699_51131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509912.1|52882_62392_+	toxin B	NA	NA	NA	NA	NA
52333:52348	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_000205762.1|64650_65397_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|65455_66316_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|66418_66979_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|67111_67324_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|67568_68030_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|68075_68285_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|68322_68661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|68900_69155_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|69390_69465_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|69457_70315_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|71226_71511_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|71510_71786_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|71880_72087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|72918_74131_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|74304_76515_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|76558_76948_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|78173_82076_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|82444_82825_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|82821_83169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|83218_84757_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
